ID: 1095267766

View in Genome Browser
Species Human (GRCh38)
Location 12:40180320-40180342
Sequence ATCAGTCTTTCTGAGCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095267766_1095267770 -1 Left 1095267766 12:40180320-40180342 CCCTAATGCTCAGAAAGACTGAT No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095267766 Original CRISPR ATCAGTCTTTCTGAGCATTA GGG (reversed) Intergenic
No off target data available for this crispr