ID: 1095267958

View in Genome Browser
Species Human (GRCh38)
Location 12:40181936-40181958
Sequence GAGGATAAGCAGGTGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095267958_1095267966 18 Left 1095267958 12:40181936-40181958 CCAGAATCCACCTGCTTATCCTC No data
Right 1095267966 12:40181977-40181999 CTCAGTGCTGGCTTTGGAAATGG No data
1095267958_1095267965 12 Left 1095267958 12:40181936-40181958 CCAGAATCCACCTGCTTATCCTC No data
Right 1095267965 12:40181971-40181993 CTGACTCTCAGTGCTGGCTTTGG No data
1095267958_1095267962 6 Left 1095267958 12:40181936-40181958 CCAGAATCCACCTGCTTATCCTC No data
Right 1095267962 12:40181965-40181987 GCCGACCTGACTCTCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095267958 Original CRISPR GAGGATAAGCAGGTGGATTC TGG (reversed) Intergenic
No off target data available for this crispr