ID: 1095267762

View in Genome Browser
Species Human (GRCh38)
Location 12:40180294-40180316
Sequence CAGAGTTTTTAAGGGCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095267762_1095267770 25 Left 1095267762 12:40180294-40180316 CCAAATTGCCCTTAAAAACTCTG No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data
1095267762_1095267768 7 Left 1095267762 12:40180294-40180316 CCAAATTGCCCTTAAAAACTCTG No data
Right 1095267768 12:40180324-40180346 AATGCTCAGAAAGACTGATTTGG No data
1095267762_1095267769 8 Left 1095267762 12:40180294-40180316 CCAAATTGCCCTTAAAAACTCTG No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095267762 Original CRISPR CAGAGTTTTTAAGGGCAATT TGG (reversed) Intergenic
No off target data available for this crispr