ID: 1095267758

View in Genome Browser
Species Human (GRCh38)
Location 12:40180286-40180308
Sequence TTAAGGGCAATTTGGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095267758_1095267768 15 Left 1095267758 12:40180286-40180308 CCCACCCACCAAATTGCCCTTAA No data
Right 1095267768 12:40180324-40180346 AATGCTCAGAAAGACTGATTTGG No data
1095267758_1095267769 16 Left 1095267758 12:40180286-40180308 CCCACCCACCAAATTGCCCTTAA No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095267758 Original CRISPR TTAAGGGCAATTTGGTGGGT GGG (reversed) Intergenic
No off target data available for this crispr