ID: 1095267770

View in Genome Browser
Species Human (GRCh38)
Location 12:40180342-40180364
Sequence TTTGGGTAATAATAAAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095267763_1095267770 17 Left 1095267763 12:40180302-40180324 CCCTTAAAAACTCTGCTCCCCTA No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data
1095267764_1095267770 16 Left 1095267764 12:40180303-40180325 CCTTAAAAACTCTGCTCCCCTAA No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data
1095267762_1095267770 25 Left 1095267762 12:40180294-40180316 CCAAATTGCCCTTAAAAACTCTG No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data
1095267765_1095267770 0 Left 1095267765 12:40180319-40180341 CCCCTAATGCTCAGAAAGACTGA No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data
1095267766_1095267770 -1 Left 1095267766 12:40180320-40180342 CCCTAATGCTCAGAAAGACTGAT No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data
1095267761_1095267770 28 Left 1095267761 12:40180291-40180313 CCACCAAATTGCCCTTAAAAACT No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data
1095267760_1095267770 29 Left 1095267760 12:40180290-40180312 CCCACCAAATTGCCCTTAAAAAC No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data
1095267767_1095267770 -2 Left 1095267767 12:40180321-40180343 CCTAATGCTCAGAAAGACTGATT No data
Right 1095267770 12:40180342-40180364 TTTGGGTAATAATAAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095267770 Original CRISPR TTTGGGTAATAATAAAACTC TGG Intergenic
No off target data available for this crispr