ID: 1095270639

View in Genome Browser
Species Human (GRCh38)
Location 12:40214651-40214673
Sequence CTGCATCCACACATGGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1865
Summary {0: 1, 1: 6, 2: 64, 3: 390, 4: 1404}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095270639_1095270642 -5 Left 1095270639 12:40214651-40214673 CCTTTTGCCATGTGTGGATGCAG 0: 1
1: 6
2: 64
3: 390
4: 1404
Right 1095270642 12:40214669-40214691 TGCAGCAAGAAGGCACCATCTGG 0: 1
1: 1
2: 6
3: 21
4: 240
1095270639_1095270645 30 Left 1095270639 12:40214651-40214673 CCTTTTGCCATGTGTGGATGCAG 0: 1
1: 6
2: 64
3: 390
4: 1404
Right 1095270645 12:40214704-40214726 TGACCAGACAAAAGATCTGATGG 0: 1
1: 0
2: 2
3: 27
4: 311
1095270639_1095270643 4 Left 1095270639 12:40214651-40214673 CCTTTTGCCATGTGTGGATGCAG 0: 1
1: 6
2: 64
3: 390
4: 1404
Right 1095270643 12:40214678-40214700 AAGGCACCATCTGGAAGAACAGG 0: 1
1: 0
2: 0
3: 23
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095270639 Original CRISPR CTGCATCCACACATGGCAAA AGG (reversed) Intronic
900010652 1:104019-104041 CTGTTTCCACTCATGGCAGAAGG - Intergenic
900036551 1:414488-414510 CTGTTTCCACTCATGGCAGAAGG - Intergenic
900058180 1:650242-650264 CTGTTTCCACTCATGGCAGAAGG - Intergenic
900731754 1:4266524-4266546 CTGCATCGTCCCATGGCAGAAGG - Intergenic
900909840 1:5587244-5587266 CCACATCCTCACATGGCAGAAGG - Intergenic
900932015 1:5743636-5743658 CTGCATCCACACCTGGGGGACGG - Intergenic
901254594 1:7811598-7811620 CTGTGTCCTCACATGGCACAAGG + Intronic
901276808 1:7997963-7997985 CTGCTTCCACTCATGGCAGAAGG - Intergenic
901327947 1:8380199-8380221 CTTCATGCCCACATGGCAAAAGG + Intronic
902097340 1:13957607-13957629 CTGCTTCTACTCATGGCAGAAGG + Intergenic
902154348 1:14472080-14472102 CTGCTTACTCACATGGCAGAAGG + Intergenic
902161061 1:14530677-14530699 AAGCTTCCACTCATGGCAAAAGG - Intergenic
902189489 1:14752021-14752043 CTGCTTCCACTCATGGCAGAAGG + Intronic
902265542 1:15260879-15260901 CTGCTGCCTTACATGGCAAAGGG - Intronic
902313108 1:15597114-15597136 CTGCTTCCACTCATGGCAAATGG - Intergenic
902735128 1:18395514-18395536 CTGCTTCCACTCCTGGCAGAAGG - Intergenic
902967172 1:20014050-20014072 CTGTGTCCTCACATGGCAGAAGG + Intergenic
903002843 1:20278717-20278739 CTGCTTCCACTCATGGCAGAGGG + Intergenic
903834625 1:26195389-26195411 CTGCTTCCACTCATGGCAGAAGG + Intronic
904079622 1:27863784-27863806 CTGCATCATAACATGGCAGAGGG - Intergenic
904114517 1:28151745-28151767 CTGTGACCTCACATGGCAAAAGG - Intronic
904299235 1:29543467-29543489 CTGCATCCTCACATGGCAGAAGG - Intergenic
904352854 1:29920271-29920293 CTGTGTCCTCACATGGCAGAAGG - Intergenic
904393563 1:30202256-30202278 CTGTATCCTCACATGTCAGAAGG + Intergenic
905000453 1:34664045-34664067 CTGTGTCCTCACATGGCAGAAGG - Intergenic
905495295 1:38380264-38380286 CTGCTTCCACTCATGGCAGTAGG + Intergenic
905931401 1:41790330-41790352 CTGCTTCCACTCATGGTAGAGGG - Intronic
905966060 1:42096711-42096733 CTGCTTCCACTCATGGCAGAAGG + Intergenic
906745663 1:48220698-48220720 CTGTGTCCTCACATGGCAGAAGG + Intergenic
906896799 1:49782809-49782831 CTGCATCATCTCATGGCAGAAGG - Intronic
907067390 1:51499034-51499056 CTGCATCCTCATATGGTAGAAGG - Intronic
907151239 1:52290191-52290213 CTGCATCATCCCATGGCAGAAGG + Intronic
907365389 1:53954715-53954737 CAGTATCCAGACATCGCAAATGG - Intronic
907665353 1:56429530-56429552 CTGAATCCTCACATGACAGAAGG - Intergenic
907695633 1:56725068-56725090 CTGCTTCTACTCATGGCAGAAGG - Intronic
907844678 1:58193299-58193321 CTGCTTCCATTCATGGCAGAAGG - Intronic
907955223 1:59221803-59221825 CTGTGTCCTCACATGGCAAAAGG - Intergenic
907979674 1:59469354-59469376 CTGCATCATCCCATGGCAAAGGG + Intronic
908094942 1:60727852-60727874 CTGCTTCCACTTATGGCAGAAGG - Intergenic
908158930 1:61386947-61386969 CTGTGTCCTCACATGGCAGAAGG + Intronic
908499475 1:64728910-64728932 CTGTGTCCTCACATGGCAGAAGG - Intergenic
908549172 1:65192247-65192269 CTGCATCATCCCATGGCAGAAGG + Intronic
908901103 1:68957540-68957562 CTGTGTCCTCACATGGCAGAAGG - Intergenic
909029399 1:70522245-70522267 TTGCATCCTCATATGGCAGAGGG + Intergenic
909052419 1:70782637-70782659 CTGCATCCTCACATGGTGGAAGG - Intergenic
909107696 1:71433122-71433144 CCGTATCCTCACATGGCAGAAGG - Intronic
909115935 1:71536460-71536482 TTGCTTCCACTCATGGCAGAGGG - Intronic
909364892 1:74808117-74808139 CTGCTTCCACTCATGGCAGAAGG + Intergenic
909410908 1:75350225-75350247 CTGTGTCCTCACACGGCAAAGGG - Intronic
909694255 1:78448219-78448241 CTGCTTCCACTCATGGCAGAAGG + Intronic
909749082 1:79136498-79136520 CTGCATCCTTACATGGCAGAAGG + Intergenic
909814302 1:79972184-79972206 ATGCATTCACACAAAGCAAAGGG + Intergenic
909831827 1:80201970-80201992 CTGCATCTTCATATGGCAGAAGG + Intergenic
910002119 1:82353804-82353826 CTGTGTCCACTCATGGCAGAAGG + Intergenic
910191082 1:84596513-84596535 CCACATCCTCACATGGCAGAAGG + Intergenic
910217494 1:84857045-84857067 CTGCCTTGACAGATGGCAAATGG - Intronic
910270402 1:85387884-85387906 CTGCTTCCACTCATGGCAGAAGG + Intronic
910656094 1:89620146-89620168 CTGCATCTTCATATGGCAAAAGG + Intergenic
910832144 1:91471671-91471693 CTGAGTCCTCACATGGAAAAAGG - Intergenic
911000731 1:93162917-93162939 ATGCTACCACACCTGGCAAATGG - Intronic
911071504 1:93835477-93835499 CTCCTCCCACACAAGGCAAATGG + Intronic
911217015 1:95205975-95205997 TTGCATCCTCATATGGCAGAAGG + Intronic
911228029 1:95328956-95328978 CTGCATCTTCACATGGCAGAAGG + Intergenic
911259002 1:95664660-95664682 GTTCATCCATTCATGGCAAATGG - Intergenic
911259344 1:95667726-95667748 GTGCATCCTCACTTGGCAGAAGG + Intergenic
911262245 1:95700786-95700808 CTACATCCTCACCTGGCAAAAGG + Intergenic
911326231 1:96472630-96472652 CTCCTTCCTTACATGGCAAAAGG - Intergenic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
911997219 1:104781464-104781486 CAGCATCCAAACTTGGCAGATGG - Intergenic
912367330 1:109145186-109145208 CTGCATCCTCACATGGCAGAAGG - Intronic
912410040 1:109474814-109474836 CAGCATCAACAGATGACAAAGGG + Intronic
912647945 1:111412938-111412960 GTGCATACACACACGGCAAAAGG + Intergenic
912695642 1:111840081-111840103 CTGCATCCTCACATGGTGGAAGG + Intronic
912740191 1:112187332-112187354 CTATATACATACATGGCAAATGG - Intergenic
912774358 1:112495921-112495943 CTGGATCTTCACATGGCAGAAGG + Intronic
912864627 1:113246235-113246257 CTGCATCGTCCCATGGCAGAAGG - Intergenic
912883750 1:113447307-113447329 CTGCATTGTCCCATGGCAAAAGG + Intronic
913116150 1:115699184-115699206 CTGCTTCCATTCATGGCAGAAGG - Intergenic
913122981 1:115758779-115758801 CTGCTTCCACTCATGGCAGAAGG - Intronic
913240852 1:116828009-116828031 CTGCTTCCACTCATGGTAGAAGG + Intergenic
913352487 1:117876333-117876355 CTGCTTCCACTCACGGCAGAAGG - Intronic
913435247 1:118840957-118840979 CTGCATCCTCACATGGCAGAAGG + Intergenic
913686256 1:121234850-121234872 CTGCATCATCCCATGGCAGAAGG - Intronic
914038107 1:144022472-144022494 CTGCATCATCCCATGGCAGAAGG - Intergenic
914151347 1:145045468-145045490 CTGCATCATCCCATGGCAGAAGG + Intronic
914354649 1:146873759-146873781 CTGCATCGTAACATGGCAGATGG + Intergenic
914382834 1:147134169-147134191 CTGCTTCCACTCATGGCAGAAGG + Intergenic
914395306 1:147261327-147261349 CTGCATCCTCACATGACAGAAGG + Intronic
914438110 1:147678695-147678717 CTGCATCATCCCATGGCAGAAGG + Intergenic
915819320 1:159005118-159005140 CTGTGTCCTCACATGACAAACGG - Intronic
916398110 1:164413713-164413735 CTGCATCCTCACAAGGTAGAAGG - Intergenic
916458648 1:164997551-164997573 CTACATCCACACATGTGCAAAGG + Intergenic
916539223 1:165736097-165736119 CTGCATCCTCACATGGTGGAAGG - Intronic
916760314 1:167810469-167810491 CTGTGTCCTCACATGTCAAAAGG - Intronic
916816982 1:168363683-168363705 CTGCAACCTCACATGGCAGAAGG - Intergenic
917246992 1:173014169-173014191 CTGCAGCCTCACATGGCAGAAGG - Intergenic
917265904 1:173220669-173220691 CTGTATCCTCACATGGCAGAGGG - Intergenic
917285694 1:173419417-173419439 CTGCATCCTCACGTGGCAGAGGG - Intergenic
917347811 1:174046826-174046848 CTGCATCCTCACATGGCGGAAGG + Intergenic
917491218 1:175500336-175500358 CTACATCCACACAAGAAAAATGG - Intronic
917575284 1:176314747-176314769 CTGCTTCTACTCATGACAAAAGG - Intergenic
918025490 1:180740886-180740908 CTGTGTCCTCACATGGTAAAAGG + Intronic
918138066 1:181694580-181694602 CTGCATCATCTCATGGCAGAAGG - Intronic
918272759 1:182919316-182919338 TTGGATCCTCACATGGCAAAAGG + Intronic
918334219 1:183491909-183491931 CTGTGTCCACATATGGCAGAAGG + Intronic
918681990 1:187367328-187367350 CTGCATCCTCACATGGCAGAAGG + Intergenic
918740616 1:188126699-188126721 CTTCATCCTCACATGGCAGAAGG + Intergenic
918791371 1:188834558-188834580 CTGCATCCTCACAAGGCAGAAGG - Intergenic
919057913 1:192593658-192593680 CTGCATCATCCCATGGCAGAAGG + Intergenic
919130161 1:193441065-193441087 CTGCATCATAACATGGCAGAAGG - Intergenic
919410600 1:197237394-197237416 CAGCATCCTCACATGGTGAAAGG + Intergenic
919440756 1:197630370-197630392 CTGCATCCTCACACGGCAGGAGG + Intronic
919588435 1:199468932-199468954 CTGCATCCTTACATGTCAGAGGG + Intergenic
919588488 1:199469462-199469484 CTGCATCCTCACATGACAGAGGG + Intergenic
920159550 1:203985787-203985809 CTGCATCAACCCATGGCAGAAGG + Intergenic
920252803 1:204633143-204633165 CTGTTTCCTCACATGGCAGAAGG - Intronic
920396133 1:205647506-205647528 CTGTGTCCTCACATGGCAGAAGG + Intergenic
920411185 1:205762183-205762205 CTGCTTCCTCACATGGCAGAAGG - Intergenic
920473578 1:206253409-206253431 CTGCATCATCCCATGGCAGAAGG - Intronic
920909181 1:210198298-210198320 CTGCATCCTTACATGGTAGAAGG + Intergenic
921040070 1:211422586-211422608 CTGCTTCCACTCATGGCAGAAGG + Intergenic
921231854 1:213081291-213081313 TTGCTTCCACTCATGGCAGAAGG + Intronic
921249749 1:213285850-213285872 CTGCATCCTCACATGGTGGAAGG - Intergenic
921718980 1:218449778-218449800 CTGCATCCTCACATGGTAGCAGG + Intergenic
921969133 1:221126009-221126031 TTGCAGCCTCACATGGCAGAGGG - Intergenic
921980592 1:221253581-221253603 CTGCTTCCACTCATGGCAGAAGG + Intergenic
922042110 1:221906690-221906712 CTGCTTCCATTCATGGCAGAAGG + Intergenic
922178879 1:223218054-223218076 CTGCTTCCACTCATGGCAGAAGG - Intergenic
922259092 1:223920026-223920048 CTGTTTCCACTCATGGCAGAAGG - Intergenic
922331371 1:224579819-224579841 CTGTCTCCAATCATGGCAAATGG - Intronic
922332596 1:224590557-224590579 CTGTATCATCACATGGCAGAAGG + Intronic
922348320 1:224715631-224715653 CTGCTTCCACTCGTGGCAGAAGG + Intronic
922438134 1:225626506-225626528 CTGCATTCTCACATGGTAGAAGG - Intronic
922529750 1:226335412-226335434 CTGCTTTCTCACATGGCGAAAGG - Intergenic
922712088 1:227841942-227841964 CTGCTTCCACTCATGGGGAAGGG + Intronic
923027516 1:230217744-230217766 CTGTATCCTCACATGGCAGAAGG + Intronic
923319455 1:232816264-232816286 CTGCATCATAACATGGCCAAAGG + Intergenic
923379733 1:233404139-233404161 CTGCTTCCACTCATGGTGAAAGG - Intergenic
923416860 1:233770867-233770889 CTTCTTCCTCACATGGCAGAAGG - Intergenic
923676854 1:236087869-236087891 CTGTGTCCTCACATGGCAGAAGG + Intergenic
923721955 1:236474458-236474480 AAGCATCAAAACATGGCAAATGG + Intronic
923775779 1:236977386-236977408 CTGCATCTTCAGATGGCAAAAGG + Intergenic
924340282 1:243022776-243022798 CTGTTTCCACTCATGGCAGAAGG - Intergenic
924494866 1:244577595-244577617 CTGTGTCCTCACATGGCAGAAGG + Intronic
924498812 1:244616540-244616562 CTGCATCATCAGATGGCAGAAGG + Intronic
924690093 1:246339860-246339882 CTGCATCCTAGCATGGCAGAAGG - Intronic
1062917409 10:1251831-1251853 CTGTATCCTCACATGGCAGATGG - Intronic
1063041132 10:2338374-2338396 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063329874 10:5147079-5147101 CTGCTTCCATTCATGGCAAAAGG + Intergenic
1063347859 10:5327887-5327909 CTGCTTCCACTCATGGCAGATGG + Intergenic
1063541267 10:6936650-6936672 CTGCATCATAACATGGCAGAAGG - Intergenic
1063544261 10:6964562-6964584 CTGCATCCTCACATGATGAAAGG - Intergenic
1063559131 10:7110215-7110237 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063866594 10:10372021-10372043 CTGATTCCATACATGTCAAAAGG - Intergenic
1063897508 10:10697641-10697663 CTGCATCCTCACATGGCAAAAGG + Intergenic
1063967587 10:11359010-11359032 CTGTATCCTCACATGGCAGAAGG - Intergenic
1064184273 10:13147208-13147230 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1064235713 10:13572714-13572736 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1064630973 10:17310382-17310404 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1064693522 10:17942108-17942130 CTGCATCATGACATGGCAGAAGG - Intergenic
1064874514 10:19977719-19977741 CTGTAACCTCACATGGCAGAGGG + Intronic
1064990387 10:21251733-21251755 CTGTGTCCTCATATGGCAAAAGG - Intergenic
1064992054 10:21264875-21264897 CTGCATCCTCACGTGACAATAGG + Intergenic
1065228826 10:23575562-23575584 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1065261032 10:23923413-23923435 CTACATCCTTATATGGCAAAGGG + Intronic
1065385342 10:25128218-25128240 CTGCTTCCACTCATGGTAGAAGG - Intergenic
1065433563 10:25684135-25684157 CTGCATCCTCACATGGTGGAAGG + Intergenic
1065871379 10:29959139-29959161 CTGTATCTTCACATGGCAGAAGG - Intergenic
1066006916 10:31154168-31154190 CTGCTTCCACTCATGGCAGAGGG + Intergenic
1066020085 10:31289723-31289745 CTGTGTCCTCACATGGCAGATGG - Intergenic
1066148394 10:32587352-32587374 CTGCATCATCCCATGGCAGAAGG + Intronic
1066224667 10:33370527-33370549 CTGCTTCCACTCATGGCGGAAGG + Intergenic
1066434960 10:35389072-35389094 CTGCAATCTTACATGGCAAAGGG - Intronic
1066444338 10:35468186-35468208 GTGTAACCTCACATGGCAAAAGG + Intronic
1066501649 10:36000750-36000772 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1066537895 10:36411234-36411256 CTGCATCCTCCCATGGCAGAAGG - Intergenic
1066630024 10:37450138-37450160 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1066650444 10:37650324-37650346 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1066736217 10:38482830-38482852 CTGTTTCCACTCATGGCAGAAGG + Intergenic
1067033451 10:42896460-42896482 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1067141670 10:43663058-43663080 CTGCTTCCCCTCATGGCAGAAGG + Intergenic
1067468837 10:46521846-46521868 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1067799425 10:49348847-49348869 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1067846452 10:49725927-49725949 CTGTGTCCTCACATGGCAGATGG - Intergenic
1067914049 10:50377205-50377227 CTGCATCAAAACATGTCAGAAGG + Intronic
1068068793 10:52169381-52169403 CTGTAACCTCACATGGCAGAAGG + Intronic
1068314865 10:55327181-55327203 ATGTATCCTCACATGGCAGAAGG - Intronic
1068343252 10:55736935-55736957 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1068524774 10:58116080-58116102 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1068660057 10:59614447-59614469 CTGCATCCCCACAAGGTGAAAGG + Intergenic
1068766788 10:60773383-60773405 CTGCAGCCTCACGTGGCAGAAGG + Intergenic
1068863687 10:61872178-61872200 CTGTATCCTCACATGGGGAAAGG + Intergenic
1068902669 10:62287487-62287509 ATGTATCCTCACATGGCAGAAGG + Intergenic
1068944675 10:62717902-62717924 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1069045341 10:63737320-63737342 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1069054379 10:63829608-63829630 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1069183537 10:65393410-65393432 CTGCAACCTCACATGGCAGAGGG + Intergenic
1069205544 10:65679758-65679780 CAGCAAGCATACATGGCAAAAGG + Intergenic
1069269382 10:66506023-66506045 CTGCTTCCACTCATGGCAGAAGG + Intronic
1069363880 10:67675706-67675728 TTGCAAAGACACATGGCAAAGGG + Intronic
1069656366 10:70092163-70092185 CTGTGTCCTCACATGGCAGAAGG - Intronic
1069801050 10:71081775-71081797 CTGCACCCCTACATGGCAGAGGG + Intergenic
1070256320 10:74815735-74815757 CTACGTCCTCACATGGCAGACGG + Intergenic
1070583575 10:77743480-77743502 CTGTGTCCTCACATGGTAAAGGG - Intergenic
1070654098 10:78259221-78259243 CTTCATCCTCACATAGCAGAAGG - Intergenic
1070874749 10:79792627-79792649 TTGCTTCCACTCATGGCAAAAGG - Intergenic
1071223861 10:83502335-83502357 CTGCTTCCATTCATGGTAAAAGG - Intergenic
1071225467 10:83523698-83523720 CTGCTTCCACTCATGGCAGATGG + Intergenic
1071388307 10:85144035-85144057 CTGCATCCTCACATGGCAGAAGG - Intergenic
1071533516 10:86407993-86408015 CTGCATCCTCACATGGCAGAAGG + Intergenic
1071641674 10:87314796-87314818 TTGCTTCCACTCATGGCAAAAGG - Intergenic
1071725715 10:88196456-88196478 CTGCAATATCACATGGCAAAGGG - Intergenic
1071918704 10:90325527-90325549 CTGCATCATCACATGTCAGAAGG + Intergenic
1071966868 10:90860395-90860417 CTGTGTCCTCACCTGGCAAAGGG + Intergenic
1072100174 10:92221869-92221891 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072171093 10:92862491-92862513 CTGCATCCTCACATGGTGGAAGG - Intronic
1072313613 10:94180816-94180838 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072362416 10:94672897-94672919 CTGTATTCACACATAACAAAAGG - Intergenic
1072494669 10:95945033-95945055 CTGTGTCCTCACATGGCAGATGG - Intergenic
1072868759 10:99093601-99093623 CTGCATCATCACATAGCAGAAGG + Intronic
1072995675 10:100241699-100241721 CTGCATCATCCCATGGCAGAAGG + Intronic
1073148527 10:101296065-101296087 CTGCATTCTCACACGGCAGAAGG - Intergenic
1073703083 10:105952177-105952199 CTGCCTCCATACCTAGCAAATGG + Intergenic
1073722458 10:106188576-106188598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1073806752 10:107106867-107106889 TTGTATCCTCACATGGCAGAAGG - Intronic
1073940416 10:108691612-108691634 CTGGATCCTCACATAGCAGAAGG + Intergenic
1074244995 10:111680770-111680792 CTGCATCCTCATATGGCAGAAGG - Intergenic
1074279277 10:112035703-112035725 CTGCATCATCACATGGCAGAAGG + Intergenic
1074451807 10:113565414-113565436 CTGCCTCCACTCATGGCAAAAGG + Intronic
1074590688 10:114810162-114810184 CTGCATCGTCCCATGGCAGAAGG + Intergenic
1074620225 10:115111473-115111495 CTGCGTCTACTCATGGCAGAAGG + Intronic
1074656393 10:115593095-115593117 CTGCATCATCCCATGGCAGAAGG + Intronic
1074754508 10:116614500-116614522 CTGTATCCTCATATGGTAAAAGG - Intergenic
1074800124 10:116991434-116991456 CTGCTTCCACCCCTGGCAGAAGG + Intronic
1074982669 10:118632291-118632313 CTGCTTCCACTCATGGAAGAAGG - Intergenic
1075009170 10:118853272-118853294 CTGTATCCTCACATGGCAGAGGG + Intergenic
1075145251 10:119877204-119877226 CTGCATCATCATAAGGCAAAGGG - Intronic
1075183342 10:120232275-120232297 CTGCATCCTCACATAGTAGAAGG - Intergenic
1075350958 10:121724981-121725003 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075436191 10:122444675-122444697 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075510395 10:123067625-123067647 CTGCTTCCTCCCATGGCAAAGGG + Intergenic
1075581634 10:123623199-123623221 CTGCTTCCTCGCATGGCAGAAGG - Intergenic
1075601310 10:123771470-123771492 CTGCATCCTCCCATGGCAGATGG - Intronic
1075877696 10:125822200-125822222 CTGCATCCCCACCTGCCACAGGG + Intronic
1077308881 11:1879821-1879843 CTTCATCCCCACAGGGCACAGGG + Intronic
1077378882 11:2218745-2218767 CTGCATCCACTCATGGCGGGAGG + Intergenic
1077439523 11:2561552-2561574 CAGCATCCACACCTGTAAAATGG - Intronic
1078087116 11:8240625-8240647 CTGCATCCTCACGTGGCAGAAGG + Intronic
1078258873 11:9685504-9685526 CTGTATCCTCACATGGCAGAAGG + Intronic
1078326729 11:10387349-10387371 CTGGATCCAGACACGGCAATTGG + Intronic
1078445349 11:11400657-11400679 CTGTGTCCTCACATGGCAAAAGG + Intronic
1078471944 11:11595321-11595343 CTGTGTCCTCACATGGTAAAAGG - Intronic
1078477423 11:11643116-11643138 CTGCATCATAACATGGCGAAAGG + Intergenic
1078723514 11:13906197-13906219 CTGCTTCCACTCATGGTGAAAGG + Intergenic
1078863995 11:15279862-15279884 CTGCCTCCTCACTTGGCAGAAGG - Intergenic
1079139202 11:17796537-17796559 CTGCATCATAACATGGCAAAAGG - Intronic
1079628027 11:22639358-22639380 CTGCTTCAAAACATGGCAGAAGG - Intronic
1079651387 11:22934324-22934346 TTACATCCTCACATGGCAGAAGG - Intergenic
1080081847 11:28229601-28229623 CTGTGTCCTCACATGGCAGAAGG - Intronic
1080232732 11:30035736-30035758 CTGCATCCTCATATGGCAGTAGG - Intergenic
1080257344 11:30305843-30305865 CTTCATCCTCACATGGTGAAAGG + Intergenic
1080307788 11:30855019-30855041 CCGCATCATCACATGGCAGAAGG - Intronic
1080314063 11:30928244-30928266 CAGCTTCCACTCATGGCAGAAGG - Intronic
1080335333 11:31188976-31188998 CTGCATCCTCACATGGTGGAGGG - Intronic
1080397284 11:31901942-31901964 CTGAGTCCTCACATGGCAGAAGG + Intronic
1080420936 11:32109922-32109944 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1080422693 11:32125764-32125786 CTGCATCCTCAGAGGGCAAAAGG - Intergenic
1080577210 11:33610882-33610904 CTGCATCATCCCATGGCAGAAGG + Intronic
1080827052 11:35857247-35857269 CTGCATCCTCACCTGGTAGAAGG + Intergenic
1080928947 11:36787354-36787376 ATGTCTCCTCACATGGCAAAAGG - Intergenic
1081327544 11:41764163-41764185 CTGCTTCCACTCATGGCGGAAGG + Intergenic
1081337090 11:41880106-41880128 TTGCGTCCTCACGTGGCAAAAGG - Intergenic
1081439137 11:43061251-43061273 CTGCATCCTCACATGGTGGAAGG + Intergenic
1081638075 11:44734137-44734159 CTGCTTCCACTCAGGGCAGAAGG - Intronic
1081740561 11:45436690-45436712 CTGCATCATAACATGGCAGAAGG + Intergenic
1082312918 11:50676055-50676077 ATGAATGCACACATGCCAAATGG + Intergenic
1082687510 11:56259080-56259102 CTGCATCCTCACATGGCAGAAGG + Intergenic
1082777091 11:57254162-57254184 CTTCTTCCACTCATGGCAGAAGG + Intergenic
1082943676 11:58735411-58735433 CTACTTCCACACATGGCATAAGG - Intergenic
1083596918 11:63922093-63922115 CTGCATCCTCACATGGCAGCAGG - Intergenic
1083708453 11:64532512-64532534 CTGCATCATCTCATGGCAGAAGG + Intergenic
1084081106 11:66825528-66825550 CTGTGTCCTCACATGGCAGAAGG - Intronic
1084158345 11:67328934-67328956 TTGCGTCCTCACATGGCAGAAGG + Intronic
1084421316 11:69062091-69062113 AAGCATCCACTCATGGCAGAAGG + Intronic
1084489846 11:69472255-69472277 CTGCATTCTCACTTGGCACAGGG - Intergenic
1085068374 11:73518958-73518980 CTGCTTCCACTCATGGCAGAAGG - Intronic
1085110918 11:73887017-73887039 CTGCTTCCACTCATGGCAGAAGG - Intronic
1085235906 11:75015230-75015252 CTGCATCCTCACATGACTGAAGG - Intronic
1085846457 11:80071395-80071417 CTGCATTTTCACATGGCAGAAGG - Intergenic
1086086334 11:82958554-82958576 CTGCATCCTCACATGATGAAAGG - Intronic
1086160759 11:83719511-83719533 GTGCTTCCACTCCTGGCAAAAGG + Intronic
1086385165 11:86299653-86299675 CCTCATCCACACCTTGCAAAAGG - Intergenic
1086391581 11:86370430-86370452 CTGCTTCCATTCATGGCAAAAGG - Intergenic
1086445520 11:86866875-86866897 CTGCTTCCACTCATGGCAGAAGG - Intronic
1086509046 11:87536295-87536317 CTGCATCATCAAATGGCAGAAGG - Intergenic
1086845584 11:91746081-91746103 TTGCATCCTTACATGGCAAGAGG - Intergenic
1086965148 11:93019695-93019717 CTGCATCAAAACGTGGCAGAAGG + Intergenic
1086974686 11:93118418-93118440 TTGTGTCCTCACATGGCAAAAGG + Intergenic
1087097158 11:94330209-94330231 CTGCATTCTCACATGGTGAAAGG + Intergenic
1087219524 11:95531315-95531337 CTGCTTCCACTCATGGTGAAAGG - Intergenic
1087401762 11:97675859-97675881 CTGCATCCTAACATGGCAGAAGG + Intergenic
1087409315 11:97770710-97770732 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1087500807 11:98951351-98951373 TTGTATCCTCACATGACAAAAGG + Intergenic
1087604968 11:100366332-100366354 CTGCCTGCACACAAGGCAGAGGG + Intergenic
1087698351 11:101407151-101407173 CTGCATCCTTACATGGCAAAAGG + Intergenic
1087923147 11:103890055-103890077 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1087955056 11:104276034-104276056 TGGCATCCACATATGGCAAGTGG + Intergenic
1088057019 11:105595989-105596011 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1088163027 11:106896666-106896688 CTGCATCCTCATGTGGCAGAAGG - Intronic
1088269567 11:108019876-108019898 CTGCTTCTACTCATGGCAGAAGG + Intronic
1088338555 11:108736710-108736732 CTGCATCCTCACATGGCAGAAGG - Intronic
1088375229 11:109133521-109133543 CTGTATCCTCACGTGACAAAAGG - Intergenic
1088418253 11:109613404-109613426 CTGCTTTCACTCATGGCACAAGG - Intergenic
1088489775 11:110375612-110375634 CTGCATTCTCACATGGTAGAAGG - Intergenic
1088571563 11:111228382-111228404 CTCCATCTTCACATGGCAGAAGG + Intergenic
1088965875 11:114720534-114720556 TAGCAGCCACACATGGCAAGTGG - Intergenic
1089143831 11:116309852-116309874 CTGTGTCCTCACATGGCTAAAGG - Intergenic
1089238750 11:117055854-117055876 CTGTGTCCTCACATGGCAGAAGG - Intronic
1089333877 11:117709357-117709379 CTGTGTCCTCACATGGCAGATGG + Intronic
1089630847 11:119783305-119783327 CTGCATCATCCCATGGCAGAAGG + Intergenic
1089768063 11:120782897-120782919 CTGCATCCTCACAAGGCAGGAGG + Intronic
1090105784 11:123852547-123852569 CTGTTTCCACTCATGGCAGAAGG - Intergenic
1090374472 11:126279280-126279302 CTGCATCCTCACATGGCAGAAGG + Intergenic
1090585436 11:128206890-128206912 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1090697959 11:129267808-129267830 CTGCTTCTACTCATGGCAGAAGG + Intronic
1090742843 11:129681878-129681900 CTGCGTCCTCACATGGCAGGTGG - Intergenic
1090886446 11:130881022-130881044 CTGTGTCCTCATATGGCAAAAGG - Intronic
1090972417 11:131654777-131654799 GAGCTTCCACTCATGGCAAAAGG - Intronic
1091039401 11:132262531-132262553 CTGCTTCCTCACATGGCAGGGGG + Intronic
1091553872 12:1557458-1557480 CTGTGTCCTCACATGGCAGAAGG + Intronic
1091628197 12:2138698-2138720 CTGCTTCCACTCATGGCAGAAGG - Intronic
1091910705 12:4228314-4228336 CTGCTTCCACTCATGGCGGAAGG - Intergenic
1092730923 12:11533680-11533702 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1092747946 12:11691108-11691130 CTGTGTCCTCACATGGCAGAAGG + Intronic
1092787709 12:12043238-12043260 CTGTATCCTTACATGGCAGAAGG + Intergenic
1093012648 12:14125411-14125433 CTGCTTCCACTCATGGTGAAAGG + Intergenic
1093021613 12:14209176-14209198 CCACATCCTCACATGGCAGAAGG + Intergenic
1093269493 12:17041776-17041798 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1093271173 12:17064025-17064047 CTGCTTTCTCACATGGCAAGAGG + Intergenic
1093411706 12:18876124-18876146 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1093477902 12:19574854-19574876 CACAATCCACACATGGCACATGG - Intronic
1093486194 12:19655729-19655751 TGGCATCCTCACATGGCAGAAGG - Intronic
1093510641 12:19923070-19923092 ATGCATCCACTCATGGCAGAAGG - Intergenic
1093558959 12:20515005-20515027 CTGCATCATCACATGGCAGAAGG + Intronic
1093681010 12:22003447-22003469 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1093696723 12:22169488-22169510 CTGCTTCCACACATGGCAGAAGG + Intronic
1093754131 12:22833340-22833362 CTGTATCCTGACATGGCAAAGGG - Intergenic
1093770670 12:23014004-23014026 CTGCATCCTGACATGGTGAAGGG + Intergenic
1093798567 12:23343761-23343783 CTGCTTCCTCACATGGAAGAAGG - Intergenic
1094023999 12:25943047-25943069 CTGCTTCCACTCATGGCCAAAGG + Intergenic
1094282257 12:28753309-28753331 AAGCTTCCACTCATGGCAAAAGG - Intergenic
1094564201 12:31584937-31584959 CTGCTTCCTCTCATGGCAGAAGG + Intronic
1094818883 12:34209868-34209890 CTGCTTCCACTCATGACAGAAGG - Intergenic
1095041981 12:37453513-37453535 CTGCATCTTCACATGGCATAAGG + Intergenic
1095143142 12:38691789-38691811 CTGTATCCTCACATCGCAGAAGG + Intronic
1095192718 12:39276179-39276201 CAGCAGCCACACATGGCTAGAGG - Intergenic
1095270639 12:40214651-40214673 CTGCATCCACACATGGCAAAAGG - Intronic
1095309995 12:40687431-40687453 CTGCATCATCCCATGGCAGAGGG - Intergenic
1095343147 12:41116550-41116572 CTGCATCTTCACATGGCAGAAGG - Intergenic
1095530198 12:43178031-43178053 CTGCTTCCACTCATGACTAAAGG - Intergenic
1095608628 12:44101054-44101076 CTGCATCCTTACATAGTAAAAGG + Intronic
1095671519 12:44866071-44866093 CTGTATCCTCACATGGCAGAAGG - Intronic
1095717286 12:45360333-45360355 CTGCATCTTCACATAGCAGAAGG + Intronic
1096350188 12:50891771-50891793 CTGTGTCCTCACATGGCAAAAGG + Intergenic
1096516545 12:52158931-52158953 CTGCATCATGACATGGCAGAAGG + Intergenic
1096864531 12:54554427-54554449 CTGCTTCCAGCCATAGCAAAGGG + Intronic
1097073683 12:56376284-56376306 CTGTGTCCTCACATGGCACATGG + Intergenic
1097308908 12:58097546-58097568 CTGCATCCTCACATGGTAGAAGG + Intergenic
1097384938 12:58939536-58939558 CTGTGTCCTCACTTGGCAAAGGG + Intergenic
1097515460 12:60599239-60599261 CTGCATCATCCCATGGCAGAAGG - Intergenic
1097574139 12:61370161-61370183 CTTGATCCTCACATGGCAGAAGG - Intergenic
1097754623 12:63395982-63396004 CTGCATCCTCACATGGCGGAAGG + Intergenic
1097842099 12:64331665-64331687 CTGCATGCTCACATGGCAGGAGG - Intronic
1097863290 12:64539201-64539223 CTGCATCATAACATGGCAGAGGG + Intergenic
1098015802 12:66103423-66103445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098194287 12:67983490-67983512 CTGCTTCCACTTATGGCAGAAGG - Intergenic
1098209387 12:68147558-68147580 CTGCATCACAACCTGGCAAAAGG + Intergenic
1098327063 12:69313846-69313868 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098756875 12:74375089-74375111 CTGCATCCACATATCGGACAAGG + Intergenic
1099339469 12:81410072-81410094 ATGCGTCCTCACATGGCAGAAGG - Intronic
1099494473 12:83329041-83329063 CTGTATCCTCACATGGTAGAAGG - Intergenic
1099507500 12:83497652-83497674 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1099621661 12:85009114-85009136 GTGCATCCTCCCATGGCAGAAGG + Intergenic
1099695228 12:86010938-86010960 CTACATCACAACATGGCAAAAGG - Intronic
1100080321 12:90841568-90841590 CTGCATCATAACATGGCAATAGG - Intergenic
1100124387 12:91406118-91406140 CTGCTTCAACTCATGGCAGAAGG + Intergenic
1100465279 12:94839120-94839142 CTGCTCCCACTCATGGCAGAAGG + Intergenic
1100466547 12:94850598-94850620 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1100576324 12:95894650-95894672 CTGCTTCCACTCATGGCAGAAGG - Intronic
1100685600 12:96983584-96983606 CTGTATCCTCACATGACAGAGGG - Intergenic
1100752190 12:97710583-97710605 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1100806308 12:98287505-98287527 CTGTGTCCCCACATGGCAGAAGG - Intergenic
1101104595 12:101427576-101427598 CTGCATCATAACATGGCAGAAGG + Intergenic
1101469267 12:104981382-104981404 CTGCATTCTCACATGGTAGAAGG - Intergenic
1101646012 12:106631587-106631609 CTGTGTTCACACATGGCAGAAGG - Intronic
1101691716 12:107088530-107088552 CTGTCTCCTCACATGGCAGAAGG - Intronic
1102879496 12:116473519-116473541 CTGTATCCTCACATGGAAGAAGG - Intergenic
1103136714 12:118513783-118513805 CTTGAGCCACAGATGGCAAATGG - Intergenic
1103222122 12:119254724-119254746 CTGGGTCCTCACATGGCAGAAGG + Intergenic
1103293173 12:119863886-119863908 CTGCATCTTCACCTGGCAGAAGG - Intronic
1103483389 12:121265898-121265920 CCGCATCCTTACATGGCAGAGGG - Intronic
1103956379 12:124579184-124579206 CTGCTACCTTACATGGCAAAGGG - Intergenic
1104157308 12:126146112-126146134 CTGCATCATCCCATGGCAGAAGG + Intergenic
1104201201 12:126591120-126591142 TTGCACCCAGATATGGCAAATGG + Intergenic
1104343757 12:127977245-127977267 CTGCAGCCACCCATGTCAATGGG - Intergenic
1104739036 12:131159144-131159166 CTGCATCCTAACATGGCAGAAGG - Intergenic
1104986564 12:132600844-132600866 CTGCACCCACCCATGGCAGAGGG - Intergenic
1105434830 13:20367497-20367519 CTGCTTCCACTCGTGGCAGAAGG + Intergenic
1105446994 13:20466024-20466046 CTGCTCCCACCCATGGCAGAAGG - Intronic
1105518424 13:21110899-21110921 CTGCGTCCTCACATGGCAGAAGG - Intergenic
1105697928 13:22908912-22908934 CTGCATCCTCACATGGAAGAAGG + Intergenic
1105712792 13:23029140-23029162 CTGCTTCCACTCATGGCATGGGG - Intergenic
1106130409 13:26934762-26934784 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1106213740 13:27675206-27675228 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1106502980 13:30347052-30347074 CTGCTTCTACTCATGGCAAGAGG - Intergenic
1106689653 13:32100834-32100856 CTGCATCTTCACATGGCAGAAGG + Intronic
1107181351 13:37463650-37463672 CTGCTTCCACTCATGACAGATGG + Intergenic
1107254824 13:38412077-38412099 TTTCATCCACACATAGCTAAAGG - Intergenic
1107287832 13:38815715-38815737 CTGCTTTCACTCATGGCAGAAGG + Intronic
1107391086 13:39965021-39965043 CTGCATCATCCCATGGCAGAAGG + Intergenic
1107414041 13:40184621-40184643 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1107858234 13:44636042-44636064 CTGCATCGAAACATGGTAGAGGG - Intergenic
1107876084 13:44791576-44791598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1107980093 13:45727078-45727100 CTGCTTCCACACATGGAGAAAGG + Intergenic
1108057029 13:46495299-46495321 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1108382158 13:49864651-49864673 TTGCATCATCACATGACAAAAGG - Intergenic
1108588321 13:51890463-51890485 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1108745068 13:53385173-53385195 CTGCGTCCTCACATGGCAGATGG + Intergenic
1109281971 13:60367218-60367240 ATGCAACCTTACATGGCAAAGGG - Intergenic
1109290161 13:60464089-60464111 TTGCTTCCACTCATGGCAGAAGG - Intronic
1109330005 13:60917910-60917932 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109330229 13:60919912-60919934 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109383123 13:61591188-61591210 CTGCATCATCCCATGGCAAAAGG - Intergenic
1109523847 13:63548288-63548310 CTGCATCCTCACAAGGTGAAAGG - Intergenic
1109524806 13:63561900-63561922 TTGCATCCTCACACGGCAGAAGG + Intergenic
1109658737 13:65430138-65430160 CTGCATCCTCACATGGTGGAAGG - Intergenic
1109978383 13:69872162-69872184 CTGCTTCCACTCATGGCAGAAGG + Intronic
1110131882 13:72020296-72020318 CTGTATGCCCACCTGGCAAATGG - Intergenic
1110166532 13:72449337-72449359 CTGCATCATAACTTGGCAAAGGG + Intergenic
1110727290 13:78840033-78840055 CTGTGTCCACACATGGTAGAAGG + Intergenic
1110809211 13:79792705-79792727 CTGCAAAGACACATTGCAAAGGG - Intergenic
1110884505 13:80616573-80616595 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1110884719 13:80618524-80618546 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1111013659 13:82347655-82347677 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1111226712 13:85283034-85283056 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1111258716 13:85706787-85706809 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1111519426 13:89380756-89380778 CTGCTTACAATCATGGCAAAAGG - Intergenic
1112028916 13:95439287-95439309 CTGCATCCTCACATGGTGGAAGG + Intronic
1112074696 13:95898772-95898794 CTGCATCCTCATACGGCAGAAGG - Intronic
1112459674 13:99592477-99592499 CTGCATTCTAACATGGCAGAAGG + Intergenic
1112732539 13:102381443-102381465 CTGCATCCTCACATGGCAGAAGG - Intronic
1112742767 13:102493982-102494004 CTGCAACCTCACGTGGCAAAAGG - Intergenic
1112885585 13:104167131-104167153 CTGCATTCTCTCATGGCAGAAGG + Intergenic
1113066563 13:106378770-106378792 CTGCATCATCACATGGCAGAAGG - Intergenic
1113074167 13:106451726-106451748 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1113250032 13:108442521-108442543 CTGCATCCTCACATAACAGAAGG + Intergenic
1113278166 13:108758072-108758094 CTGCATCTTCGCATGGCAGAAGG - Intronic
1113395662 13:109945256-109945278 CTGCATCCTCACATGGTGGAAGG + Intergenic
1113501189 13:110775719-110775741 CTGTGACCTCACATGGCAAAAGG - Intergenic
1113525916 13:110976318-110976340 CTACATCCTAACATGGCAGAAGG - Intergenic
1113941479 13:114020514-114020536 CTGCCCTCACACATGGCAGAGGG + Intronic
1113970302 13:114183598-114183620 CTGCATCCTCATATGGTGAAAGG + Intergenic
1114171474 14:20277135-20277157 CTGCATTCTCACTTGGCAGAAGG + Intronic
1114187866 14:20416725-20416747 CTGCATCTTCTCATGGCAGAAGG - Intergenic
1114202208 14:20532453-20532475 CTGTATCCTCACATGGGGAAGGG + Intergenic
1114690070 14:24573332-24573354 CTGTGTCCACATATGGCAAAAGG - Intergenic
1114719637 14:24867194-24867216 CTGTGTCCTCATATGGCAAAAGG - Intronic
1114739688 14:25082607-25082629 CTGTAACCTCACATGGCAGAAGG - Intergenic
1114766832 14:25382251-25382273 CTATATCCTCACATGGCAAAGGG + Intergenic
1115201115 14:30855437-30855459 CACCTTCCACACATGGCCAAGGG - Intergenic
1115214771 14:31003615-31003637 CTGCTTCCACTCATGGCTGAAGG - Intronic
1115300196 14:31876881-31876903 CTGCATTCCCACATGGCAGAAGG + Intergenic
1115373875 14:32651614-32651636 CTGTGTCCTCACATGGCAGAAGG + Intronic
1115424209 14:33236420-33236442 CTCCATGCACACATGTCAGATGG - Intronic
1115469688 14:33755824-33755846 CTGCTTCCACTCGTGGCAGAAGG + Intronic
1115859548 14:37668697-37668719 CTGCAAAGTCACATGGCAAAAGG + Intronic
1115874901 14:37849951-37849973 CTGCAGGCATACATGGAAAAAGG - Intronic
1115992748 14:39166476-39166498 CTGCATCCAGAAATGACCAAGGG - Intronic
1116221599 14:42095420-42095442 CTGCTTCCACAGCTGGCAACAGG + Intergenic
1116328408 14:43564244-43564266 ATGCATGAGCACATGGCAAATGG + Intergenic
1116420526 14:44727041-44727063 CTGCTTCCATTCATGGCAGAAGG - Intergenic
1116615873 14:47137569-47137591 CTGCTTTCACTCATGGCAAAAGG - Intronic
1116699084 14:48215455-48215477 CTGCATCCTCACATGGCAGAAGG - Intergenic
1116748514 14:48851669-48851691 CTGTGTCCTCACATGGCATAAGG - Intergenic
1116776288 14:49185082-49185104 CTGCTTCCACTCATGGTAAGAGG + Intergenic
1116900850 14:50361564-50361586 CTGTGTCCTCACATGGCAAAAGG + Intronic
1116966692 14:51022356-51022378 CTGCATCATCCCATGGCAGAAGG - Intronic
1117017278 14:51531002-51531024 CTGCATCTTCTCATGGCAGAAGG + Intronic
1117104131 14:52381499-52381521 CAGCTTCCACTCATGGCAGAAGG - Intergenic
1117733080 14:58743481-58743503 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1118050888 14:62026422-62026444 CTGCATCCTCACATGGCAGAAGG + Intronic
1118318496 14:64739734-64739756 CTGTGTCCTCACATGGCAAAGGG + Intronic
1118429860 14:65706647-65706669 CTGTATCCTCACATGGTAGAAGG + Intronic
1118437854 14:65787765-65787787 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1118455731 14:65944451-65944473 CTTCATCTTCACATGGCAGAAGG + Intergenic
1118735743 14:68700685-68700707 ATGCATCCTCACATGGCAACAGG - Intronic
1119529129 14:75347266-75347288 CTGCATCATCCCATGGCAGAAGG - Intergenic
1119533192 14:75378020-75378042 CTGCATCATCCCATGGCAGAAGG - Intergenic
1119584411 14:75819344-75819366 TAGTATCCACAAATGGCAAAGGG - Intronic
1120101044 14:80445899-80445921 CTGCATCCACTCATTGCAGAAGG - Intergenic
1120375883 14:83706686-83706708 CTGCATCAACAGATGGCAGACGG - Intergenic
1120413156 14:84184060-84184082 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120518725 14:85501103-85501125 CTGCATCATCCCATGGCAGAAGG - Intergenic
1120566719 14:86068755-86068777 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120683385 14:87508070-87508092 CTGTATCCCCCCATGGCAGAGGG - Intergenic
1120715929 14:87840695-87840717 CAGCATCTACTCATGGCAGAAGG + Intronic
1120932389 14:89861791-89861813 CTGCATCATAACATGGCAGAAGG - Intronic
1120991363 14:90380314-90380336 CAGCATCCTCACGTGGCAGAAGG - Intergenic
1121215701 14:92246069-92246091 CTGCTTCCACTCATGGCAGATGG + Intergenic
1121471813 14:94161362-94161384 CTGCTCCCACTCATGGCAGAAGG - Intronic
1121504386 14:94465312-94465334 CAGTAGCCACACATGGCTAATGG - Intronic
1121549785 14:94790124-94790146 TTGTATCCCCACATGGCAGAAGG - Intergenic
1121728743 14:96171867-96171889 CTGAGTCCTCACATGGCAGAAGG + Intergenic
1121941788 14:98077728-98077750 CTGTGTCCTCACATGGCACAAGG + Intergenic
1122038901 14:98968223-98968245 CTGTATCTTCACATGGCAGAAGG - Intergenic
1122304697 14:100755511-100755533 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1122562981 14:102630295-102630317 CTGCTTCCACACATGGCGGAAGG - Intronic
1122637825 14:103138575-103138597 CTGCGTCCACCCCTGGCAGAGGG + Intergenic
1122671528 14:103376389-103376411 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1122763236 14:104045797-104045819 CTGCATCATGACATGGCAGAGGG - Intronic
1202940489 14_KI270725v1_random:141233-141255 CTGCATCTTCACTTGGCATAAGG + Intergenic
1123540057 15:21280950-21280972 CTGCATCCTCACATGGCATAAGG - Intergenic
1123670748 15:22654410-22654432 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1124102112 15:26705212-26705234 CTGTGTCCTCACATTGCAAAAGG + Intronic
1124362071 15:29044972-29044994 CTGTGTCCACACATGGTGAAAGG + Intronic
1124504819 15:30263668-30263690 CAGCATCCACACAGGACAACAGG + Intergenic
1124526722 15:30460837-30460859 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1124561904 15:30782039-30782061 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1124708388 15:31984339-31984361 CTGCTTCCACTCATAGCAGATGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124738733 15:32274967-32274989 CAGCATCCACACAGGACAACAGG - Intergenic
1124771931 15:32546846-32546868 CTGCATCCTCACTTGGTGAAAGG + Intergenic
1124888465 15:33709644-33709666 CTGCATCATAACATGGCAGAAGG - Intronic
1124949503 15:34303771-34303793 CTGCATCTTCCCATGGCAGAGGG - Intronic
1125215201 15:37264040-37264062 CTGCATCCTCACATGGTGAAAGG - Intergenic
1125237167 15:37528907-37528929 CTGTGTCCTCACATGGCAAGGGG + Intergenic
1125441802 15:39711276-39711298 CTACGTCCTCACATGGTAAAAGG + Intronic
1126124149 15:45280081-45280103 CTGTAACCTCACATGGCAGAAGG - Intergenic
1126261990 15:46704157-46704179 CTGCTTCCACTCATGGTCAAAGG - Intergenic
1126264027 15:46731318-46731340 ATGCATCCCCATATGGCAGAAGG + Intergenic
1126292968 15:47102015-47102037 CTGCATCTTCACGTGGCATAAGG - Intergenic
1126565300 15:50090509-50090531 CTGTGTCCTCACATGGCAGAAGG - Intronic
1126607457 15:50493113-50493135 CTGCATCCTCACAGGGTAGAAGG + Intronic
1126931773 15:53661305-53661327 CTTCTTCCACTCATGGCAGAAGG + Intronic
1126991193 15:54377704-54377726 CTGTGTCCTCACATGGCAAAAGG + Intronic
1127078188 15:55348667-55348689 CTGCTTCCACTCATGGCAGAAGG - Intronic
1127290976 15:57570777-57570799 CTGCTTCCACTCATGACAGAAGG - Intergenic
1127492082 15:59474400-59474422 CTGCATGCTTACATGGCAGAAGG + Intronic
1127492087 15:59474446-59474468 CTGTGTCCTCACATTGCAAAAGG + Intronic
1128538325 15:68507236-68507258 CTGCATCATAACATGGCAGAGGG + Intergenic
1128822809 15:70675870-70675892 CTGCATCCTCACCTGGCAGAAGG - Intronic
1129345047 15:74912137-74912159 CTGCTTCCACTCATGGCGGAAGG - Intergenic
1129349266 15:74945255-74945277 CTGCATCATCCCATGGCAGAAGG + Intergenic
1129429234 15:75486400-75486422 TTGCATCCTCACATGGCAGAAGG - Intronic
1129485661 15:75869578-75869600 TTGCATCCTCACATGGTAGAAGG + Intronic
1129630013 15:77248566-77248588 CTGTGTCCTCACATGGCAGAAGG - Intronic
1129907785 15:79201647-79201669 CTGCATCCTCCCATGGTAGAAGG + Intergenic
1129921963 15:79326935-79326957 GTGCTTCCACTCATGGCAGAAGG + Intronic
1129922010 15:79327226-79327248 CTGCATCCTCACGTGGCAGAAGG - Intronic
1129935809 15:79449496-79449518 CTGCATCTTCACATAACAAAAGG + Intronic
1130177764 15:81592882-81592904 CTGCATCCCCACATGGTGGAAGG - Intergenic
1130187266 15:81696456-81696478 CTGCTTGCACTTATGGCAAAAGG + Intergenic
1130317136 15:82806149-82806171 CTGCAGCCACAAATAGCAACAGG + Intergenic
1130405984 15:83602453-83602475 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130429607 15:83833349-83833371 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130706884 15:86241590-86241612 CTGCATACTCACATAGCAGAAGG + Intronic
1131132200 15:89907517-89907539 CTGAGTCCTCACATGGCAGAAGG - Intronic
1131423916 15:92329916-92329938 CTGTATCCTCATATGGCAAAAGG - Intergenic
1131560745 15:93437250-93437272 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1131602517 15:93863756-93863778 CTGCTTCCACTCATGGCAAACGG - Intergenic
1131648401 15:94371836-94371858 CTGCCACCACACCTGGCTAAGGG + Intronic
1131651803 15:94408211-94408233 CTGCACACACACCTAGCAAATGG - Intronic
1131920043 15:97316424-97316446 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1202948368 15_KI270727v1_random:8108-8130 CTGCATCCTCACATGGCATAAGG - Intergenic
1133439178 16:5806339-5806361 CTGCATCCCCACATGGTGGATGG + Intergenic
1133441142 16:5821817-5821839 CTGCATCCTCACATGGTGAAAGG + Intergenic
1134245016 16:12533394-12533416 ATGCATCAACACATCACAAAAGG - Intronic
1134285674 16:12860162-12860184 CTGGATGCTCACATGGCAGAAGG - Intergenic
1134756125 16:16669017-16669039 ATGCATGCACACATGGCAGGTGG - Intergenic
1134989943 16:18690147-18690169 ATGCATGCACACATGGCAGGTGG + Intergenic
1135279682 16:21143376-21143398 CTGCATGCTCACATGGGAGAAGG - Intronic
1135497032 16:22961872-22961894 CTGTTTCCACTCATGGCAGAAGG + Intergenic
1135907053 16:26521821-26521843 CTGCTTCCAGTCATGGCAGAAGG - Intergenic
1136019665 16:27431992-27432014 CTGCATCCTCACATGGCAGAAGG + Intronic
1136069745 16:27780772-27780794 CAGGATCCACACATGGTGAAGGG - Intergenic
1136385769 16:29925261-29925283 CTGTATACACACATTGCAGAAGG - Intronic
1136742513 16:32550306-32550328 TTGAATCCACACATCACAAAGGG - Intergenic
1137069976 16:35895871-35895893 CTGCTTCCACTCAGGGCAGAAGG - Intergenic
1137419054 16:48315453-48315475 CTGCATCTTCACATGGCAGAAGG + Intronic
1137464659 16:48697415-48697437 CTGCTTCCAATCATGGCAGAAGG + Intergenic
1137475447 16:48804020-48804042 TTGCATCCACCCATGGGAGAAGG + Intergenic
1137805490 16:51301089-51301111 CTGCGTCCTCACATGGTGAAAGG + Intergenic
1137862852 16:51864215-51864237 CTCCATCCACACAAGGCACTAGG - Intergenic
1138038589 16:53634710-53634732 CTGCTTCCACTCATGGCATAAGG - Intronic
1138341420 16:56291823-56291845 CTGCATCCTCAGGTGGCAGAAGG + Intronic
1138397160 16:56713860-56713882 CTGTCTCCTCACATGGCAGAAGG + Intronic
1138603797 16:58074251-58074273 CTGCTTCCACTTATGGCAGAAGG + Intergenic
1138612581 16:58138427-58138449 CTGTTTCCACACATTGCAGAAGG - Intergenic
1138747759 16:59383272-59383294 CTGCATCATCTCATGGCAGAAGG + Intergenic
1138753094 16:59447857-59447879 CTGCATCCTCATGTGGCAAATGG + Intergenic
1138802738 16:60054340-60054362 CTGCATTCTCACATGGTGAAAGG - Intergenic
1139011111 16:62635532-62635554 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139022812 16:62772857-62772879 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139032030 16:62895689-62895711 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1139144430 16:64307237-64307259 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1139238943 16:65370656-65370678 CTGCATTCTCACATGGTAGAAGG + Intergenic
1139979371 16:70841775-70841797 CTGCATCGTAACATGGCAGATGG - Intronic
1140348021 16:74233802-74233824 CTGCATCCTCCTATGGCAGAAGG - Intergenic
1140420527 16:74815318-74815340 CTTCATCCTAACATGGCAGAGGG - Intergenic
1140582515 16:76248283-76248305 CTGCTGCCACTCATGGCAGAAGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140706875 16:77638972-77638994 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1140777650 16:78264756-78264778 CTGTGTCCTCACATGGCAGAAGG - Intronic
1141225912 16:82114663-82114685 CTGCAAAGTCACATGGCAAAGGG + Intergenic
1141268462 16:82518186-82518208 CTAGATCCACAAATGGCTAAAGG - Intergenic
1141676433 16:85520195-85520217 CTGTATCCTCACATGGTGAAAGG + Intergenic
1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG + Intronic
1142453694 16:90202890-90202912 CTGTTTCCACTCATGGCAGAAGG + Intergenic
1203027084 16_KI270728v1_random:524922-524944 TTGAATCCACACATCACAAAGGG + Intergenic
1203044637 16_KI270728v1_random:809509-809531 TTGAATCCACACATCACAAAGGG - Intergenic
1143438253 17:6946771-6946793 CTGCATCAACCCATGGCAGAAGG + Intronic
1143782768 17:9238076-9238098 CTGCACCCACACATGGACCAGGG - Intronic
1144135477 17:12290964-12290986 CTGCGTCCTCACTTGGCAAAAGG - Intergenic
1144457014 17:15427009-15427031 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1144588284 17:16502290-16502312 GTGCTTCCACTCATGGCAGATGG + Intergenic
1144599293 17:16598640-16598662 CTGCTTCCACTCATGGCGGAAGG - Intergenic
1144647498 17:16985341-16985363 CTGGATCCTCACATGACAGAAGG - Intergenic
1144939382 17:18927093-18927115 CTGTGTCCTCACATGGCATAAGG + Intronic
1145378411 17:22373054-22373076 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1145833009 17:27932625-27932647 CTGCTTCCACTCATGTCAGAAGG + Intergenic
1146312245 17:31778470-31778492 CTGCATCCACACAGAACATAGGG + Intergenic
1146759449 17:35463941-35463963 CTGCTTCCACTCATGGCAGGAGG + Intergenic
1148571059 17:48669471-48669493 CAGTATCCTCACATGGCAGATGG - Intergenic
1148881035 17:50727350-50727372 CTGCTTCCACTCATGGCAGAAGG + Intronic
1148985821 17:51620266-51620288 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1149258632 17:54855477-54855499 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1149286073 17:55165815-55165837 CTGCATCCTCACAAGGCAGAAGG - Intergenic
1149723588 17:58869545-58869567 CTGCTTCCACCCATGGCAGAAGG - Intronic
1150034976 17:61784808-61784830 CTGCTTCCACTGATGGCAAAAGG - Intronic
1150556483 17:66259334-66259356 CTGAATCCTCACGTGGCAGAAGG - Intergenic
1150600663 17:66648113-66648135 CTGTGTCCTCACATGGCAGAAGG + Intronic
1150841492 17:68611054-68611076 TTGCTTCCACTCATGGCAGAAGG - Intergenic
1150908413 17:69362781-69362803 TTGTGTCCTCACATGGCAAAAGG - Intergenic
1151145450 17:72036330-72036352 CTGTGTCCTCACATGGCATAAGG + Intergenic
1151434751 17:74088097-74088119 CTGGAGCCCTACATGGCAAAAGG - Intergenic
1151435767 17:74096145-74096167 CTGCATCATCCCATGGCAGAAGG - Intergenic
1151950016 17:77346892-77346914 CTGTGTCCCCACATGGCAGAAGG - Intronic
1152029542 17:77833467-77833489 CTGCACCCTCACATGGCAGAAGG + Intergenic
1152102752 17:78312391-78312413 CTGCATCCTTACAGGGCAGAAGG - Intergenic
1152508578 17:80770157-80770179 CTGCATCCTCACATAGCAGAAGG + Intronic
1152790555 17:82276548-82276570 CTGCCTCCACTCATGGCAGAAGG + Intergenic
1153082835 18:1248320-1248342 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1153132866 18:1877389-1877411 CAGCATCCTCACATGACAGAAGG - Intergenic
1153455412 18:5276093-5276115 CTGCATCCTCTCATAGCAAAAGG - Intergenic
1153525127 18:5987438-5987460 GTGCATCCACACGTGGCCACGGG - Intronic
1153591404 18:6677290-6677312 CTGCTTCCACTAATGGCAGAAGG + Intergenic
1153641466 18:7161360-7161382 CTGCATCCTAAGATGGCAGAAGG - Intergenic
1153711049 18:7799205-7799227 CTGCATCCTCACATGGCAGAAGG + Intronic
1153841573 18:9012734-9012756 CTGCTTCCACACATGGTGGAAGG + Intergenic
1154179467 18:12119525-12119547 CTGTGTCCTCACATGGCAGAAGG + Intronic
1154295747 18:13145758-13145780 CTGCATCTACTCATAGCAGAAGG + Intergenic
1154957544 18:21274174-21274196 CTGTATCCTCACATGGTAGAGGG + Intronic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1155438002 18:25833222-25833244 CTGTATCCTCACATGGGGAAAGG - Intergenic
1155694785 18:28672286-28672308 CTGCATCCTCATATGGCAGAAGG + Intergenic
1155699811 18:28730177-28730199 CTGCATTCTCACATGGGAGAAGG - Intergenic
1155700490 18:28737107-28737129 CTGTGTACACACATGGCAGAAGG - Intergenic
1155913446 18:31532261-31532283 CTGCATCCTCACGTGGCCAAAGG + Intronic
1155917222 18:31568610-31568632 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1156116760 18:33794855-33794877 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1156356261 18:36343680-36343702 CTGCTTCCACTCATGACAAAAGG - Intronic
1156544790 18:37953838-37953860 CTTCATCCCCACTTGGCAGAGGG + Intergenic
1156685297 18:39637693-39637715 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1156820563 18:41367370-41367392 CTGCATCCTCACATGACAAAAGG - Intergenic
1156886241 18:42139650-42139672 TTGTATCCTCACATGGCAGAAGG + Intergenic
1156931444 18:42649641-42649663 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1157231480 18:45920547-45920569 CTGCGTCCACACATGGCAGAAGG + Intronic
1157301752 18:46484438-46484460 CTGTGTCCTCACATGGCAGAAGG - Intronic
1157656626 18:49396088-49396110 CTGCTTCCACTCATGGCAGAAGG - Intronic
1157942666 18:51946133-51946155 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158342564 18:56482449-56482471 CTGCATCATAACATGGCAGAAGG - Intergenic
1158400350 18:57116186-57116208 CTGCGTCCTCACACGGCAGAAGG + Intergenic
1158499704 18:57989385-57989407 CTGATTCCTCACATGGCAGACGG - Intergenic
1158513606 18:58112981-58113003 CTGTATCCTCACATGGTAGAAGG - Intronic
1158645840 18:59246311-59246333 CTGCATCCTCACATGGTGGAAGG + Intergenic
1158727566 18:59987384-59987406 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158757656 18:60346176-60346198 CTGCATCCCCATAAGTCAAATGG - Intergenic
1158788205 18:60740989-60741011 CTGTGTCCCCACATGGCAGAGGG + Intergenic
1158939845 18:62397361-62397383 CTGTACCCTCACATGGCAGAAGG + Intergenic
1158957079 18:62550489-62550511 CAGCATACACACAGGACAAAGGG + Intronic
1159237916 18:65701353-65701375 CTGCATCTAAACATGGCAGAAGG + Intergenic
1159420176 18:68208394-68208416 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1159442174 18:68495336-68495358 CTGCATTCTCACATGACAGAAGG + Intergenic
1159479779 18:68974264-68974286 CTGGGTCCTCACATGGCAGAAGG - Intronic
1159560435 18:69987043-69987065 CTGCGTCCTAACATGGCAGAAGG + Intergenic
1159566794 18:70060229-70060251 CTACATCCACACATGGTGGAAGG - Intronic
1159829312 18:73254686-73254708 CTGCTTCCACTCATGACAGAAGG + Intronic
1159847983 18:73489344-73489366 CTGCATCCTCACATGGCGGGAGG + Intergenic
1159872690 18:73776241-73776263 CTGCATCATCCCATGGCAGAAGG - Intergenic
1160053804 18:75461115-75461137 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1160177335 18:76606358-76606380 ATGTATCCTCACATGGCAGAAGG - Intergenic
1160245939 18:77159468-77159490 CTGCATCCCCACATGGTGGAAGG - Intergenic
1160669283 19:349341-349363 CTGAACCCTCACATGGCAGAGGG + Intergenic
1160753395 19:746093-746115 CTGCATCCACAGATGCCAACAGG + Intronic
1162478255 19:10913773-10913795 CTCCATCCACACATGGGCATTGG - Intronic
1163296989 19:16418789-16418811 CCGTGTCCTCACATGGCAAAAGG - Intronic
1163381277 19:16970631-16970653 CTGTATCCTCATATGGCAGAAGG - Intronic
1164964678 19:32471981-32472003 CTGCATCCACACACTTCACACGG - Intronic
1165600086 19:37047349-37047371 CTGTGTCCTCACATGGCAGAAGG - Intronic
1165642005 19:37397688-37397710 TTGCATCCTCACATGGCAGAAGG + Intergenic
1165642249 19:37399674-37399696 CTCCGTCCTCACATGGCAGAAGG + Intergenic
1166123023 19:40696943-40696965 CTGGAGCGACACATGGCAACAGG - Intronic
1166680329 19:44762275-44762297 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1167100311 19:47400609-47400631 CTGCTTCCTCACCTGGGAAATGG + Intergenic
1167812814 19:51849489-51849511 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1167845339 19:52158999-52159021 CTGTGTCCTCACATGGCAGAAGG - Intronic
1168637244 19:58005896-58005918 CTGCATCCTCACCTGACAGAAGG - Exonic
925249271 2:2417393-2417415 CTGCATCCTCACAGGGTGAAAGG - Intergenic
925693620 2:6550867-6550889 TTGCATCCTCACAAGGCAGAAGG - Intergenic
925880638 2:8349604-8349626 CTGTGTCCTCACATGGCAGAAGG + Intergenic
926050538 2:9741623-9741645 CTGCTTCCACTCATGGCAGAAGG - Intergenic
926288503 2:11509734-11509756 CTGCATCCTCACATGGTGGAAGG - Intergenic
926396445 2:12447386-12447408 ATGTGTCCTCACATGGCAAAAGG - Intergenic
926589781 2:14728256-14728278 CTACTTCCACTCATGGCAGAAGG - Intergenic
926612602 2:14961491-14961513 CTGCTTCCACTCATGGCAGAAGG - Intergenic
926961867 2:18365819-18365841 CTGCATCCTCACATGGTGGAGGG - Intergenic
927458041 2:23274478-23274500 CTGCATCCTCACATGGTGGAAGG - Intergenic
927498871 2:23568710-23568732 CTGCAACACCACATTGCAAAGGG + Intronic
927599742 2:24430481-24430503 CCGCATCATCCCATGGCAAAAGG - Intergenic
928288242 2:30012182-30012204 CTGCTTCCAATCATGGCAGAAGG - Intergenic
928307158 2:30179639-30179661 CTGTGTCCTCACATGGCAGAAGG + Intergenic
928841976 2:35620045-35620067 TTGCATGCAGAGATGGCAAAAGG - Intergenic
929023739 2:37579067-37579089 CTGGGTCTTCACATGGCAAAAGG + Intergenic
929129038 2:38547969-38547991 CTGTAACCTCACATGGCAGAAGG - Intergenic
929278644 2:40053512-40053534 ATGCAGCCTCACATGGCAGAAGG - Intergenic
929314959 2:40465935-40465957 CTGTGTCCTCACATGGCAGAAGG - Intronic
929379023 2:41327104-41327126 CTGCTTCTACTCATGGCAGAAGG - Intergenic
929731996 2:44504941-44504963 CTGCTTCCACTCATGGCAGAAGG + Intronic
929797852 2:45073735-45073757 CTGTGTCCTCACATGGCAGAGGG - Intergenic
930204318 2:48572973-48572995 CTGCATCCACACATTCCTGAGGG - Intronic
930371720 2:50509970-50509992 TTGTATCCTCACATGGCAGAGGG - Intronic
930394024 2:50796985-50797007 CTGTGTCCTCACATGGCAGAAGG + Intronic
930467039 2:51768284-51768306 CTACTTCCACTCATGGCAGAAGG + Intergenic
930540660 2:52702629-52702651 CTTCTTCCACTCATGGCAGAAGG + Intergenic
930572230 2:53101834-53101856 GTGCATCCTCATATGGCAGAAGG + Intergenic
930578096 2:53176969-53176991 CTGCATCCTCACATAGCAGAAGG - Intergenic
930673468 2:54175979-54176001 ATGTATCCTCACATGGTAAAGGG - Intronic
930689155 2:54341343-54341365 CTGCATCCTCACATGGTGGAAGG - Intronic
930831670 2:55750165-55750187 TTGTATCCTCACATGGCAGAAGG - Intergenic
930878477 2:56245820-56245842 ATACATCCACACATGGCAGAAGG - Intronic
930992959 2:57682752-57682774 CTGCCTTCTCACATGGCAGAGGG - Intergenic
931210202 2:60186487-60186509 CTGTGTCCTCACATGGCAGAAGG + Intergenic
931690143 2:64828826-64828848 CTGCTACCACTCATGGCCAAAGG - Intergenic
931767662 2:65471125-65471147 CTGCATCCTCACATGGTAGAAGG - Intergenic
931948871 2:67338765-67338787 CTGCTTGCACACATGGTAGAAGG + Intergenic
932022771 2:68104606-68104628 CTGCTTCCACTTATGGCAGAAGG + Intronic
932043430 2:68323095-68323117 CTGCATCCATACATGGTAGAAGG - Intergenic
932351729 2:71038038-71038060 ATGCCTCCAAAAATGGCAAAGGG - Intergenic
932667957 2:73711938-73711960 GTGTATCCTCACATGGCAGAAGG - Intergenic
932802642 2:74755501-74755523 CTGCATCCTTACACGGCAGAAGG + Intergenic
932874027 2:75431861-75431883 CTGCTTTCACTCATGGCAGAAGG + Intergenic
933069668 2:77841210-77841232 TTGTATCTACACAAGGCAAAGGG - Intergenic
933107911 2:78356713-78356735 CTGTGTCCTCACATGGCAGAAGG + Intergenic
933558172 2:83857766-83857788 CTGTGTCCCCACATGGCAAAAGG - Intergenic
933566298 2:83954489-83954511 CAAAATCAACACATGGCAAATGG - Intergenic
933686765 2:85147648-85147670 CTTCATCCACAAGTGGCACAGGG - Intronic
934334132 2:92107945-92107967 CAGCTTCCAGACATGACAAAAGG - Intergenic
934334461 2:92112713-92112735 CAGCTTCCAGACATGACAAAAGG - Intergenic
934692906 2:96375478-96375500 TTGCATCCTTACATGGCAGAAGG - Intergenic
934922455 2:98356645-98356667 CTGCATTCAGACTTGGAAAATGG + Intronic
935047489 2:99495138-99495160 CTGCTTCCAGTCATGGCAGAAGG + Intergenic
935167915 2:100585750-100585772 CTGCTTCCACTCATGGTGAAAGG - Intergenic
935272576 2:101447945-101447967 CTACATCCTCACATGGCAGAAGG + Intronic
935277030 2:101483952-101483974 CTGCGTCCTCACATGGCATAAGG - Intergenic
935478678 2:103557951-103557973 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935641893 2:105298761-105298783 CTGCATCCAGACATAGCTACAGG - Intronic
935716455 2:105943509-105943531 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935730588 2:106062109-106062131 CTGAATGCACACAGGGGAAAGGG - Intergenic
935822632 2:106909396-106909418 CTGCTTCCACTCATGGCGGAAGG - Intergenic
935851434 2:107224372-107224394 CTGCGTCCTCACATGGTAGAAGG + Intergenic
935873934 2:107485756-107485778 CTGATTCCACTCATGGCAGAAGG - Intergenic
935936139 2:108185132-108185154 CTGTAACCTCACATGGCAGAAGG + Intergenic
936001536 2:108835895-108835917 CTGCATCCTCACATGGCACAGGG + Intronic
936254282 2:110897468-110897490 CTGAGTCCTCACATGGCAGAAGG + Intronic
936262974 2:110978245-110978267 TTGTATCCTCACATGGCAGAAGG + Intronic
936395647 2:112126493-112126515 TTGAATCCTCACATGGCAGAAGG - Intergenic
936596902 2:113856785-113856807 CTGTGTCCTCACATGGCAGAAGG - Intergenic
936635565 2:114252491-114252513 CTGCTTCCACTCATAGCAAAAGG - Intergenic
936644374 2:114351675-114351697 CTGCAAAGACACATGGCAAAGGG - Intergenic
936726196 2:115319846-115319868 CTGCATTCTCACATGGCAGAAGG + Intronic
937013600 2:118583548-118583570 CTGCATCCTCACATGGCAGAAGG + Intergenic
937066838 2:119023933-119023955 CTGCAGCCACATCTGGCAACTGG + Intergenic
937194851 2:120144248-120144270 CTGCATCCTCACATGGTTGAAGG - Intronic
937260686 2:120585282-120585304 CTGCTTCCACTCATGGCAGAAGG + Intergenic
937426497 2:121803925-121803947 CTGCTTCCACTCGTGGCAGAAGG - Intergenic
937462529 2:122101793-122101815 CTGCATCTTCACATGGTAGAGGG + Intergenic
937514984 2:122642823-122642845 CTGCATTTTCACATGGCAAAAGG - Intergenic
937819980 2:126299263-126299285 CTACTTCCACTCAAGGCAAAGGG + Intergenic
938118525 2:128618246-128618268 CTGCTTCCACTCCTGGCAGAAGG - Intergenic
938349036 2:130585821-130585843 CTGTGTCCTCACTTGGCAAAAGG + Intergenic
938912872 2:135901476-135901498 CTGTATCCTCACATGGCAGAAGG - Intergenic
938961485 2:136345504-136345526 CTGCATCCTCACATGGCAGAAGG + Intergenic
938974723 2:136465276-136465298 CTGTGTCCTCACATGGCAGAAGG + Intergenic
939099326 2:137877951-137877973 CTGCTTCCACTCATGGTGAAAGG + Intergenic
939521115 2:143231840-143231862 CTGTATCCTCACATGGCAGAGGG + Intronic
939988457 2:148855183-148855205 CTGTGTCCCCACATGGCAGAAGG - Intergenic
940060429 2:149559540-149559562 CAGTGTCCTCACATGGCAAAGGG + Intergenic
940132644 2:150401063-150401085 CTGCTTCCACTCATGGCAGAAGG - Intergenic
940156074 2:150658658-150658680 CTGCTTCCATTCATGGCAGAAGG + Intergenic
940322589 2:152392562-152392584 CTGCATCCTCATCTGGCAGAAGG + Intronic
940332827 2:152493706-152493728 CTGCTTCCACTTATGGCAGAAGG - Intronic
940372571 2:152919115-152919137 CTGTGTCCTCACATGGCAGAAGG - Intergenic
940372777 2:152921401-152921423 CTGCAACCTCACATGGTAGAAGG + Intergenic
940859725 2:158759254-158759276 CTGCATCCTAACAAGGCAGAGGG - Intergenic
941093862 2:161212961-161212983 CTGCTTCCACTCATGGCCGAAGG + Intronic
941162560 2:162052395-162052417 CAGCATCCCCACATGGTGAAAGG - Intronic
941380354 2:164785044-164785066 CTTCATCCTCACATGGCAGAAGG - Intronic
941397272 2:164989473-164989495 CTGCATCCTCACATGGCATAAGG - Intergenic
941529602 2:166650432-166650454 TTGCATCCTCACATGGCAGAAGG - Intergenic
941551947 2:166927722-166927744 ATGTGGCCACACATGGCAAAGGG - Intronic
941557496 2:167000030-167000052 CTGCAATCACACATTTCAAATGG - Intronic
941860362 2:170272801-170272823 CTACATCGTCCCATGGCAAAGGG - Intronic
941943241 2:171066642-171066664 CTGCATTCACACATGTTTAAAGG + Intronic
942131324 2:172883279-172883301 CTGTATCATCTCATGGCAAAAGG + Intronic
942489624 2:176476399-176476421 CTGTAACCTCACATGGCAGAAGG - Intergenic
942524819 2:176841879-176841901 CTGCTTTCACTCATGGCAAAAGG - Intergenic
942592322 2:177559176-177559198 CTGCATCATAACATGGCAGAAGG - Intergenic
943025240 2:182619873-182619895 CTGCATCATCACATGGCAGAAGG + Intergenic
943115951 2:183670521-183670543 CTGCGTCCTTACATGGCAGAGGG - Intergenic
943274929 2:185854588-185854610 TTGTATCCTCACATGGCAGAAGG + Intergenic
943280726 2:185929498-185929520 CTGCCACCTCACATGGCAGAGGG - Intergenic
943370876 2:187014173-187014195 CTACGTCCTCACATGGCAGAAGG - Intergenic
943389321 2:187244047-187244069 CTGCATCCTCACATGGCTGAAGG + Intergenic
943587800 2:189760864-189760886 CTGCATTCCCACATGACAACTGG + Intronic
943635443 2:190301800-190301822 GTGTGTCCACACATGGCACAAGG + Intronic
943644819 2:190399051-190399073 CTGCATCCTCACATGGCAGAAGG + Intergenic
943665062 2:190600680-190600702 CTGCTTCAACTCATGGCAAAAGG - Intergenic
943678492 2:190742273-190742295 CTGCATCCTCCCATGGCAGAAGG - Intergenic
943705298 2:191027625-191027647 CTGCTTCTACTCATGGCAGAAGG - Intergenic
944079994 2:195776846-195776868 CCACACACACACATGGCAAAGGG + Intronic
944171347 2:196782195-196782217 CTGTGTCCTCACGTGGCAAAAGG - Intronic
944223585 2:197326678-197326700 CTGCATTCTCCCATGGCAGATGG - Intergenic
944392076 2:199228192-199228214 CTGTATGCCCACCTGGCAAATGG + Intergenic
944467605 2:200018786-200018808 CTGTGTCCTCACATGGCAGAAGG + Intergenic
944754333 2:202744261-202744283 CTGCATCCACTCATGGCGGAAGG + Intronic
945095929 2:206219258-206219280 CTGAATCAACACATGGCATCGGG - Intergenic
945171029 2:206995346-206995368 CTACTTCCACTCATGGCAGAAGG - Intergenic
945195486 2:207233526-207233548 CTGTGTCTTCACATGGCAAAAGG - Intergenic
945308983 2:208288244-208288266 CAGCATCCACATCTGTCAAAAGG - Intronic
945319506 2:208405846-208405868 TTGCAACCTCACATGGCAGAAGG - Intronic
945657980 2:212648884-212648906 CTGCATCCTCACATGGCAGAAGG + Intergenic
945805833 2:214488759-214488781 CTGTTTCCACTCATGGCAGAAGG + Intronic
945930721 2:215852544-215852566 CTGTGTCCTCACATGGCAGAAGG + Intergenic
946637703 2:221747863-221747885 CTGTGTCCTCACATGGCAGAAGG - Intergenic
946891009 2:224276396-224276418 CTGCATCCTCACATGGCAGAAGG - Intergenic
947069819 2:226276182-226276204 CTACGTCCTCACATGGCAGAAGG + Intergenic
947082582 2:226415224-226415246 CTGAATCCTCATATGGCAGAAGG - Intergenic
947121803 2:226823169-226823191 CTGCATCCTCACATAGCAGCAGG - Intergenic
947154807 2:227151790-227151812 CTGCATCCTCACATGGTGGAAGG - Intronic
947231279 2:227889363-227889385 CTGCGTCTTCACATGGCAGAGGG + Intronic
947362763 2:229363276-229363298 CAGCAGCCACACAGGGCACATGG - Intronic
947527860 2:230890268-230890290 CTGCTTCCACTCGTGGCAGAAGG + Intergenic
947886036 2:233572526-233572548 CTACTTCCACTCATGGCAGAAGG - Intergenic
947889903 2:233608232-233608254 CTGCTGCCACTCATGGCAGAAGG + Intergenic
947894576 2:233657389-233657411 CTACTTCCACTCATGGCAGAAGG + Intronic
947895332 2:233666087-233666109 CTACTTCCACTCATGGCAGAAGG + Intronic
948107564 2:235427702-235427724 GTGCATCCACACATGGTAAGGGG - Intergenic
948267255 2:236644019-236644041 CTGCATCAGCCCATGGCAGAAGG - Intergenic
948384636 2:237573938-237573960 CTGCTTCCACTCATGGCAGAAGG - Intergenic
948511332 2:238467184-238467206 CTGTGTCCTCACATGGCAGAGGG + Intergenic
949085140 2:242147553-242147575 CTGTTTCCACTCATGGCAGAAGG + Intergenic
1168865363 20:1081372-1081394 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1169228868 20:3873643-3873665 CTGCATCCACACATGGTAGAAGG - Exonic
1169500061 20:6150964-6150986 CTGCATTCACTCATGGCAAAAGG + Intergenic
1169635586 20:7688147-7688169 CTGCCTCTTCACATGGCAGAAGG - Intergenic
1169737294 20:8850682-8850704 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169744856 20:8933358-8933380 CTGCTTCCACTCCTGGCAGAAGG + Intronic
1169830832 20:9823140-9823162 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169885145 20:10390537-10390559 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1169902478 20:10567410-10567432 CTGTATCCTCACACGGCAGAAGG - Intronic
1170147146 20:13188060-13188082 CTACATCTTCACGTGGCAAAAGG - Intergenic
1170195528 20:13685273-13685295 TTGCATCCTCACATGGCAGAAGG + Intergenic
1170475323 20:16708373-16708395 CTGCTCCCACTCATGGCAGAAGG - Intergenic
1170480999 20:16764727-16764749 CTGCTTCCGCTCATGGCAGAAGG - Intronic
1170819773 20:19747030-19747052 CTGCATCATCACATGGCAGAAGG + Intergenic
1170832210 20:19852202-19852224 CTGCAAAGCCACATGGCAAAGGG + Intergenic
1170939886 20:20840006-20840028 CTGCTTCCACTCATGTTAAAAGG - Intergenic
1170957045 20:20991160-20991182 CCGCGTCCTCACATGGCAGAAGG + Intergenic
1170962710 20:21039571-21039593 CTGCAAAGTCACATGGCAAAGGG - Intergenic
1170988408 20:21279761-21279783 CTTCTTCCACTCATGGCAGAAGG + Intergenic
1171020632 20:21581477-21581499 CTGCTTCCACTCATGGTGAAAGG + Intergenic
1171295062 20:24010128-24010150 CTGCTTCCTCACATGGCAAAGGG - Intergenic
1171451453 20:25238784-25238806 CTGCATGCTTACATGGCAGAAGG - Intergenic
1171524866 20:25800936-25800958 CTGTGTCCTCACATGGCAGAAGG + Intronic
1171536409 20:25896566-25896588 CTACATCTTCACATGGCATAAGG + Intergenic
1171551961 20:26054947-26054969 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171682455 20:27973077-27973099 CAGCTTCCAGACATGACAAAAGG - Intergenic
1171712091 20:28418698-28418720 CAGCTTCCAGACATGACAAAAGG - Intergenic
1171793071 20:29546247-29546269 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171804694 20:29664592-29664614 CTACATCTTCACATGGCATAAGG - Intergenic
1171839359 20:30191834-30191856 CTACATCTTCACATGGCATAAGG + Intergenic
1171855380 20:30338159-30338181 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1172299061 20:33835802-33835824 CTGCATCCACTCATGGTGGAAGG + Intronic
1172701792 20:36857878-36857900 CTGCGTCCTCACATTGAAAAGGG + Intronic
1172835645 20:37871434-37871456 TTGCATCCTCACATTGCAGAAGG + Intronic
1173010684 20:39179027-39179049 CTGCATTCCCACATGGCGAAAGG + Intergenic
1173584103 20:44169046-44169068 CTGCTTCCACTCATGGCAGAAGG - Intronic
1173590772 20:44222856-44222878 CTGCTTCCACTCATGGCAGGAGG - Intergenic
1173678632 20:44860259-44860281 CTGCTTCCATTCATGGCAGAGGG - Intergenic
1173904806 20:46618593-46618615 CTGTGTCCTCACATGGCAGAAGG - Intronic
1174196759 20:48777712-48777734 CTGCATCCACATCTGTAAAATGG + Intronic
1174517770 20:51106303-51106325 CTGCATCCTCACATGGCAGAAGG - Intergenic
1174722337 20:52826435-52826457 CTGCATCCTCACATGGCAGAAGG + Intergenic
1175669207 20:60887357-60887379 CTGCATCAATCCATTGCAAATGG - Intergenic
1175706957 20:61186422-61186444 CTGCTTCCAGACATTCCAAAGGG + Intergenic
1176037353 20:63046172-63046194 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1176582658 21:8545703-8545725 CTGCATCTTCACATGGCATAAGG - Intergenic
1176913743 21:14599725-14599747 CTGCTTCCACTCATGGCTGAAGG - Intronic
1177003968 21:15648032-15648054 CTATATCCTCACATGGCAGAAGG - Intergenic
1177006246 21:15675872-15675894 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1177007138 21:15687362-15687384 CTGCATCTTCACATGACAGAGGG - Intergenic
1177187401 21:17812887-17812909 CTGCATCATCCCATGGCAGAAGG - Intronic
1177189988 21:17840222-17840244 CTGCCTCCGCTCATGGCAAGAGG - Intergenic
1177208941 21:18045820-18045842 CTGTGTCCTCACATGGCAGAAGG - Intronic
1177301979 21:19258802-19258824 CTGTAACCTCACATGGCAGAAGG + Intergenic
1177368267 21:20167649-20167671 ATGCTTCCACTCATGGCAGAAGG + Intergenic
1177669738 21:24209249-24209271 CTACATCCTCACATGACAAAAGG - Intergenic
1177867394 21:26528519-26528541 AAGCTTCCACTCATGGCAAAAGG - Intronic
1177969847 21:27776472-27776494 CTGCTTTCACTCATGGCAGAAGG + Intergenic
1178019442 21:28392920-28392942 CTGCAAAGTCACATGGCAAAGGG - Intergenic
1178071408 21:28972152-28972174 CTGTGTCCTCACATGGCAGAAGG - Intronic
1178166209 21:29980572-29980594 TTGTGTCCTCACATGGCAAAGGG - Intergenic
1178228341 21:30751244-30751266 CTGCATCAAAACATGGCAAAAGG - Intergenic
1178231456 21:30789748-30789770 CTGTGTCCCCACATGGCAAAGGG - Intergenic
1178383192 21:32128687-32128709 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179149824 21:38800215-38800237 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179151131 21:38809259-38809281 CTGTAGCCACACATGGCAAGTGG + Intronic
1179162580 21:38910286-38910308 CTGGAGCCACACATTCCAAAGGG - Intergenic
1179417778 21:41212242-41212264 CTGTCTCCTTACATGGCAAAAGG + Intronic
1179458897 21:41520383-41520405 CTGCATCATAACATGGCAGAAGG + Intronic
1179726099 21:43341922-43341944 GTGCCACCACACATGGCACATGG - Intergenic
1180113660 21:45681000-45681022 CTGCATTCTCACATGGCAGAAGG + Intronic
1180265490 22:10522751-10522773 CTGCATCTTCACATGGCATAAGG - Intergenic
1180677358 22:17596489-17596511 CTGCTTCCACTCATGGCAGAAGG - Intronic
1180919412 22:19512917-19512939 CTGCTTCCACTCATGGCAGAAGG + Intronic
1180942632 22:19669409-19669431 CTGCATCCTCACATGGCAGAAGG - Intergenic
1181975197 22:26723958-26723980 CTTCATCTTCACATGGCAGAAGG + Intergenic
1181975708 22:26727889-26727911 CTGCATCTTCACATGGCAGAAGG + Intergenic
1182018737 22:27063142-27063164 CTGCAAAGTCACATGGCAAAAGG + Intergenic
1182032398 22:27169547-27169569 CTACAACTACTCATGGCAAAAGG - Intergenic
1182108931 22:27709136-27709158 CTGCATCAGAACATGGCAGAAGG - Intergenic
1182146193 22:27998304-27998326 ATTCATACACTCATGGCAAATGG + Intronic
1182159327 22:28105794-28105816 CTACATCCCCACAGGGCAATGGG - Exonic
1182189507 22:28443697-28443719 CTTCAGCCACACAGAGCAAACGG + Intronic
1182206239 22:28630152-28630174 CTGCTTCCACTCATGGCAGAAGG - Intronic
1182265845 22:29114536-29114558 CTGTGTCCGCACATGGCAGAGGG - Intronic
1182817640 22:33180014-33180036 CTGTGTCCTCACATGGCAGAAGG - Intronic
1182920535 22:34075208-34075230 CTGTATCCTCACATGGCAGAAGG + Intergenic
1182946511 22:34327811-34327833 CTGCTTCCAGTCATGGCAGAAGG - Intergenic
1183012392 22:34957583-34957605 CTGTAACCTCACATGGCAGAAGG + Intergenic
1183017800 22:35004245-35004267 CTGCATCCTTACATGGTGAAAGG + Intergenic
1183799217 22:40147558-40147580 CTGCGTCCCCACGTGGCAAAAGG + Intronic
1183826665 22:40393751-40393773 CTGCATCCTAATATGGCAGAAGG + Intronic
1184343650 22:43900015-43900037 CTGCATCATAACATGGCACAGGG - Intergenic
1184399214 22:44264074-44264096 GTGCGTCCACACAATGCAAAGGG + Intronic
1184452229 22:44590179-44590201 CTACAGCCCCACTTGGCAAATGG + Intergenic
1184559782 22:45255542-45255564 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1184908806 22:47511711-47511733 CTGCATCCTCACATGGTGAAAGG - Intergenic
1185356946 22:50378993-50379015 CTGTGTCCTCACATGGCAAAAGG - Intronic
1185419438 22:50727318-50727340 CTGGATCCAGAAATGGCAAGGGG + Intergenic
1202715968 2_KI270715v1_random:2300-2322 CAGCTTCCAGACATGACAAAAGG - Intergenic
1202716297 2_KI270715v1_random:7068-7090 CAGCTTCCAGACATGACAAAAGG - Intergenic
1202716675 2_KI270715v1_random:12520-12542 CAGCTTCCAGACATGACAAAAGG - Intergenic
1202728661 2_KI270716v1_random:36259-36281 CAGCTTCCAGACATGACAAAAGG - Intergenic
1202728990 2_KI270716v1_random:41027-41049 CAGCTTCCAGACATGACAAAAGG - Intergenic
949153146 3:794531-794553 CTGCATCCTCACGTGGAAGAAGG - Intergenic
949264548 3:2141208-2141230 ATGCTACCTCACATGGCAAAAGG + Intronic
949313084 3:2721944-2721966 CTGTGTCCTCACATAGCAAAGGG - Intronic
949400445 3:3660079-3660101 CTGCATCATCCCATGGCAGAAGG + Intergenic
949422841 3:3884562-3884584 CTGCACCTTCACATGGCACAAGG - Intronic
949432315 3:3991130-3991152 CTGTGTCCTCACATGGCAAAAGG + Intronic
949563137 3:5221081-5221103 CTTGCTCCACAGATGGCAAAGGG - Intergenic
949602314 3:5613566-5613588 CTGGTTCCCCACATGGCAAAAGG - Intergenic
949603271 3:5624955-5624977 CTATATCCTCAAATGGCAAAAGG - Intergenic
949624488 3:5851381-5851403 CTGCTTCCACTCATGACAGAAGG - Intergenic
949636257 3:5984641-5984663 CTGTATCATCACATGGCAGAAGG + Intergenic
949761153 3:7472162-7472184 CTGCCTGCACTCATGGCAGAAGG - Intronic
949768013 3:7548341-7548363 CTGCTTCCACTCAGGGCAGAAGG - Intronic
950290364 3:11779196-11779218 CTGCCCCCACTCATGGCAGATGG - Intergenic
950307488 3:11927773-11927795 CTGCTTCCACTCATGGCAGAAGG + Intergenic
950455023 3:13087810-13087832 CTGCATCCTCCCGTGGCAGAAGG + Intergenic
950490752 3:13303497-13303519 CTGCTTCCACACCTGGGAAATGG - Intergenic
950567377 3:13778297-13778319 CTGTGTCCTCACATGGCATAAGG - Intergenic
950626677 3:14252632-14252654 CTGGGGCCACACATGGCAATCGG - Intergenic
950862002 3:16156458-16156480 CTGCATCAAAACATGGCATCAGG + Intergenic
950948769 3:16977903-16977925 CTGCATCCTCACATGGTGGAAGG + Intronic
951053676 3:18122920-18122942 TTGCTTCCACTCATGGCAGAAGG - Intronic
951229799 3:20165139-20165161 CTGCTTCCACTCATGGTAGAAGG + Intronic
951247741 3:20360607-20360629 CTGCATCGTAACATGGCAGAAGG - Intergenic
951288826 3:20850129-20850151 CTGCTTCCACTCATGGCGGAAGG + Intergenic
951391367 3:22108004-22108026 CTGCATCGTCACATGGTATAAGG - Intronic
951706613 3:25550458-25550480 CTGTAACCTCACATGGCAGAAGG + Intronic
951809574 3:26684596-26684618 CTGCACCACCACATGGCAGAAGG + Intronic
951985260 3:28612786-28612808 CTGCCTCCTCCCATGGCAGAAGG + Intergenic
952004036 3:28821845-28821867 CTGTGTCCTCACATGGCAATAGG + Intergenic
952011422 3:28904527-28904549 CTGTGTCCTCACATGGCAGAAGG + Intergenic
952122927 3:30266039-30266061 CTGCTTCCACTCATGGTGAAAGG - Intergenic
952124794 3:30287798-30287820 CTGCATCCACACATGGTGGAAGG - Intergenic
952519578 3:34143089-34143111 CTGCTTCCACCCATGGCAGAAGG - Intergenic
952597619 3:35037576-35037598 CTACTTCCTCACATGGCAGAAGG + Intergenic
952810704 3:37399981-37400003 CTGCATCATTACATGGCAGAAGG + Intronic
952843354 3:37666759-37666781 CTGCAAAGTCACATGGCAAAGGG + Intronic
952996833 3:38891658-38891680 CTGCATCATAACATGGCAGAAGG + Intronic
953000636 3:38929844-38929866 CTGCATCATCCCATGGCAGAAGG - Intronic
953008686 3:39002637-39002659 CTGCAAAGCCACATGGCAAAGGG - Intergenic
953011403 3:39028672-39028694 CTGCATCATAACTTGGCAAATGG + Intergenic
953307362 3:41842644-41842666 CTGTTTCCACTCATGGCAGAAGG - Intronic
953693398 3:45138964-45138986 CTGCTTCCACTCACGGCAGAGGG + Intronic
953892916 3:46767959-46767981 CTACATCCTAACATGGCAGAAGG + Intronic
954528415 3:51295243-51295265 CTGCTTCCACTCATGGCAGAAGG + Intronic
955036723 3:55275037-55275059 CTGCATCTTCCCAAGGCAAAAGG + Intergenic
955184186 3:56699367-56699389 CTGCGTCCTCACATGGCTAAAGG - Intergenic
955241644 3:57183234-57183256 CTGTGTCCTCACATGGCAGAAGG + Intergenic
955385849 3:58479243-58479265 CTGCTTCTACTCATGGCAGAAGG + Intergenic
955456063 3:59123007-59123029 CTGCTTCCACTCATGGCAGAAGG + Intergenic
955857531 3:63289425-63289447 CTGCTTCCACTCATGGCAGAAGG + Intronic
955892379 3:63663707-63663729 CTGCTTCCACTCATGGTAGAAGG - Intronic
956098025 3:65737787-65737809 CTCTACCCACATATGGCAAATGG + Intronic
956237523 3:67090810-67090832 CTGCATCATCCCATGGCAGAAGG - Intergenic
956244416 3:67165660-67165682 CTGTGTCCTTACATGGCAAAAGG + Intergenic
956271571 3:67453418-67453440 CTGTGTCCTCACATGGCAGAAGG + Intronic
956305989 3:67826034-67826056 CAGTAACCATACATGGCAAATGG + Intergenic
956339982 3:68211702-68211724 CTGCTTCCACTCATGGCAGAAGG + Intronic
956368229 3:68529640-68529662 CTGCCACCACTCATGGCAGAAGG + Intronic
956447685 3:69341798-69341820 CTATATCCTCTCATGGCAAAAGG - Intronic
956482776 3:69689513-69689535 CTGCTTCCACTTATGGCAGAAGG + Intergenic
956524941 3:70148578-70148600 CTGCTTCCACTCATGGCAGAAGG + Intergenic
956571862 3:70705569-70705591 CTGCATCCTCACATGGGGGAAGG + Intergenic
956586966 3:70875276-70875298 CTGCTTCTACTCATGGCAGAAGG - Intergenic
956689554 3:71863426-71863448 CTGTGTCCTCACATGGCAGAAGG + Intergenic
956694965 3:71910543-71910565 CTGCTTCCACTCATGGCAGAAGG - Intergenic
956758361 3:72412967-72412989 CTGTGTCCTCACATGGCAGAAGG - Intronic
956919189 3:73908274-73908296 CTGTGTCCTCACATGGCAGAAGG - Intergenic
956921991 3:73939551-73939573 CTGCTTCCACTCATGGCAGAAGG - Intergenic
956957347 3:74356131-74356153 CTGCATCCTCACATGGTAGAAGG - Intronic
956984225 3:74678632-74678654 CAGCATCATCACATGGCAAAGGG - Intergenic
957016559 3:75070427-75070449 CTGCATCCTCACATGGCAGAAGG - Intergenic
957141244 3:76360810-76360832 TTGCATCCACACAGGAGAAAGGG - Intronic
957180802 3:76875150-76875172 CTATATCCTCACATGGCAGAAGG - Intronic
957219753 3:77366697-77366719 CTGCTTCCACTTATGGCAGAAGG + Intronic
957245338 3:77709349-77709371 CTGCATCATCTCATGGCAGAAGG + Intergenic
957304318 3:78437477-78437499 CTACACCCTCACATGGTAAAAGG + Intergenic
957309495 3:78501197-78501219 CTGCTTCCACTCACGGCAGAAGG - Intergenic
957310304 3:78510337-78510359 CTGTGTCCTCACATGGCAGAAGG + Intergenic
957689277 3:83546327-83546349 CTGTGTCCACACATAGCAGAGGG - Intergenic
957896932 3:86433187-86433209 CTGCATCCTCACATGACAGAGGG + Intergenic
958011853 3:87889157-87889179 CTGCTTCCACTCATGGTAGAAGG - Intergenic
958069905 3:88596915-88596937 CTGTGTCCTCACATGGCAGAAGG - Intergenic
958163280 3:89846426-89846448 CTGAGTCCTCACATGGCAGAAGG - Intergenic
958259180 3:91359780-91359802 CTGCATCATAACATGGCAGAAGG + Intergenic
958602301 3:96312148-96312170 CTGCATCCTCACATGGCAGAAGG + Intergenic
958686799 3:97408670-97408692 CTGTGTCCTCACATGGCAGAAGG + Intronic
958922753 3:100124676-100124698 ATACATCCCCAAATGGCAAAAGG + Intronic
959003227 3:100989147-100989169 CTGCATCCTCACATGGTGGAAGG - Intronic
959135130 3:102409154-102409176 CTGCATCATAACATGGCAGAAGG + Intronic
959501326 3:107108854-107108876 CTGCATCTTCACATGGCAAAAGG + Intergenic
959517532 3:107286131-107286153 CTGCATCCTTACATGGTAGAAGG - Intergenic
959569318 3:107866400-107866422 CTGCGTCTTCACATGGCAGAAGG - Intergenic
959716504 3:109439261-109439283 CTGTGTCCATACATGGCAGAAGG - Intergenic
960080994 3:113540081-113540103 CTGCTTCCACTCACGGCAGAAGG + Intronic
960173072 3:114485761-114485783 CTGTATCTTCATATGGCAAAGGG - Intronic
960207695 3:114922686-114922708 CTGCTTCCACTCATGGCAGAAGG + Intronic
960268543 3:115649216-115649238 TTGCATCCTCACATGGCAGAAGG + Intronic
960470997 3:118065126-118065148 CTGCATCCTCACAGAGCAGAAGG + Intergenic
960697748 3:120412422-120412444 TGGCATCCTCACATGGCAGAAGG - Intronic
960849832 3:122041384-122041406 CTGCATCATCCCATGGCAGAAGG - Intergenic
960903262 3:122573049-122573071 CTGCTTCCATTCATAGCAAAGGG + Exonic
960931246 3:122853182-122853204 CTGCATTCTCATGTGGCAAAGGG + Intronic
961111650 3:124289079-124289101 CTGCATCATAACATGGCAGAAGG + Intronic
961479346 3:127169819-127169841 CTGCTTCCACTCATGGCAGAAGG - Intergenic
961562133 3:127737955-127737977 ATGCATTCACATATGGCACATGG + Intronic
961843373 3:129737519-129737541 CTGCATCATCACATGGTGAAAGG - Intronic
961902501 3:130226665-130226687 CTGCAACCTCACATGGCAGAAGG + Intergenic
961938153 3:130608004-130608026 CTGCATCCACACATGGCAGAAGG + Intronic
962012020 3:131401110-131401132 CTGCTTCCACTCATGGCAGAAGG + Intergenic
962252579 3:133845361-133845383 CTGCGTCCTCACATGGCAGAGGG - Intronic
962445836 3:135463827-135463849 CTGCATCCACACATGACATAAGG - Intergenic
962492078 3:135904077-135904099 CTGCTTCCACTCATGGCAGAAGG + Intergenic
962607618 3:137045570-137045592 CTGTATCCTCACATGGGGAAGGG + Intergenic
962620999 3:137178830-137178852 CTGTGTCCTCACATGGCCAAAGG + Intergenic
962629226 3:137258988-137259010 CTGGGTCCTCACGTGGCAAAAGG - Intergenic
962737361 3:138337872-138337894 CTGCTTCCATTCATGGCAGAAGG + Intergenic
962742334 3:138370860-138370882 CTGGATCCACACCTGGCATTAGG + Intronic
962770481 3:138606729-138606751 GAGCATCCACACATGGCAGAAGG + Intergenic
962961156 3:140312274-140312296 CAGAATCCATACATGCCAAAAGG - Intronic
962996072 3:140629867-140629889 ATACATCCGCAGATGGCAAAGGG - Intergenic
963173726 3:142277386-142277408 CTGCATCCTCACGTGGTGAAAGG - Intergenic
963347741 3:144116017-144116039 CTGCATCCACACATGGTAAAAGG - Intergenic
963470902 3:145740568-145740590 CTGCTTCCACTCATGGCAAAAGG - Intergenic
963500921 3:146125055-146125077 GTGCATCAACAAATGCCAAAAGG + Intronic
963534485 3:146511113-146511135 CTGCATTCTCACATGGCGGAAGG - Intergenic
963639304 3:147838839-147838861 CTGTGCCCTCACATGGCAAAAGG - Intergenic
963816277 3:149834729-149834751 CTGCTTCCATTCATGGCAGAAGG - Intronic
963834505 3:150043066-150043088 CTGCTTCCACTCATGGCAGAAGG - Intronic
964079775 3:152740026-152740048 CTGCATCATCCCATGGCAGAAGG - Intergenic
964269271 3:154937987-154938009 CTGCTTCCACTTACGGCAAAAGG - Intergenic
964443028 3:156731552-156731574 CTGCATTCACACAAAGCTAAAGG - Intergenic
964565357 3:158044957-158044979 CTTCTTCCACTCATGGCAGAAGG + Intergenic
964659783 3:159107302-159107324 CTGTGTCCACAAATGGCAAAAGG - Intronic
964990228 3:162801699-162801721 CTGCATCCTCACATGATGAAAGG - Intergenic
965127920 3:164653573-164653595 CTGCATCCAGAAATGGGAAGGGG + Intergenic
965411276 3:168334642-168334664 CAGCATACAATCATGGCAAAAGG - Intergenic
965629036 3:170711614-170711636 CTGCTTCCATTCATGGCAGAAGG - Intronic
965797562 3:172457243-172457265 CTGCATCCTCACATGGCAGAAGG + Intergenic
966008188 3:175043017-175043039 CAGCTTCCACTCATGGCATAAGG - Intronic
966077337 3:175953448-175953470 CTGCATCGGCACATGGCGAAGGG - Intergenic
966205109 3:177398257-177398279 CTGCTTCCACTCATGGCCGAAGG + Intergenic
966221685 3:177557676-177557698 CTGCACCATCACATGGCAGAAGG - Intergenic
966262994 3:178002264-178002286 CTGCATCCCCACATTGCAGGAGG + Intergenic
966288750 3:178329581-178329603 CTGTGTCCTCACATGGCAGAAGG + Intergenic
966345724 3:178977478-178977500 CTGCAAAGTCACATGGCAAATGG + Intergenic
966400380 3:179541688-179541710 CTGCTTCCACTCATGGCAGAAGG + Intergenic
966433354 3:179855767-179855789 CTGGGTCCTCACATGGCAGAAGG - Intronic
966566884 3:181392943-181392965 CTGCTTCCACTCATGGTAGAAGG + Intergenic
966970302 3:185039408-185039430 CTGCCTCCACTCAAGGCAGAAGG + Intronic
967146336 3:186609419-186609441 CTGCTTCCACTCATGGCGGAAGG - Intergenic
967260698 3:187638921-187638943 CTGTGTCTTCACATGGCAAAAGG + Intergenic
967719608 3:192801606-192801628 CTGTGTCCTCACATGGCAGAAGG - Intronic
967822194 3:193848548-193848570 CTGTGTCCTCACATGGCAAAAGG - Intergenic
967849927 3:194074142-194074164 CTGCATCATCCCATGGCAGAAGG + Intergenic
968789335 4:2648712-2648734 GTGCACCCACAGATGGCAGAGGG - Intronic
969189306 4:5504102-5504124 CTGCGTCCTCACATGGTAGAAGG - Intergenic
969328472 4:6458415-6458437 CTGCGTCCTCACATGACAGAAGG + Intronic
969355862 4:6625258-6625280 CTCCGTCCTCACATGGCAGAAGG + Intergenic
969461086 4:7329277-7329299 CAGCATTCACACTTGGCAAGAGG + Intronic
969671418 4:8592348-8592370 CCGCATCCACACAGGGGACAAGG + Intronic
969719247 4:8884054-8884076 CAGCGTCCTCACATGGCAGAAGG - Intergenic
969951000 4:10835522-10835544 ATGTGTCCTCACATGGCAAAAGG + Intergenic
969971401 4:11052109-11052131 CGGCATCCACATCTGGAAAATGG - Intergenic
970003456 4:11387642-11387664 CTGCATCATCCCATGGCAGAAGG - Intergenic
970142194 4:12994929-12994951 CTGCTTCCACTCATGGCAGAAGG + Intergenic
970162718 4:13205358-13205380 CTGTGTCCTCACATGGCAGAAGG + Intergenic
970209878 4:13698080-13698102 CTGTGTCCTCACATGGTAAAAGG + Intergenic
970225742 4:13855200-13855222 CTGTATCCTCACATGGCTGAGGG - Intergenic
970317467 4:14843121-14843143 CAGCATCCACACATATCAAGAGG + Intergenic
970471350 4:16382238-16382260 CTGTGTCTTCACATGGCAAATGG - Intergenic
970516739 4:16839269-16839291 CTGCTTCCATTCATGGCAGAAGG + Intronic
970568926 4:17360451-17360473 TCGCATCCTCACATGGCAGAAGG + Intergenic
970800091 4:19963067-19963089 CTGCATCCTCACATGGTGGAGGG + Intergenic
970964564 4:21913404-21913426 CTGTGTCCTCACATGGCAGAAGG - Intronic
971098549 4:23435850-23435872 CTGTGTTCTCACATGGCAAAAGG - Intergenic
971117211 4:23662526-23662548 CTGCATCATTCCATGGCAAAGGG - Intergenic
971230733 4:24798938-24798960 CTGGGCCCACACCTGGCAAAAGG - Intronic
971251233 4:24975086-24975108 CTGCAACCTCACATGGCATAAGG - Intronic
971459333 4:26877948-26877970 CTGCATCACTACATGGCAGATGG - Intronic
971793442 4:31198164-31198186 CTGCTTTCACTCATGGCAGAAGG - Intergenic
971892371 4:32541736-32541758 ATGCATGCTCACATGGCTAAAGG - Intergenic
971907443 4:32745531-32745553 CTGTGTCCTCACATGACAAAGGG + Intergenic
971984706 4:33807002-33807024 CTGCATCATCCCATGGCAGAAGG - Intergenic
972181369 4:36470847-36470869 CTGTGTCCTCACATGGCAGAAGG - Intergenic
972185345 4:36521284-36521306 CTTCTTCCACTCATGGCCAAAGG - Intergenic
972841383 4:42933696-42933718 CTGCATCTTCACATGGTGAAAGG - Intronic
972842374 4:42946654-42946676 CTGTATCCTCACATGGTGAAAGG + Intronic
973062862 4:45750927-45750949 CTGTGTCCTCACATGGCAGAAGG + Intergenic
973110907 4:46396680-46396702 CTGCTTCCACTCATGGCAGAAGG - Intronic
973534170 4:51864628-51864650 CTGCATCTTAACATGGCAGAAGG + Intronic
973766126 4:54164670-54164692 CTGTGTCCTCACATGGCAGAAGG + Intronic
974202033 4:58655152-58655174 CTGTGTCCTCACATGGCAGAAGG + Intergenic
974345821 4:60679720-60679742 CTGCAGCTTCACATGGCAAAAGG - Intergenic
974388990 4:61240158-61240180 CTGCATCCTTGCATGGCAGAAGG + Intronic
974432361 4:61815800-61815822 CTGTGTCCTCACATTGCAAAAGG - Intronic
974438765 4:61890475-61890497 CTGCATCATCCCATGGCAGAAGG + Intronic
974441868 4:61929238-61929260 CTGCATCCTCACATGGTACAAGG - Intronic
974547431 4:63331000-63331022 ATGAATCCACACATCACAAAGGG + Intergenic
974815570 4:66999715-66999737 CTGCTGCCACTCATGGCAGAAGG + Intergenic
974821462 4:67071374-67071396 CTGTGTCCTCACATGGCAGAGGG - Intergenic
974909685 4:68102124-68102146 GCTCATCCACGCATGGCAAATGG + Intronic
975152439 4:71035861-71035883 CTGTTCCCACACAAGGCAAATGG + Intergenic
975455509 4:74585490-74585512 CTGCTTCCACTCATGGCAGAAGG - Intergenic
975566766 4:75764877-75764899 CTGCATTCCTACATGGCAACAGG + Intronic
975923786 4:79424447-79424469 CTGCGTCCTCACATGGTAGAAGG + Intergenic
976143096 4:82013440-82013462 CTGCATTATCACATGGCAAAAGG - Intronic
976224891 4:82788096-82788118 CTGTGTCTTCACATGGCAAAAGG - Intronic
976270405 4:83224728-83224750 CTGCATCACCCCATGGCAGAGGG - Intergenic
976826323 4:89264330-89264352 CTGCTTCCACTCATGGTAGAAGG - Intronic
976876006 4:89854577-89854599 CTGCTTCCACTCATGGCAGAAGG + Intergenic
976994046 4:91407641-91407663 CTGCTTCCACTCATGGTAGAAGG + Intronic
977127623 4:93189346-93189368 CTGCATCCTCACATGGTAGAAGG + Intronic
977141923 4:93384120-93384142 CAGTATCCTCACATGGCCAAAGG + Intronic
977421314 4:96803325-96803347 CTGTAACCTCACATGGCAGAAGG - Intergenic
977437682 4:97020043-97020065 CTGCTTCCACTCATGGCAGAAGG + Intergenic
977490705 4:97706427-97706449 CTGTGTCCTCACATGGCAGAAGG - Intronic
977540066 4:98306357-98306379 CTGCATTCTCACATGACAGAAGG + Intronic
977604150 4:98965051-98965073 CTGCTTTCACTCATGGCAGAAGG - Intergenic
977748467 4:100579864-100579886 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748602 4:100581009-100581031 CTGTGTCCTCACATGGCAGAAGG - Intronic
977880495 4:102198942-102198964 CTGTGTCCTCACATGGCAGAAGG + Intergenic
978063819 4:104371410-104371432 CTGCTTCCACTCACGGCAGAAGG + Intergenic
978156008 4:105489864-105489886 CTGTGTCCTCACATGGTAAAAGG - Intergenic
978526806 4:109675844-109675866 CTGCATCATCCCATGGCAAAAGG - Intronic
978661262 4:111129188-111129210 CTGCATCCTCACACGGGAGAAGG - Intergenic
978750619 4:112242533-112242555 CTGCTTCCACTAGTGGCAAAAGG + Intronic
979080262 4:116329840-116329862 CTGCATCCTCACATGGCAGAAGG - Intergenic
979086748 4:116421518-116421540 CTGCATCATAACATGGCAGAGGG + Intergenic
979174388 4:117644490-117644512 CTGTGTCCTCACATGGCAGAAGG + Intergenic
979262571 4:118665798-118665820 CTGTTTCCACTCATGGCAGAAGG + Intergenic
979351031 4:119644797-119644819 CTGCATCATAACATGGCAGAGGG - Intergenic
979772688 4:124548401-124548423 CTGCTTCCACAAATGGTGAAAGG - Intergenic
979791279 4:124784411-124784433 CTGCATCATAACATGGCAAAAGG - Intergenic
980174848 4:129332209-129332231 CTGTAACCTCACATGGCAGAAGG - Intergenic
980269176 4:130562303-130562325 AAGCATCCACTCATGGCAGAAGG - Intergenic
980482108 4:133400409-133400431 CTGCATCCTCACACGGTAGAAGG + Intergenic
980512404 4:133811999-133812021 CAGGAGCTACACATGGCAAAGGG + Intergenic
980524392 4:133970803-133970825 CTGCATCCTCACATAGCAGAAGG - Intergenic
980662324 4:135878579-135878601 CTGTGTCCTCACATGGCAGAAGG - Intergenic
980770404 4:137364605-137364627 ATGCATCCTCATATGGCAGAAGG - Intergenic
980844517 4:138307988-138308010 CTGCATTCACGGATGGGAAATGG - Intergenic
980976571 4:139616785-139616807 CTGCATCCTCACATGGTGGAAGG + Intergenic
981052374 4:140321989-140322011 CTGCATCCTCACATGGCAGGAGG - Intronic
981102678 4:140847446-140847468 TTGCATCCTCACATGACAGAAGG + Intergenic
981154467 4:141417484-141417506 CTGCTTCCATTCATGGCAGAAGG - Intergenic
981377559 4:144033419-144033441 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981530019 4:145743350-145743372 CTGCATCATCCCATGGCAGAAGG + Intronic
981797935 4:148619193-148619215 CTACTTCCACTCATGGCAGAAGG - Intergenic
981869239 4:149466885-149466907 CTGCATCCACACAAGACAGAAGG + Intergenic
981874635 4:149527437-149527459 CTGCATCCTCACATGGCAGAAGG - Intergenic
981921119 4:150085701-150085723 CTGCATCCTCACATGCTAGAAGG - Intronic
982331365 4:154185199-154185221 TTGCATCCCTACATGGCAGAAGG - Intergenic
982401644 4:154974344-154974366 CTGCGTCCTCACATGGCAGAAGG - Intergenic
982413348 4:155104115-155104137 CTGCATCCTCACATGGTAGAAGG - Intergenic
982423715 4:155230163-155230185 CTGCACCCATATATGGAAAATGG + Intergenic
982461819 4:155679439-155679461 CTGCTTCCACTCATGGCAGAAGG + Intronic
982660446 4:158200323-158200345 CTGCTTCCACTCATGGCAGAAGG - Intergenic
982694270 4:158581896-158581918 CTGCTTCCACTCATGGCAGAAGG + Intronic
982780913 4:159490572-159490594 CTGCATCATCTCATAGCAAAAGG - Intergenic
982832724 4:160084655-160084677 CTGCCTCCTCACATGGCAGAAGG + Intergenic
982880939 4:160714330-160714352 TTGCATCCTCACATGGCAGAAGG + Intergenic
982951193 4:161698147-161698169 CTGTGTCCTCACATGGCAGAAGG - Intronic
983259038 4:165435027-165435049 CTGCTTCCACTCATGGCAGAAGG - Intronic
983373546 4:166896318-166896340 CTGCCCCCACCCATGGCTAATGG + Intronic
983500638 4:168495397-168495419 CTGTGTCCTCACATGGCAGAAGG - Intronic
983573618 4:169236556-169236578 CTGCTTCCTCACCTGGAAAATGG + Intronic
983574234 4:169242790-169242812 CTGCATCATCACATGGCAGAAGG - Intronic
983656302 4:170088878-170088900 CTGCATCCTCACGTGGTAGAAGG - Intronic
983669688 4:170221714-170221736 CTGCCTCCACACATGGTGGAAGG - Intergenic
983797808 4:171887112-171887134 CTGCATTATCACATGACAAATGG + Intronic
983969272 4:173851176-173851198 CTGCATCCACACATGGCAGGAGG - Intergenic
984147720 4:176084267-176084289 CTGCCTCCACTCATGGTAGAAGG + Intronic
984255373 4:177384134-177384156 CTGCATCCTCACACGGCAGAAGG + Intergenic
984365234 4:178791224-178791246 CTGCATCGTAACATGGCAAAAGG - Intergenic
984389366 4:179109426-179109448 CTGCATCATCCCATGGCAGAAGG - Intergenic
984419466 4:179501685-179501707 CTGCTTCTACACATTGCAGAAGG + Intergenic
984435958 4:179710420-179710442 CTGTAACCTCACATGGCAGAAGG + Intergenic
984863387 4:184259187-184259209 CTGTGTCCTCACATGGCAGAAGG - Intergenic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
984900649 4:184583230-184583252 CTGTGTCCTCACATGGCAGAAGG - Intergenic
984983196 4:185302628-185302650 CCACATCCTCACATGGCAGAAGG - Intronic
985007074 4:185544612-185544634 CTGCATTATCACATGGCAGAAGG + Intergenic
985073093 4:186187687-186187709 CTGCATCATCCCATGGCAGAAGG - Intergenic
985254736 4:188058473-188058495 CTGTGTCCTCACATGGCAGAAGG + Intergenic
985745096 5:1642396-1642418 CTGCGTCCTCACATGGCGGACGG + Intergenic
985991792 5:3567768-3567790 CTGAAGCCACACAAGGCTAATGG - Intergenic
986255335 5:6098286-6098308 CTGCATCCTCATGTGGCAGAAGG + Intergenic
986425407 5:7626597-7626619 CTGCCTCCACTCATGGATAATGG + Intronic
986481166 5:8189639-8189661 CAGAATCCACAAATAGCAAAAGG + Intergenic
986535650 5:8784129-8784151 CTGTGTCCTCACATGGCAGAAGG - Intergenic
986912214 5:12572329-12572351 CTGCATCATCAAATGGCAGAAGG + Intergenic
987154610 5:15076622-15076644 CTGCATCATCCCATGGCAATAGG - Intergenic
987236636 5:15949259-15949281 CAGTAACCACACATGGCAAGTGG - Intergenic
987571064 5:19659716-19659738 CTGCATCCTCACATGGCAGAAGG - Intronic
987716783 5:21581576-21581598 CTGTATCATCACATGGCACAAGG - Intergenic
987884317 5:23793973-23793995 CTGCTTCCACTCATGACAGAAGG + Intergenic
988058050 5:26126110-26126132 CTGCATCAACCTATGGCAGAAGG + Intergenic
988068101 5:26249696-26249718 CTGTATTCTCACATGCCAAAAGG + Intergenic
988156529 5:27458854-27458876 CTGCTTCTACTCATGGCAGAAGG + Intergenic
988288567 5:29254896-29254918 CTGTGTCCTCACATGGCAGAAGG + Intergenic
988410155 5:30876371-30876393 TTGCATCCTCACATGGCAGAAGG + Intergenic
988545767 5:32156103-32156125 TTGCATCCTCACATGGCAGAAGG - Intronic
988708120 5:33745263-33745285 CTGCCTCCACCCAAGGCAGATGG + Intronic
988714852 5:33815412-33815434 CTGCATCTTCACACGGCAGAGGG - Intronic
988756389 5:34256757-34256779 CTGCTTCCACTCATGGTAGAAGG + Intergenic
989110675 5:37904063-37904085 TTGCATTCACACATGGCAGAAGG - Intergenic
989185867 5:38625472-38625494 CTGCTTCCACTCATGGCAGAAGG + Intergenic
989350396 5:40479402-40479424 CTGCATCATCTCATGGCAGAAGG - Intergenic
989752806 5:44916021-44916043 CTGCTTCCACCCATGGCAGGAGG - Intergenic
990005144 5:50937249-50937271 CTGCATCATCCCATAGCAAAAGG + Intergenic
990145206 5:52751880-52751902 CTGTGTCCTCATATGGCAAAAGG + Intergenic
990434337 5:55772769-55772791 CTGCTTCCACCCATGGCTGAAGG - Intronic
991214020 5:64140965-64140987 CTACATCTTCACATGGCAGAAGG + Intergenic
991221529 5:64224907-64224929 CTGCATCCTCACATGGCAGAAGG - Intronic
991274500 5:64828539-64828561 CTGCATCCTCAAATGGCAGAGGG + Intronic
991288618 5:65009092-65009114 CTGCTTCCACTCATGGTAGAAGG + Intronic
991292940 5:65050441-65050463 CTGTGTCCTTACATGGCAAAAGG + Intergenic
991322083 5:65384972-65384994 CTGCATCTTCACATGGTAGAAGG + Intronic
991349146 5:65702590-65702612 CTGTGTCCTCACATGGCAAGAGG + Intronic
991357512 5:65784527-65784549 CTATATCCTCACATGGCAGAAGG + Intronic
991514851 5:67424000-67424022 CTGTGTCCTCACATGGCAGAAGG - Intergenic
991532093 5:67626849-67626871 CTGCATTCTCACATGGCAGAAGG - Intergenic
991989488 5:72323444-72323466 CTGCATCCACACACAATAAAAGG - Intronic
992041217 5:72835473-72835495 CTGCATCCCCACATGGACGAAGG + Intronic
992128299 5:73665612-73665634 CTGCATCATCTCATGGCAGAAGG + Intronic
992159705 5:73989301-73989323 CTGCAAAGCCACATGGCAAAGGG + Intergenic
992268176 5:75038620-75038642 CTGTGTTCTCACATGGCAAAGGG + Intergenic
992353277 5:75953097-75953119 CTGCTTCTACTCATGGCAGAAGG + Intergenic
992401024 5:76411631-76411653 CTGCACCGTAACATGGCAAAAGG - Intronic
992832184 5:80604449-80604471 CTGCATTCCGACATGGCAGAAGG - Intergenic
992920874 5:81518470-81518492 CAGCATCCTCACATGGCAGAGGG - Intronic
992947985 5:81828271-81828293 CTGCTTCCACTCATGGCAGAAGG - Intergenic
993023362 5:82618478-82618500 CTGTGTCCTCACATGGCAGAAGG + Intergenic
993526927 5:88976489-88976511 CTGCATTCTCACATGGTAGAAGG + Intergenic
993564475 5:89456079-89456101 CTGCATCCCCTCATGGCAGAAGG - Intergenic
993744913 5:91585533-91585555 CTGCATCATCCCATGGCAGAAGG + Intergenic
993748293 5:91630246-91630268 CTGGATCCTCACATGGCAGAGGG - Intergenic
994015746 5:94962981-94963003 CTGTGTCCTCACATGGCAAAAGG + Intronic
994117522 5:96077732-96077754 CTGCTTCCACTCATGGTAGAAGG - Intergenic
994427678 5:99614321-99614343 CTGCATCCTCACATGATGAAAGG + Intergenic
994431846 5:99676016-99676038 CTGCTTTCACTCATGGCAGAAGG + Intergenic
994488359 5:100408728-100408750 CTAAATCCACACATTGCAAAAGG - Intergenic
994568966 5:101488572-101488594 CTGCTTCCATTCATGGCAGAAGG - Intergenic
994631178 5:102290124-102290146 CTGCTTCCACTCAGGGCAGAAGG + Intronic
994640510 5:102402598-102402620 CTGCATCATCTCATGGCAGAAGG + Intronic
994665933 5:102705244-102705266 CTGCATCCTCATATGGCAGAAGG - Intergenic
994843895 5:104960310-104960332 CTGTATCATCTCATGGCAAAAGG - Intergenic
995027347 5:107439226-107439248 CTGAGTCCTCACATGGCAGAAGG - Intronic
995058384 5:107787584-107787606 TTGCATCCTCACATGGCGAAAGG - Intergenic
995058585 5:107789321-107789343 CTGCATCCTCACATGGTGGAAGG - Intergenic
995205103 5:109470544-109470566 CTGCTTCCACTCATGGCAGAAGG - Intergenic
995316664 5:110782383-110782405 TTGCTTCCACACATGGAGAAAGG + Intergenic
995349963 5:111163867-111163889 CTGCTTCCACTCATGGTGAAAGG + Intergenic
995350289 5:111167175-111167197 TTGCATCTTCACATGGCAGAAGG - Intergenic
995394182 5:111670118-111670140 CTGCATCCTCACATGGCAAAAGG + Intronic
995467851 5:112469238-112469260 CTGCTTCCACTCATGGCAGATGG + Intergenic
995512009 5:112919653-112919675 CTGCTTCCTCACATGGTAGAAGG - Intronic
995514096 5:112937120-112937142 CTGTGTCCCCACATGGCAGAAGG - Intergenic
995535402 5:113130759-113130781 CTGCTTCTACTCATGGCAGAAGG - Intronic
995579431 5:113580066-113580088 CTGTGTCCTCATATGGCAAAAGG + Intronic
995581227 5:113605249-113605271 CTGCTTCCACTCATGGCAGAAGG - Intergenic
995621743 5:114033084-114033106 CTGCGTCCTCACATAGCAGAAGG - Intergenic
995755482 5:115499190-115499212 CTGTGTCCTCACATGGCAGAAGG + Intergenic
995827996 5:116322856-116322878 CTGCATCATTACATGGCAAGAGG + Intronic
995856364 5:116597127-116597149 CTGCTTCCACTCATGGTGAAAGG - Intergenic
995926857 5:117385408-117385430 CTGCATCCTCACACAGCAGAAGG - Intergenic
995971726 5:117980449-117980471 ATGCATCCACTAATGGTAAATGG + Intergenic
996182198 5:120432613-120432635 TTGCATCGTCACATGGCCAAAGG - Intergenic
996258174 5:121430898-121430920 CTGCTTCCACTCATGGCAAAAGG - Intergenic
997385805 5:133471519-133471541 CTGTGTCCTCACATGGCAGAAGG - Intronic
997841801 5:137247740-137247762 CTGCATCATGACATGGCAGAGGG + Intronic
997939270 5:138142164-138142186 CTGTATCCTCACATGGCAGAAGG - Intronic
998591645 5:143485447-143485469 ATGCTTCCACTCATGGCAGAAGG + Intergenic
998980966 5:147701732-147701754 CTGCATCCTCACATGGCAGAAGG - Intronic
999297229 5:150467305-150467327 CTGCATCCTCACATGGTGGAAGG - Intergenic
1000046155 5:157523597-157523619 CTGCTTCCACTCATGGCAGAAGG - Intronic
1000089375 5:157917041-157917063 CTGCATCATCCCATGGCAGAAGG - Intergenic
1000136981 5:158362493-158362515 TGGCATCCTCACATGGCAAAAGG + Intergenic
1000251458 5:159499535-159499557 CTGTATGCACACGTGGAAAATGG + Intergenic
1000610534 5:163368669-163368691 CTGCTTCCACTCATGGTAGAAGG - Intergenic
1000801226 5:165728610-165728632 CTGCATAGAAACATGCCAAATGG + Intergenic
1000841201 5:166220658-166220680 CTGTATCCTCATATGGCCAAAGG + Intergenic
1000966044 5:167658161-167658183 CTGTGTCCTCACATGGCAGATGG + Intronic
1001156671 5:169278407-169278429 ATGAATCCCCACATGGCAAGAGG - Intronic
1001171829 5:169426819-169426841 CTGCTTCCACTCATAGCAGAAGG + Intergenic
1001443026 5:171760640-171760662 CTGCATCCTCATGTGGCAGAAGG + Intergenic
1001814271 5:174654928-174654950 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1001879244 5:175228963-175228985 CTGCTTCTACCCATGGCAGAAGG + Intergenic
1002478369 5:179482913-179482935 CTCCATCCACACATGGGAGGGGG - Intergenic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1002579796 5:180200946-180200968 CTGCCACCACACTTGGCTAAAGG - Intronic
1002592139 5:180298181-180298203 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002737270 5:181404376-181404398 CTGTTTCCACTCATGGCAGAAGG + Intergenic
1002883979 6:1277496-1277518 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1003063934 6:2886172-2886194 CTGCTTCCACTGATGGCAAAAGG + Intergenic
1003227092 6:4215795-4215817 CTGCTTCCACTCATGGCAAAAGG - Intergenic
1003318786 6:5034610-5034632 CTGCTTCCGCTCATGGCAGAAGG - Intergenic
1003321036 6:5051810-5051832 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1003544291 6:7045414-7045436 CTCCATGCACAGATGGCACAGGG - Intergenic
1003644126 6:7900771-7900793 CTGTGCCCTCACATGGCAAAAGG + Intronic
1003682704 6:8271766-8271788 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1003944912 6:11065939-11065961 CTGAGTTCTCACATGGCAAAAGG - Intergenic
1003951517 6:11120416-11120438 CTGTGTCCAAACATGGCAGAAGG + Intronic
1003953569 6:11141620-11141642 CTGCTTCCATTCATGGCAGAAGG - Intergenic
1004082190 6:12405817-12405839 CTGCTTCCATTCATGGTAAAAGG + Intergenic
1004246819 6:13985906-13985928 CTGCTTCCACTCATGACAGAAGG - Intergenic
1004298319 6:14434401-14434423 CTGCTTCCAGTCATGGCAAAAGG - Intergenic
1004382042 6:15140761-15140783 CTGCATCGTAACATGGCAGAAGG + Intergenic
1004823194 6:19392499-19392521 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1004971752 6:20918153-20918175 CTGTGTCCTCACATGGCAGAAGG - Intronic
1005038307 6:21577892-21577914 TTGCATCCTCACATGGCAGAAGG + Intergenic
1005849073 6:29805404-29805426 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1005869153 6:29960618-29960640 CTGCTCCCACTCATGGCAGAAGG - Intergenic
1005878903 6:30039105-30039127 CTGCATCCTCCCATGGCAGAAGG - Intergenic
1005907214 6:30273973-30273995 CTGCATCATCACATGGCTGAAGG + Intergenic
1006605179 6:35251013-35251035 CTGCTTCCAAACAAGGGAAATGG + Exonic
1006698099 6:35948920-35948942 CAGCATCCCCACATGGCAGAAGG - Intronic
1006869023 6:37233473-37233495 CTGCATGCTCACATGGGAGAAGG + Intronic
1006876128 6:37298294-37298316 CTCCATCCATACATAGGAAAAGG - Intronic
1007076123 6:39067454-39067476 CTGTGTCCTCACATGGCAGAGGG + Intronic
1007164520 6:39819788-39819810 CTGTGTCCTCACATGGCAGATGG + Intronic
1007295918 6:40820395-40820417 CTGCACCCTCACATGGCAGAAGG - Intergenic
1007362256 6:41367368-41367390 CTGCTTCCATTCATGGCAGAAGG - Intergenic
1007367471 6:41405203-41405225 CTGCATTCTCACATGGCTGAAGG + Intergenic
1007720388 6:43881673-43881695 CTACATCATCCCATGGCAAAAGG - Intergenic
1007828114 6:44616975-44616997 CTGCATCCTCACATGGTGGAGGG - Intergenic
1007878434 6:45134160-45134182 CTGCATCATCCTATGGCAAAAGG + Intronic
1007928352 6:45668307-45668329 TTGCATCCTCACATGGCAGAAGG + Intergenic
1008011245 6:46469877-46469899 CTGTGTCCTCACATGGCCAAAGG - Intronic
1008439098 6:51511837-51511859 CTGCATCCACACTCTTCAAAGGG - Intergenic
1008614813 6:53216472-53216494 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1008746366 6:54674375-54674397 CTGCATCATCACATGGCAGAAGG - Intergenic
1008840441 6:55896609-55896631 CTGCGTCCTCACATGGTGAAAGG + Intergenic
1009184603 6:60559589-60559611 CTGCATCATAACATGGCAGAAGG - Intergenic
1009594353 6:65715245-65715267 CTGCATCCACACATGATGGAAGG + Intergenic
1009801333 6:68540443-68540465 CTGCTTCCTCACATAGCAGAAGG + Intergenic
1010024912 6:71204069-71204091 CTGCTTCCACTCATGACAGAAGG + Intergenic
1010081657 6:71870914-71870936 CTGCATCCTCACATGGGAGAAGG - Intergenic
1010179690 6:73071588-73071610 CTGCCTCCACTCATGGCAGAAGG + Intronic
1010255861 6:73757593-73757615 CAACAGCCACACATGGCAAGTGG - Intronic
1010339580 6:74732555-74732577 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1010445384 6:75943496-75943518 CTGTTTCCACTCATGGCAAAAGG - Intronic
1010531881 6:76978434-76978456 CTGCTTCCACTTATGGCAGAGGG - Intergenic
1010582638 6:77618171-77618193 CTGTATCCTCCCATGGCAGAAGG - Intergenic
1010652971 6:78477730-78477752 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1011073264 6:83409063-83409085 CTGTGTCCTCACATGGCAGAAGG - Intronic
1011171814 6:84513188-84513210 CTGCGTCCTTACATGGCAGAAGG - Intergenic
1011227322 6:85121929-85121951 CTGCATCATAACATGGCAGATGG - Intergenic
1011548466 6:88506189-88506211 CTGCATCAAAACATGGCGTAAGG - Intergenic
1012065753 6:94549423-94549445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1012083279 6:94787689-94787711 CTGCATCATCTCATGACAAAAGG - Intergenic
1012434213 6:99197722-99197744 CTGCATCATCACATGGCAGAAGG + Intergenic
1012440585 6:99258814-99258836 TGGCATCCTCACATGGTAAATGG + Intergenic
1012443232 6:99281671-99281693 CTGTGTCCTCACATGGTAAAAGG - Intronic
1012831258 6:104206098-104206120 CTGCATCCTCACAGGGCAGAAGG - Intergenic
1013427590 6:110027895-110027917 CTGCATCCTCACATGGCAGAAGG + Intergenic
1013692615 6:112663798-112663820 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1013768626 6:113601719-113601741 CTGCATCATAACATGGCGAAAGG - Intergenic
1013859225 6:114614090-114614112 CTTCATCCACACATGTCAAGAGG - Intergenic
1013862268 6:114650064-114650086 CTGCATCATCCCATGGCAGAAGG + Intergenic
1014021375 6:116594033-116594055 CTGCTTCCACTCATGGTAGAAGG + Exonic
1014114966 6:117660572-117660594 CTCTTTCCACACAAGGCAAATGG - Intergenic
1014129812 6:117817772-117817794 CTCCTTCCACTCATGGCAGAAGG - Intergenic
1014181808 6:118392736-118392758 CTACATCCTCACATGGCAGAAGG + Intergenic
1014294848 6:119605685-119605707 CTGTGTCCCCACATGGCTAAGGG + Intergenic
1014503618 6:122225793-122225815 CTGCATCCTCACATGGTGGAAGG + Intergenic
1014687106 6:124515340-124515362 CTGCTTCCACTCATGGCAGAAGG + Intronic
1014698143 6:124650518-124650540 CTGCATCATAATATGGCAAAAGG + Intronic
1014779073 6:125542504-125542526 CTGCATCATCACATGGCAGAAGG - Intergenic
1014786943 6:125630385-125630407 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1014918370 6:127181998-127182020 CTGCTTCCACTCATGACAGAAGG + Intronic
1014962450 6:127703972-127703994 CTGCATCCTTACATGGCAGGAGG + Intergenic
1015069141 6:129068467-129068489 CTGTAGCCTCACATGGCAGAAGG + Intronic
1015094630 6:129400136-129400158 CTGTGTCCTCACATGGTAAAAGG + Intronic
1015196577 6:130530068-130530090 CTGCTTCCACACAGCCCAAAAGG - Intergenic
1015206951 6:130650954-130650976 TTGCTTCCACTCATGGCAGAAGG + Intergenic
1015210110 6:130687242-130687264 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1015211932 6:130708557-130708579 CTGCTTCCACTCATTGCAGAAGG + Intergenic
1015480807 6:133706400-133706422 CTGCATCATAACATGGCAGAAGG - Intergenic
1015606389 6:134959311-134959333 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1015739578 6:136439336-136439358 CTGCATCCTCATATAGTAAAAGG - Intronic
1016026691 6:139294579-139294601 CTGCACCCTCACATGGCAGAGGG - Intergenic
1016029401 6:139322305-139322327 TTGCATCCTCACATGGCAGAAGG + Intergenic
1016265397 6:142227390-142227412 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1016309364 6:142716433-142716455 CTGCTTCCACTCATGGTATAAGG - Intergenic
1016388040 6:143548172-143548194 CTGTGTCCTCACATGGCAGAGGG + Intronic
1016587539 6:145706998-145707020 CTGCAGCCTCACATGGCAGAGGG - Intronic
1016806858 6:148220258-148220280 CTGTATCCTCATATGGCAGAAGG + Intergenic
1016916930 6:149252722-149252744 CTCCAACATCACATGGCAAAGGG - Intronic
1016983395 6:149874927-149874949 CTGCATCCCCACATGGTGGAAGG + Intergenic
1017065053 6:150520771-150520793 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1017087282 6:150725177-150725199 GTGTATCCTCACATGGCAGAAGG + Intronic
1017301981 6:152871968-152871990 TTGCATACACACATGCAAAATGG + Intergenic
1017468403 6:154716482-154716504 CTGCTTCCATTCATGGCAGAAGG + Intergenic
1017620994 6:156296898-156296920 TTGTGTCCACACATGGCAAAAGG - Intergenic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1018155427 6:160981039-160981061 CTGCATCCTCACATAGCAGGAGG - Intergenic
1018226693 6:161635968-161635990 CTTCATCCACACATGCCCCAGGG + Intronic
1018234900 6:161714419-161714441 CTGTGTCTTCACATGGCAAAAGG - Intronic
1018464270 6:164028956-164028978 CTGCATCCTCACATGGTAGAGGG - Intergenic
1018593642 6:165454616-165454638 CTGCATCATCCCATGGCAGAAGG - Intronic
1018782194 6:167078298-167078320 CTGCATCCTCACAGGGAGAAGGG + Intergenic
1018805141 6:167253462-167253484 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1018805444 6:167255830-167255852 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1019242365 6:170679932-170679954 CTGTTTCCACTCATGGCAGAAGG + Intergenic
1019331289 7:462058-462080 CTGGACCCACACATGGGAAAGGG + Intergenic
1019939865 7:4281355-4281377 CTGTATCCTCATGTGGCAAAAGG - Intergenic
1019941367 7:4294361-4294383 CTGCATCAGCACGTGGCAGAAGG - Intergenic
1020380447 7:7539273-7539295 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1020881192 7:13764946-13764968 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1020945431 7:14600140-14600162 ATGCATCCACTCATGGCAGAGGG + Intronic
1021465439 7:20938001-20938023 CTGAGTCCTCACATGGCAGAAGG + Intergenic
1021559905 7:21959210-21959232 CTGCTTCCACGCATGGTGAAAGG - Intergenic
1021586979 7:22219838-22219860 CTGCATCCCCAAGAGGCAAAAGG + Intronic
1021797562 7:24272455-24272477 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1021808539 7:24380109-24380131 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1021976937 7:26020223-26020245 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022150292 7:27596222-27596244 CTGTGTCCTCACATGGCAGAAGG + Intronic
1022212470 7:28224970-28224992 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022224198 7:28346351-28346373 CTGTATCCTCACATGGGAGAAGG + Intronic
1022371102 7:29772395-29772417 CTGTATCCTCACATGGCAGAGGG + Intergenic
1022386811 7:29907646-29907668 CTGCATCTTCACATGGTGAAAGG - Intronic
1022512469 7:30949023-30949045 CTGCTTCCACTCATGGCAGAAGG - Intronic
1022968593 7:35496828-35496850 CTGCAACCTCACAGGGCAAAAGG - Intergenic
1023372622 7:39527316-39527338 CTGCATCCACTCATGGCAAAAGG + Intergenic
1023681197 7:42689289-42689311 ATGCATACACGCATGGCCAATGG + Intergenic
1023854543 7:44174325-44174347 CTGCTTCCACTCATGGCAGAAGG - Intronic
1023862341 7:44224278-44224300 CTGCCTCCCCACATAGCACATGG + Intronic
1023988877 7:45115997-45116019 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1024132071 7:46363231-46363253 CTGCATCCTCATATGGCAGAAGG + Intergenic
1024253482 7:47523160-47523182 CTGCATCCTCACATAGCCAAAGG + Intronic
1024448252 7:49507900-49507922 CTGCATCATCGCATGGCAGAAGG + Intergenic
1024466848 7:49720454-49720476 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1024490690 7:49980549-49980571 CTGCTTCCACCCATGGCAGAAGG + Intronic
1024700300 7:51899330-51899352 CTGCGTCCTCACATGGCTGAAGG + Intergenic
1024716333 7:52083440-52083462 CTGCATCCTCACATGGCAGAAGG + Intergenic
1024755281 7:52522147-52522169 CTGTGACCTCACATGGCAAAGGG + Intergenic
1024813982 7:53245920-53245942 CTGCTTCCACCCACGGCAGAAGG - Intergenic
1024939950 7:54751923-54751945 TTGTGTCCTCACATGGCAAAAGG - Intergenic
1025285527 7:57657536-57657558 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1025287880 7:57683272-57683294 CTGCATCTTCACATGGCATAAGG + Intergenic
1025529565 7:61861994-61862016 ATGAATCCACACATCACAAAGGG + Intergenic
1025532504 7:61906597-61906619 TTGAATCCACACATCACAAAGGG - Intergenic
1025593016 7:62887245-62887267 CTGAATGCACACATCACAAAGGG - Intergenic
1025735441 7:64142863-64142885 CTGCATCTTCCCATGGCAAAGGG + Intronic
1025887896 7:65615578-65615600 CTGTGTCCTCACATGGCAGATGG + Intergenic
1025952767 7:66158470-66158492 CTGGATCCTCACATGGCACAAGG - Intergenic
1026040601 7:66865421-66865443 CTGCATCTTCCCATGGCAGAAGG - Intergenic
1026560357 7:71443594-71443616 CAGCTTCCACTCATGGCAGAAGG - Intronic
1026736832 7:72954358-72954380 CTGCAGCCGCACCTGGCCAAGGG - Intergenic
1026818542 7:73531024-73531046 CTGTATCTTCACATGGCAGAAGG + Intergenic
1027106902 7:75410705-75410727 CTGCAGCCGCACCTGGCCAAGGG + Intronic
1027154866 7:75759715-75759737 CTGCTTCCTCACATGGCAGAAGG - Intergenic
1027684048 7:81259318-81259340 CTGCTTGCACTCATGACAAAAGG + Intergenic
1028726172 7:94090354-94090376 CTCCATCCACACAGGGCATTTGG - Intergenic
1028879230 7:95860754-95860776 CTGCACCCTCACATGGCAAAAGG + Intronic
1028879236 7:95860785-95860807 CTGTATCCTCACATGGCAGAAGG + Intronic
1028896448 7:96047107-96047129 TTGCATCCTCACATGGAAGAAGG + Intronic
1028916551 7:96265898-96265920 CTCCATCCTCACATGGCAGAAGG + Intronic
1029030271 7:97459701-97459723 AAGCATCCAATCATGGCAAAGGG + Intergenic
1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG + Intronic
1029847103 7:103423622-103423644 CTGTATCCTCACATGGCGGAAGG - Intronic
1029864943 7:103617972-103617994 CTGCTTCCACTCCTGGCAGAAGG - Intronic
1029970832 7:104787517-104787539 TTGCATCCTCACATAGCATAAGG + Intronic
1030171054 7:106603250-106603272 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1030203446 7:106929056-106929078 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1030306646 7:108025936-108025958 TTTCATTCACACATGGCCAATGG + Intronic
1030359314 7:108579074-108579096 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1030424539 7:109357486-109357508 CTGCATCCTCATATAGCAGAAGG - Intergenic
1030702333 7:112654919-112654941 CTGCTTCCACTCATGACAGAAGG + Intergenic
1031146123 7:117998980-117999002 CTTCATCTTCACATGGCAGAAGG + Intergenic
1031161919 7:118179057-118179079 CTGCATCCTCACATGGCAGAAGG - Intergenic
1031203447 7:118721863-118721885 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1031285650 7:119863894-119863916 CTGTAACCTCACATGGCAGAAGG - Intergenic
1031441966 7:121805611-121805633 CTGAATCCTTACATGGTAAAAGG - Intergenic
1031718089 7:125133735-125133757 CTTCATCCTCACATGGTCAAAGG - Intergenic
1031854493 7:126906160-126906182 CTGTGTCCTCACATGGCAGATGG - Intronic
1031874562 7:127123515-127123537 CTGCCTCCACTCATGGCTGAAGG - Intronic
1032158497 7:129490995-129491017 CTGCATCATCCCATGGCAGAAGG + Intergenic
1032892431 7:136212908-136212930 CTGCATCTTCACATGGCATAAGG + Intergenic
1033092783 7:138402504-138402526 CTGCATCCTTACATGGTAGAAGG - Intergenic
1033302283 7:140197159-140197181 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1033370117 7:140699557-140699579 CTGCAACCCCATATGGTAAAAGG - Intronic
1033594330 7:142845256-142845278 CTGCATCCTCACGTGGCAGAAGG - Intergenic
1033980219 7:147155221-147155243 CTGTGTCCTCACATGGCAGAAGG - Intronic
1034006571 7:147478695-147478717 CTTCATCCAGACATTGCACATGG + Intronic
1034716448 7:153247053-153247075 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1034750829 7:153567581-153567603 CTGCCTCCACTCATGGCGAAAGG + Intergenic
1034780269 7:153873073-153873095 CTGCTTCCACTCATGGTGAAAGG + Intergenic
1034783150 7:153900467-153900489 CTGTTTCCACTCATGGCAGAAGG + Intronic
1034949832 7:155289832-155289854 CTGCATCCTCACATGGTGAAGGG + Intergenic
1035088369 7:156281359-156281381 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1035143845 7:156792744-156792766 CTGCATCCGCCCATGGCCAGTGG + Intronic
1035505752 8:128222-128244 CTGTTTCCACTCATGGCAGAAGG - Intergenic
1035676305 8:1458781-1458803 CTGCATCCAGACATGAAAACAGG + Intergenic
1035785706 8:2259025-2259047 CTGCATCCTCCCATGGCGGAAGG + Intergenic
1035807101 8:2462691-2462713 CTGCATCCTCCCATGGCGGAAGG - Intergenic
1036023478 8:4875456-4875478 TTGCATCCAAACATGTAAAATGG - Intronic
1036119417 8:5999523-5999545 CTATGTCCTCACATGGCAAAAGG - Intergenic
1036161794 8:6395872-6395894 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1036180661 8:6581872-6581894 CTGCGTCCTCACATGGCAGAAGG + Intronic
1036542326 8:9729113-9729135 CTGTATCCTCACTTGGCAGAAGG + Intronic
1036550033 8:9807574-9807596 CTCTTTCCACACAAGGCAAATGG + Intergenic
1036616913 8:10395259-10395281 GTGCACACACACATTGCAAAGGG + Intronic
1036720587 8:11171644-11171666 CTGCTTCCACTCATGGCAGAAGG - Intronic
1036737831 8:11334059-11334081 CTGCCTCATCCCATGGCAAAAGG - Intergenic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1037152819 8:15657930-15657952 CTGCATCATCACATGGCATGAGG + Intronic
1037313733 8:17581715-17581737 CTGCTTCCACTCAGGGCAGAGGG - Intronic
1037386044 8:18343068-18343090 CTGCCACCACAGAAGGCAAAAGG + Intergenic
1037393749 8:18420686-18420708 CTGCTTCCACACATGGTGGAAGG - Intergenic
1037463923 8:19140416-19140438 CTGCATCATCTCATGGCAGAAGG - Intergenic
1037740647 8:21606342-21606364 CTGCATCCTTACATGGCAGAAGG - Intergenic
1037784767 8:21896067-21896089 CTGCATCCAGACATTGCAATGGG + Intergenic
1037844661 8:22272540-22272562 GTGCTTCCACTCATGGCAGAAGG - Intergenic
1037943199 8:22970244-22970266 CTGCATCCTCACGCGGCAGAAGG + Intronic
1038036215 8:23689060-23689082 CTGTGTCCTCACATGGCAAGAGG + Intergenic
1038074848 8:24060547-24060569 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1038145893 8:24895255-24895277 CTGTCTCTTCACATGGCAAAAGG - Intergenic
1038270893 8:26074899-26074921 CTGCTTCCACTCATGGCGGAAGG + Intergenic
1038277907 8:26137111-26137133 TTGCATCCTCACATGGTGAAAGG - Intergenic
1038340540 8:26681685-26681707 ATGCATCCTCACATGGTGAAGGG - Intergenic
1038394307 8:27235778-27235800 CTGCATCCTCACATGGCAGAAGG - Exonic
1038556631 8:28523979-28524001 GTGCATCAACCCATGGCAAAAGG - Intronic
1038677869 8:29639838-29639860 CTGCTTCCATTCATGGCAGAAGG - Intergenic
1038684562 8:29704520-29704542 ATGTGTCCTCACATGGCAAAAGG + Intergenic
1038738240 8:30192209-30192231 CTGTGCCCTCACATGGCAAAAGG + Intergenic
1038754454 8:30327703-30327725 CTGCATCATAACATGGCAGAAGG + Intergenic
1038841435 8:31188075-31188097 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1038995136 8:32914467-32914489 CTGCTTCCATTCATAGCAAAAGG + Intergenic
1039132306 8:34280066-34280088 CTGCGTCCTCACATAGCCAAAGG - Intergenic
1039377055 8:37045153-37045175 CTGTTTCCACTCATGGCAGAAGG + Intergenic
1039486047 8:37910621-37910643 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1039622068 8:39007117-39007139 CTGCTTCCATTCATGGCAGAAGG + Intronic
1039673767 8:39635094-39635116 CTGTATCCTCACATGGCAGAAGG - Intronic
1039691335 8:39867925-39867947 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1039830484 8:41209792-41209814 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1040124351 8:43720163-43720185 ATGAATCCACACATCACAAAAGG - Intergenic
1040327581 8:46361462-46361484 CTGAATCCACACATCACAATTGG + Intergenic
1040347585 8:46522495-46522517 CTGAATCCACACATCACAAAGGG - Intergenic
1040422917 8:47257513-47257535 CTGCATCTTCACATGGCAGAAGG - Intergenic
1040678449 8:49780649-49780671 CTGTGTACACATATGGCAAAAGG + Intergenic
1040904900 8:52457849-52457871 CTGCTTCTACTCATGGCAGAAGG - Intronic
1040946276 8:52888030-52888052 CTGCATCCTCATATGGCAGAGGG - Intergenic
1041162798 8:55062001-55062023 CTGCTTCCATTCATGGCAGAAGG - Intergenic
1041300462 8:56406276-56406298 CTTCATCCTGACATGGCATAAGG - Intergenic
1041420266 8:57660236-57660258 CTGTATCCTCACATTGTAAAAGG + Intergenic
1041422891 8:57689346-57689368 CTGCATCCTCACATGGCAGAAGG + Intergenic
1041711423 8:60898187-60898209 CTGGATCCACACCTGGCACCTGG - Intergenic
1042106712 8:65335315-65335337 CTCCATCTACACATGGGAAAAGG + Intergenic
1042169553 8:65978341-65978363 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1042405203 8:68396813-68396835 CTGCTTCCCCTCATGGCAGAAGG - Intronic
1042501850 8:69517133-69517155 CTGCATCATCCCATGGCAGAAGG + Intronic
1042653678 8:71070788-71070810 CTGCATCATCCCATGGCAGAAGG - Intergenic
1042929660 8:74000836-74000858 CTGCATCATCCCATGGCAGAAGG + Intronic
1042965366 8:74346058-74346080 CTGCATCTAAAGATCGCAAATGG - Intronic
1042990278 8:74631817-74631839 CTGCATCCTCACATGGCAGAAGG + Intronic
1043037955 8:75222125-75222147 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1043315393 8:78915254-78915276 CTGCATTCTCACCTGGCAGAAGG + Intergenic
1043322431 8:79006125-79006147 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1043360925 8:79471180-79471202 CAGCTTCCACTCATGGCAAAAGG + Intergenic
1043480321 8:80646021-80646043 CTGCATCATCACATGGCAGAAGG - Intronic
1043556860 8:81439979-81440001 CTGCATCCTCACTTGGTAGAAGG - Intergenic
1043587731 8:81788833-81788855 CTGCATCACAACATAGCAAAAGG + Intergenic
1043604016 8:81977356-81977378 CTGTGTCCTCACATGGCAGAGGG - Intergenic
1043624979 8:82244959-82244981 CTGCATCATCTCATGGCAGAAGG - Intergenic
1043649740 8:82576546-82576568 CTGCATCCTCACATGGTACGAGG + Intergenic
1043913199 8:85888680-85888702 CTGCATCATCACATGGTAGAAGG - Intergenic
1043963456 8:86445013-86445035 CTGCTTCCACTCATGGCACAAGG + Intronic
1044213433 8:89579108-89579130 CCGCATCCTCACAAGGCAGAAGG - Intergenic
1044459853 8:92430763-92430785 CTGCTTCCACTCATGGCAGACGG - Intergenic
1044806766 8:96016537-96016559 CTCCTTCCACTCATGGCAGAAGG + Intergenic
1044868759 8:96598117-96598139 CTGCATCCTCACATGGCAAAGGG + Intronic
1044886226 8:96781352-96781374 CTGCATCAAAACTTTGCAAAAGG + Intronic
1044895266 8:96885169-96885191 CTGCATCATCCCATGGCAGAAGG + Intronic
1045340144 8:101246468-101246490 CTGCTTCCACTCATGTCAAAAGG + Intergenic
1045341153 8:101255545-101255567 CTGCATCTTCACATGGCAAAAGG - Intergenic
1045404475 8:101852008-101852030 CTGCATCCTCACATGGTGGAAGG - Intronic
1045638970 8:104225693-104225715 CTACATCTACACATGGAAATTGG + Intronic
1045683144 8:104683850-104683872 CTGTGTCCTCACATGGCAGAAGG + Intronic
1046079430 8:109353341-109353363 CTGCATCCTCACATGGTGGAAGG + Intergenic
1046212423 8:111094700-111094722 CTGTGTCCTCACATGGCAAAAGG + Intergenic
1046262049 8:111781255-111781277 TTGCTTCTACTCATGGCAAAAGG - Intergenic
1046299734 8:112272049-112272071 CTGTGTCCTCACATGACAAAAGG - Intronic
1046396055 8:113641108-113641130 CTGCATGCTCACATAGCAGAAGG - Intergenic
1046512813 8:115220872-115220894 CTGTATCTTCTCATGGCAAAAGG + Intergenic
1046527870 8:115404435-115404457 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1046597669 8:116280431-116280453 CTGCATCCATCCATGGCCACAGG + Intergenic
1046616294 8:116481180-116481202 CTGTATCCTCACATGGTAGAAGG + Intergenic
1046805538 8:118475339-118475361 CTGCTTCCACTCATGGAGAATGG - Intronic
1047028562 8:120851215-120851237 CTGTATCCTCACATGGTAGAAGG - Intergenic
1047060178 8:121216586-121216608 CTGCATCAGAACATGGCAGAAGG + Intergenic
1047252866 8:123193772-123193794 CTGTGTCCTCACATGGCAGAAGG + Intronic
1047636923 8:126773929-126773951 CTGTATCCTCACATGGCAGAAGG + Intergenic
1048218560 8:132519311-132519333 CTGTATCCAAACTTGGCAGAAGG - Intergenic
1048251585 8:132870708-132870730 CTGCTTCCACTCATGGTACAAGG + Intronic
1048283048 8:133119532-133119554 CTGCATTCTCTCATGGCAAAGGG + Intronic
1048367479 8:133750913-133750935 CTGCATCCTCATGTGGCAGAAGG - Intergenic
1048549926 8:135424856-135424878 CTGCATTCTCACATGGCCAAAGG + Intergenic
1048733113 8:137466105-137466127 TTGCATCCAGACATGGCTTATGG - Intergenic
1048746239 8:137617382-137617404 CTGCTTCCTCACCTGGCAGAAGG - Intergenic
1048809293 8:138270648-138270670 CTGCATCATCCCATTGCAAAAGG + Intronic
1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG + Intergenic
1050225983 9:3456044-3456066 CTGTGTCCTCACATGGCAGAAGG + Intronic
1050402992 9:5276231-5276253 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1051508389 9:17849869-17849891 CTGTGTCCTCACATGGCACAAGG + Intergenic
1051657834 9:19399647-19399669 CTACATCTACACATTGCAATTGG + Intergenic
1051713432 9:19956877-19956899 CTGTGTCCTCACATGACAAAAGG - Intergenic
1051922881 9:22288307-22288329 CTGTATCATCACATGGCAGAAGG + Intergenic
1051964846 9:22815314-22815336 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1052024435 9:23558871-23558893 CTGTGTCCCCACATGGTAAAAGG - Intergenic
1052031607 9:23635680-23635702 CTGCAGCCACAGATATCAAAAGG + Intergenic
1052338911 9:27346135-27346157 CTGCATTCTCACATGGCAGAAGG - Intronic
1052365775 9:27610827-27610849 CCGAATCCGCACGTGGCAAACGG + Intergenic
1052648932 9:31274269-31274291 CTGCATCATCCCATGGCAGAAGG - Intergenic
1052850812 9:33377374-33377396 CAGCCTCCACACAGGGCTAAAGG + Intergenic
1052859159 9:33426320-33426342 CTGCATGCACTCATGACAACTGG - Intergenic
1053233010 9:36427555-36427577 CTGTGTCCTCACAAGGCAAAAGG - Intronic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1053263140 9:36689011-36689033 CTGCCCCCACACTTGGCAACAGG - Intergenic
1053375308 9:37601036-37601058 CTGTATCCTCACATGACAGAAGG + Intronic
1053449660 9:38182422-38182444 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1053449830 9:38184153-38184175 CTGCTTCCCCTCATGGCAGAAGG + Intergenic
1053595033 9:39551872-39551894 TTGCTTCCACACATGGCGGAAGG - Intergenic
1053604368 9:39641848-39641870 CTGCATTCTCACCTGGCAGAAGG + Intergenic
1053793209 9:41701444-41701466 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1053852815 9:42306900-42306922 TTGCTTCCACACATGGCGGAAGG - Intergenic
1053862187 9:42397889-42397911 CTGCATTCTCACCTGGCAGAAGG + Intergenic
1054151968 9:61613395-61613417 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054181618 9:61913456-61913478 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054249172 9:62700566-62700588 CTGCATTCTCACCTGGCAGAAGG - Intergenic
1054471740 9:65544525-65544547 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054563283 9:66735099-66735121 CTGCATTCTCACCTGGCAGAAGG - Intergenic
1054571221 9:66813101-66813123 TTGCTTCCACACATGGCGGAAGG + Intergenic
1055231251 9:74068618-74068640 ATGCATACACATATGGCATATGG + Intergenic
1055492072 9:76815455-76815477 CCGCATATTCACATGGCAAAAGG + Intronic
1055616876 9:78082203-78082225 CTGCATCTTCACATGGCAGAAGG - Intergenic
1055616886 9:78082249-78082271 CAGCATCCCCACATGGCAGAAGG - Intergenic
1055653397 9:78430296-78430318 TTGCATCCTCACCTGGTAAAAGG - Intergenic
1055685174 9:78765788-78765810 GTGCAAACTCACATGGCAAAGGG - Intergenic
1055753884 9:79536316-79536338 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1055798061 9:79997680-79997702 CTGCTTCCACTCATGGCAGACGG - Intergenic
1056004276 9:82250484-82250506 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1056099779 9:83290300-83290322 ATACAGCCACACATGGCTAATGG + Intronic
1056100283 9:83294196-83294218 CTGTGTCCTCACATGGCAGAAGG - Intronic
1056267669 9:84915517-84915539 TTGCTTCCACTCATGGGAAAGGG - Intronic
1056397930 9:86198356-86198378 AAGCTTCCACTCATGGCAAAAGG - Intergenic
1056535315 9:87522012-87522034 CTGCATCAAAACGTGGCAGAGGG - Intronic
1056542807 9:87588546-87588568 CAGCTTTCACAGATGGCAAATGG + Intronic
1056594751 9:87997787-87997809 CTTCATCCTCACATGGCAGAAGG - Intergenic
1056789325 9:89615507-89615529 CTGCATCCTCACATGGCAAGAGG - Intergenic
1057035106 9:91806317-91806339 CTGTGTCCTCACATGGCAGAAGG + Intronic
1057158664 9:92868618-92868640 CTGCTTCCATTCATGGCAGAAGG + Intronic
1057971964 9:99567179-99567201 CTGCTTCCACTCCTGGCAGAAGG - Intergenic
1057974391 9:99588881-99588903 CTGCATCCTCACATGGTGGAAGG - Intergenic
1057979214 9:99641888-99641910 CTACATCATCACATGGCAGAAGG + Intergenic
1058032233 9:100213040-100213062 CTGTATCCTCACATGACAGAAGG + Intronic
1058140666 9:101354293-101354315 CTGCATCCTCACATGGCAGAAGG + Intergenic
1059701498 9:116779314-116779336 CTGTGTCCTCACCTGGCAAAAGG - Intronic
1059820687 9:117969031-117969053 CTGCATCATCCCATGGCAGAAGG + Intergenic
1060032390 9:120226510-120226532 CTGCAGAGCCACATGGCAAAGGG - Intergenic
1060379068 9:123148283-123148305 ATGTATCCCCACATGGCAGAAGG - Intronic
1060572582 9:124656208-124656230 CTGCCTCCATTCATGGCACAAGG - Intronic
1061335691 9:129933493-129933515 CTGCATAGAAACAGGGCAAAGGG - Intronic
1061375162 9:130219816-130219838 CTGCTGCCACACAGGGCCAAGGG - Intronic
1061433453 9:130545632-130545654 CTGCATCCTCACACGGTAGAAGG - Intergenic
1061458688 9:130718345-130718367 CTACATCAAAACATGGTAAATGG - Intronic
1203602556 Un_KI270748v1:29156-29178 CTGTTTCCACTCATGGCAGAAGG + Intergenic
1203612678 Un_KI270749v1:23711-23733 CTGCATCTTCACATGGCATAAGG - Intergenic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186143320 X:6600319-6600341 CTGTATCCTCACATGGCCAAGGG + Intergenic
1186562017 X:10622586-10622608 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186610225 X:11131584-11131606 CTGAGTCCTCACATGGCAGAAGG + Intergenic
1186651976 X:11570981-11571003 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186690110 X:11966338-11966360 CTGCATTCTCACATGGAAGAAGG - Intergenic
1186690886 X:11974393-11974415 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1186709466 X:12178146-12178168 CTGTATCCTCAAATGGCAGAAGG - Intronic
1186730312 X:12402788-12402810 CTGTGTCCTCACATGGCATAAGG - Intronic
1186768617 X:12795557-12795579 CTGCATCATCCCATGGCAGAAGG + Intronic
1186845991 X:13531857-13531879 CTGCTTCCGCTCATGGCAGAAGG + Intergenic
1186963463 X:14762130-14762152 CTGCATCCTCACATGGTGGAAGG + Intergenic
1187034122 X:15519735-15519757 CTGCTTCCACTCATGGCAGAAGG + Intronic
1187316712 X:18202522-18202544 CTGTGTCCTCACATGGCAGAAGG - Intronic
1187440508 X:19313758-19313780 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1187532048 X:20105982-20106004 TTGCATCAAAACATGGCAAAAGG + Intronic
1187563350 X:20423379-20423401 CTGCATCCTCACATGGTGAAAGG - Intergenic
1187614589 X:20979661-20979683 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1187618175 X:21020910-21020932 CTGGACCCACCCAGGGCAAAAGG + Intergenic
1187802784 X:23082660-23082682 CTGCATGCTCACATGGCAAAAGG + Intergenic
1187817586 X:23249609-23249631 CTGCTTCCACTCATAGCAGAAGG + Intergenic
1188293511 X:28417564-28417586 CTGCATCCTCACATGGCAGAAGG + Intergenic
1188295349 X:28440758-28440780 CTGCTTCCACACATGGTGGAAGG - Intergenic
1188475363 X:30586329-30586351 CTACTTCCACTCAAGGCAAAGGG + Intergenic
1188558807 X:31444125-31444147 CTGCTTCCACTCATGGCAGAAGG - Intronic
1188844272 X:35054059-35054081 CTGCTTCCACTTATGGCAGAAGG - Intergenic
1188884080 X:35528454-35528476 CTGCGTCCTCACATGGCAGAAGG - Intergenic
1188911194 X:35849550-35849572 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1188936736 X:36185211-36185233 CTGCATCCTCCCATGGCAGAAGG + Intergenic
1188989320 X:36798560-36798582 CTGTGTCCTCATATGGCAAAAGG - Intergenic
1189025561 X:37390136-37390158 CTGTGTCCTCACATGGCAAAAGG + Intronic
1189127200 X:38461249-38461271 CTGCTTCCATTCATGGCAGAAGG + Intronic
1189178469 X:38981222-38981244 CTGTGTCCACACATGTCAGAAGG - Intergenic
1189255165 X:39632381-39632403 CTGCATCTTCACATGGCAGAAGG + Intergenic
1189302533 X:39962593-39962615 CTGCATCTTCACATGGCAGAAGG + Intergenic
1189486515 X:41437031-41437053 CTGCATCCTTGCATGGCAGAAGG + Intergenic
1189569759 X:42283940-42283962 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1189601692 X:42633530-42633552 CTGCGTCCTCACATGGCCAAAGG - Intergenic
1189668682 X:43384637-43384659 CTGTGTCCTCACATGGCACAAGG - Intergenic
1189740147 X:44109446-44109468 CTGCATCCTCACATGGTGGAAGG + Intergenic
1189858739 X:45250840-45250862 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1189916161 X:45857742-45857764 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1190056324 X:47183111-47183133 CCGCATCATAACATGGCAAAGGG + Intronic
1190135633 X:47794915-47794937 CTGCATCATAACATGGCAGAAGG - Intergenic
1190211782 X:48454565-48454587 CTGCATTCTCATATGGCAGAAGG - Intergenic
1191141500 X:57120692-57120714 CTACATCCAGACATGGCTATAGG - Intronic
1191143145 X:57136660-57136682 CTACATCCAGACATGGCTATAGG - Exonic
1191263406 X:58354931-58354953 CTGAATGCACACATCACAAACGG - Intergenic
1191711918 X:64158849-64158871 CTGCTTCCACTTATGGCAGATGG - Intergenic
1191734574 X:64375662-64375684 CTGCCTCCTCACATGGCAGAAGG - Intronic
1191944430 X:66516181-66516203 CTGCTCCCATTCATGGCAAAAGG - Intergenic
1192137392 X:68616578-68616600 CTGCTTCCACTCATGTCAGAAGG + Intergenic
1192249393 X:69398819-69398841 CTGCATCCTCACACAGCAAAAGG + Intergenic
1192399704 X:70822745-70822767 CTGCTTCCACTCATGGTAGAAGG + Intronic
1192409513 X:70920516-70920538 CTGCTTCCACTCTTGGCAGAAGG - Intergenic
1192412347 X:70945124-70945146 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1192731178 X:73803971-73803993 CTCTTTCCACACAAGGCAAATGG - Intergenic
1192816559 X:74599610-74599632 CTTTAACCTCACATGGCAAAAGG - Intronic
1192819867 X:74633713-74633735 CTGCATCATCCCATGGCAGAAGG - Intergenic
1192935933 X:75858576-75858598 CTCTACCCACACAAGGCAAATGG - Intergenic
1193046251 X:77057990-77058012 CTGCTTCCAATCATGGCAGAAGG - Intergenic
1193394934 X:80972182-80972204 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1193577567 X:83220777-83220799 CTGCATCCTCACATGGCCAAAGG + Intergenic
1193698095 X:84734320-84734342 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1193740696 X:85214236-85214258 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1193903418 X:87212763-87212785 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1193987315 X:88259773-88259795 TTGCATCTTCACATGGCAGAAGG + Intergenic
1194047374 X:89024845-89024867 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1194146091 X:90265691-90265713 CTGCATCCTTACGTGGCAAAAGG - Intergenic
1194227547 X:91279762-91279784 CTGCAGGCACACAGGGCAGATGG - Intergenic
1194344334 X:92744600-92744622 CTGAGTCCTCACATGACAAAAGG + Intergenic
1194465337 X:94228315-94228337 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1194740262 X:97564167-97564189 TTGTGTCCTCACATGGCAAAAGG - Intronic
1194749277 X:97666289-97666311 CTGTTTCCACTCATGGCAGAAGG - Intergenic
1194818002 X:98469022-98469044 CTTCATCCTCACATGGCAGAAGG + Intergenic
1194846192 X:98812151-98812173 CTATATCCTCACATGGCAAAAGG - Intergenic
1195050662 X:101093873-101093895 CTGTGTCCTCACATGGCAGAAGG + Intronic
1195214356 X:102683748-102683770 CTGCTTCTACTCATGGCAGATGG + Intergenic
1195430324 X:104781985-104782007 CTGTATCCTCACATGGCAGAAGG - Intronic
1195549877 X:106156161-106156183 CTGCATCTTCACATGGCAGAAGG + Intergenic
1196081000 X:111630872-111630894 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1196274728 X:113753642-113753664 CTGCATCATAACATGGCAGAAGG - Intergenic
1196285861 X:113879578-113879600 CTGCATCATCACATAGCAGAAGG + Intergenic
1196470425 X:116018019-116018041 CTGCATCCTCAAATAGCAGAGGG + Intergenic
1196781928 X:119391464-119391486 CTGCACCACCCCATGGCAAAAGG - Intergenic
1196902854 X:120402985-120403007 CTGCATCCTCACATGGCAGGAGG + Intergenic
1196972807 X:121127998-121128020 CTGTATCCTCACATAGCAGAAGG + Intergenic
1197610933 X:128637431-128637453 CTGTGTCCTCACATGGCGAAAGG + Intergenic
1197831653 X:130649149-130649171 CTGCTTCCACTCATGGCAGAAGG - Intronic
1197883065 X:131189641-131189663 CTGCATACTAACATGGCAGAAGG - Intergenic
1198164478 X:134041048-134041070 CTGCATCCTCACATGCAGAAGGG - Intergenic
1198263084 X:134983878-134983900 CTGTTTCCTCACATGGCAAAAGG - Intergenic
1198299480 X:135321090-135321112 CTGCATCCTCACATGGTATAAGG + Intronic
1198300798 X:135332470-135332492 GTGCTTCCTCACATGGCAGAAGG - Intronic
1198422747 X:136483981-136484003 GTCCATCCACACATGCCTAATGG - Intergenic
1198546442 X:137697449-137697471 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1198984334 X:142431895-142431917 CTGCTTCCACTCATGGTAGAAGG - Intergenic
1199117789 X:144012887-144012909 TTGCATCCTCACATGGCTGAAGG - Intergenic
1199234977 X:145481226-145481248 CTGTGTCCCCACATGGCAGAAGG + Intergenic
1199296437 X:146164184-146164206 CTGCATCTTCACATGTAAAATGG + Intergenic
1199425000 X:147691177-147691199 CCACATCCTCACATGGTAAAAGG + Intergenic
1199497754 X:148472024-148472046 CTGCATCTTCACATGGCAGAAGG - Intergenic
1199733424 X:150660756-150660778 CTGCTTCCACTCATGGCAGAAGG + Intronic
1199736064 X:150687766-150687788 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1199778215 X:151034214-151034236 CTGCATTCTCACATGGCAGAAGG - Intergenic
1199884099 X:152001923-152001945 CTGCATCCTTACATGGTAGAAGG - Intergenic
1200338396 X:155376111-155376133 CTGCTTCCACTCATGGCATAAGG + Intergenic
1200348073 X:155464581-155464603 CTGCTTCCACTCATGGCATAAGG - Intergenic
1200491835 Y:3834971-3834993 CTGTATCCTTACGTGGCAAAAGG - Intergenic
1200652681 Y:5861241-5861263 CTGAGTCCTCACATGACAAAAGG + Intergenic
1200873157 Y:8124891-8124913 CTAAATCAACAGATGGCAAAGGG - Intergenic
1201148396 Y:11079937-11079959 CTGCATCATGACACGGCAAAGGG + Intergenic
1201257960 Y:12128343-12128365 CTCAACCCACACATGGCAGAAGG - Intergenic
1201351649 Y:13050031-13050053 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1201511153 Y:14764698-14764720 CTGTGTCCCCACATGGGAAAAGG + Intronic
1201512514 Y:14780649-14780671 CTGTGTCCTCACATGGTAAAAGG - Intronic
1201597146 Y:15682957-15682979 CTGCATCCTCACATGGTGGAAGG - Intergenic
1201676102 Y:16586110-16586132 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1202384642 Y:24314254-24314276 CTGTTTCCACTCATGGCAGAAGG + Intergenic
1202486142 Y:25355868-25355890 CTGTTTCCACTCATGGCAGAAGG - Intergenic