ID: 1095267769

View in Genome Browser
Species Human (GRCh38)
Location 12:40180325-40180347
Sequence ATGCTCAGAAAGACTGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095267762_1095267769 8 Left 1095267762 12:40180294-40180316 CCAAATTGCCCTTAAAAACTCTG No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data
1095267760_1095267769 12 Left 1095267760 12:40180290-40180312 CCCACCAAATTGCCCTTAAAAAC No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data
1095267763_1095267769 0 Left 1095267763 12:40180302-40180324 CCCTTAAAAACTCTGCTCCCCTA No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data
1095267764_1095267769 -1 Left 1095267764 12:40180303-40180325 CCTTAAAAACTCTGCTCCCCTAA No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data
1095267761_1095267769 11 Left 1095267761 12:40180291-40180313 CCACCAAATTGCCCTTAAAAACT No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data
1095267759_1095267769 15 Left 1095267759 12:40180287-40180309 CCACCCACCAAATTGCCCTTAAA No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data
1095267758_1095267769 16 Left 1095267758 12:40180286-40180308 CCCACCCACCAAATTGCCCTTAA No data
Right 1095267769 12:40180325-40180347 ATGCTCAGAAAGACTGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095267769 Original CRISPR ATGCTCAGAAAGACTGATTT GGG Intergenic
No off target data available for this crispr