ID: 1095267767

View in Genome Browser
Species Human (GRCh38)
Location 12:40180321-40180343
Sequence AATCAGTCTTTCTGAGCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095267767_1095267770 -2 Left 1095267767 12:40180321-40180343 CCTAATGCTCAGAAAGACTGATT No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095267767 Original CRISPR AATCAGTCTTTCTGAGCATT AGG (reversed) Intergenic
No off target data available for this crispr