ID: 1095267763

View in Genome Browser
Species Human (GRCh38)
Location 12:40180302-40180324
Sequence TAGGGGAGCAGAGTTTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095267763_1095267770 17 Left 1095267763 12:40180302-40180324 CCCTTAAAAACTCTGCTCCCCTA No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data
1095267763_1095267769 0 Left 1095267763 12:40180302-40180324 CCCTTAAAAACTCTGCTCCCCTA No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data
1095267763_1095267768 -1 Left 1095267763 12:40180302-40180324 CCCTTAAAAACTCTGCTCCCCTA No data
Right 1095267768 12:40180324-40180346 AATGCTCAGAAAGACTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095267763 Original CRISPR TAGGGGAGCAGAGTTTTTAA GGG (reversed) Intergenic
No off target data available for this crispr