ID: 1095271461

View in Genome Browser
Species Human (GRCh38)
Location 12:40224618-40224640
Sequence CGCCTCCGCTGCGGGGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095271455_1095271461 -2 Left 1095271455 12:40224597-40224619 CCGGCCGGGCTGCGCACTGCGCG 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG 0: 1
1: 0
2: 2
3: 27
4: 236
1095271446_1095271461 25 Left 1095271446 12:40224570-40224592 CCCCGGCTGGCGGGTCGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 182
Right 1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG 0: 1
1: 0
2: 2
3: 27
4: 236
1095271450_1095271461 23 Left 1095271450 12:40224572-40224594 CCGGCTGGCGGGTCGCGGAGGGT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG 0: 1
1: 0
2: 2
3: 27
4: 236
1095271448_1095271461 24 Left 1095271448 12:40224571-40224593 CCCGGCTGGCGGGTCGCGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 211
Right 1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG 0: 1
1: 0
2: 2
3: 27
4: 236
1095271456_1095271461 -6 Left 1095271456 12:40224601-40224623 CCGGGCTGCGCACTGCGCGCCTC 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG 0: 1
1: 0
2: 2
3: 27
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095271461 Original CRISPR CGCCTCCGCTGCGGGGCTCC GGG Intronic
900113524 1:1019553-1019575 CGCCTCCGCGCCGCAGCTCCCGG + Intergenic
900237501 1:1599813-1599835 GGCTTCCGCTGCCAGGCTCCGGG - Exonic
900375693 1:2353652-2353674 CGTTTCCTCTGCAGGGCTCCTGG + Intronic
900510049 1:3054538-3054560 CCCTCCTGCTGCGGGGCTCCCGG - Intergenic
900548397 1:3241423-3241445 TGCCACAGCTGCTGGGCTCCCGG - Intronic
902215511 1:14932110-14932132 TGGCTCCTCTGCGGGGCTCAAGG - Intronic
902733557 1:18385435-18385457 CACCTCCCCGGCTGGGCTCCAGG - Intergenic
902765530 1:18612267-18612289 CGGCTCCGCTGGGTTGCTCCTGG + Intergenic
902837329 1:19055274-19055296 CGGCAGCGCTGAGGGGCTCCTGG - Intergenic
903287597 1:22286539-22286561 CACCTCCCCTGGGGGGCCCCAGG + Intergenic
903413678 1:23167765-23167787 CGCGGCCGCTGCGGGTCGCCAGG + Intronic
904252955 1:29237756-29237778 CGCCGGGGCTGCGGGGCGCCCGG + Intronic
904744470 1:32702630-32702652 CCCCGCCGCGCCGGGGCTCCGGG + Exonic
904827042 1:33280521-33280543 CAGCCCCGCTGCTGGGCTCCTGG - Intronic
905569329 1:38991438-38991460 CGCCGCCGCTTCGGGGAGCCGGG - Exonic
905734702 1:40317087-40317109 CCCCTCCGCTGCCAGGGTCCAGG - Intronic
907409393 1:54273914-54273936 CGCCCCAACTGCTGGGCTCCAGG - Intronic
911078910 1:93909176-93909198 CCCCTTCGCTGCGCGGCCCCTGG - Exonic
911527542 1:99004754-99004776 CGCCTCCGCCGCCGCGCCCCCGG - Exonic
914171925 1:145233325-145233347 GGCCCCGGCTGCTGGGCTCCTGG - Intergenic
914796592 1:150925211-150925233 CGCCTCAGCTGCGGAGTTGCTGG + Intergenic
915953612 1:160205863-160205885 CGCCTCCGCTGGCGGTCTCCCGG + Intronic
916208134 1:162335268-162335290 CCCCTCAGCTGCATGGCTCCAGG - Intronic
916528177 1:165631142-165631164 CGCCCCCAAGGCGGGGCTCCTGG - Exonic
919403268 1:197146486-197146508 CGGCTCCGGAGCGGGGATCCGGG + Exonic
920002147 1:202807673-202807695 CGCCTCCGCTCCCGGGGTGCGGG - Intronic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922766464 1:228158901-228158923 CGCCTGCTCTGGGGGGCCCCCGG - Exonic
923141479 1:231163782-231163804 CGCCTCCGCTGGGGGCGCCCTGG - Exonic
923626008 1:235614610-235614632 AGCCTCAGCTGCAGGGCCCCAGG - Intronic
1062890490 10:1056516-1056538 CGCCCCGGCTGCCGGGCTACGGG + Intronic
1063663887 10:8050657-8050679 CGCCGGGGCTCCGGGGCTCCGGG + Intergenic
1063676029 10:8141256-8141278 GGCCTCCGCTGGTGGGGTCCCGG + Intergenic
1064028736 10:11869788-11869810 GGTCTCCACTGCGGGGCCCCCGG - Exonic
1064208801 10:13347311-13347333 CGCCTCCGACGCGGGCGTCCTGG - Intronic
1065636720 10:27742515-27742537 CCCCTCCCCGGCGGGGCGCCCGG + Intronic
1067048661 10:42999912-42999934 TGCTTCACCTGCGGGGCTCCTGG + Intergenic
1068669565 10:59709700-59709722 CGCCGCCGCTGCGGGTCTGTGGG - Exonic
1069531465 10:69222647-69222669 AGCCTCTGCTGATGGGCTCCAGG + Intronic
1070792084 10:79195557-79195579 TGCCTCCGCCTCCGGGCTCCTGG - Intronic
1073088711 10:100913393-100913415 CGCCTCCGCGCAGGGGCTACTGG + Intronic
1073457880 10:103648490-103648512 CGGCTGGGCTGCGGGGTTCCAGG - Intronic
1074016653 10:109541824-109541846 CCCCTCCGCTGCAGGTCTGCTGG + Intergenic
1074648418 10:115490986-115491008 CCCCTCTGCTGCAGGTCTCCTGG + Intronic
1076329147 10:129652287-129652309 CGTCTCCGCTCGGGGGCTGCTGG - Intronic
1076395678 10:130136205-130136227 GCACTCCGCTGCGGGCCTCCTGG - Intergenic
1076604022 10:131677808-131677830 CCCCTCAGCTCCGAGGCTCCGGG + Intergenic
1078771803 11:14358722-14358744 CGCCGCCGCTCCGGCGCCCCGGG + Intronic
1080601866 11:33828967-33828989 CCGCCCCGCTGCGGGGCTCCAGG - Intergenic
1081636757 11:44726968-44726990 CGCCGGCGTCGCGGGGCTCCAGG + Intronic
1081873388 11:46393037-46393059 AGCCAGCGCTGCGGGGCTCTTGG + Intergenic
1082029369 11:47593748-47593770 CGCCTTGGCTCCGGGGCTCTGGG - Intronic
1083227471 11:61294253-61294275 CGCCCCCGCTGCGCGCCCCCCGG + Intronic
1083424700 11:62577196-62577218 ACCCTCCGCTGCTGGGCTCAGGG - Exonic
1084014815 11:66371955-66371977 CCCCTCCGCCGCAGGGATCCGGG - Intronic
1084053538 11:66616598-66616620 CGCCTGCGCGGCGGGGTTCTCGG + Exonic
1084165584 11:67373422-67373444 CGGCCCCGGCGCGGGGCTCCCGG + Intronic
1084669366 11:70596208-70596230 CGCCTGCTCTGTGGGGCACCTGG + Intronic
1089253074 11:117179064-117179086 CCCCTCCCCTGCGGGGACCCTGG + Exonic
1089729467 11:120511534-120511556 CGCCCCCGCGCCTGGGCTCCCGG + Intergenic
1090402458 11:126457985-126458007 CACCCCTGCTGCTGGGCTCCTGG + Intronic
1091235794 11:134021220-134021242 GGCATCCCCTGCGTGGCTCCAGG - Intergenic
1091320636 11:134646884-134646906 AGCCTCCTCTCCTGGGCTCCAGG + Intergenic
1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG + Intronic
1095476178 12:42589502-42589524 CGGCGCCGCTGCGGGGCTGCTGG + Exonic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097264096 12:57736137-57736159 CGCCGCAGCTGCGGCGCCCCGGG - Intronic
1103572527 12:121854628-121854650 GGAGTCAGCTGCGGGGCTCCTGG + Intronic
1103698648 12:122835946-122835968 CGCCTCAGCTCCGGCGCTCCCGG - Intronic
1104568131 12:129903410-129903432 CGGCCCCGCTGCGGGCCTCTAGG - Exonic
1104902336 12:132196326-132196348 GGCCACCGCTGCGGGGCTCTCGG - Intergenic
1105344497 13:19560738-19560760 CGCCTTCCCTGCTGGGCCCCTGG - Intergenic
1105535535 13:21260837-21260859 CGCCTTCCCTGCTGGGCCCCTGG + Intergenic
1107604025 13:42040805-42040827 CGCCGCTGCGCCGGGGCTCCTGG - Intronic
1108555268 13:51584986-51585008 CGCCTCCGCTGTGTGGCTCCGGG + Intronic
1113953181 13:114083466-114083488 CGCCATTGCTGCTGGGCTCCAGG - Intronic
1115903963 14:38186481-38186503 AGCCTCTGCTGGGTGGCTCCTGG + Intergenic
1116743968 14:48793355-48793377 CCCCTCTGCTGCAGGTCTCCTGG - Intergenic
1118930206 14:70234313-70234335 GGCGTCCGCTCCGGAGCTCCAGG - Intergenic
1119227997 14:72958723-72958745 CGTCGCGGCTGGGGGGCTCCCGG + Exonic
1119410242 14:74425933-74425955 CGCCTCCTCCGCGGGGCTCGGGG + Exonic
1120881341 14:89417152-89417174 CGCCTCCGCCGCGGCGCGTCGGG + Intronic
1122232357 14:100313092-100313114 GGCCCCCGCAGTGGGGCTCCCGG + Intergenic
1122304264 14:100751750-100751772 CGGCTCCGCTGATGGGGTCCTGG + Intergenic
1122588527 14:102827934-102827956 AGCCCCTGCTGAGGGGCTCCTGG - Intronic
1123216366 14:106812905-106812927 CGCCTAGGGTGCGGGGTTCCTGG + Intergenic
1125181795 15:36887399-36887421 CTCTTCCGCGGCGGGGCTCGAGG - Intergenic
1130520549 15:84658038-84658060 TGGCTCGGCTGCGGGGCTCCGGG + Exonic
1132519461 16:380840-380862 CGCATCAGCTGCCGGGCACCTGG + Intronic
1132677455 16:1126605-1126627 CCCCTCCCCTTCAGGGCTCCGGG + Intergenic
1132735734 16:1384945-1384967 CGCCTGCTCTGCCTGGCTCCTGG + Intronic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133181241 16:4056334-4056356 AACCTCCGCTCCCGGGCTCCAGG + Intronic
1133774243 16:8885165-8885187 AGCCTCCGCTCCGGGGCTGCAGG + Intergenic
1136061555 16:27730068-27730090 CGCCTTCACTGCAGGGCCCCTGG - Intronic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1137530335 16:49275389-49275411 CTCCTCGCCTGCGCGGCTCCCGG + Intergenic
1137559102 16:49491903-49491925 AGCCTCTGCTGCTGGGCTCCGGG + Intronic
1137731430 16:50693459-50693481 AGCCGGCGCTGCGGGGCTGCGGG + Intergenic
1139570087 16:67806366-67806388 AGACTCCGCTGCCGCGCTCCTGG - Exonic
1139750495 16:69106624-69106646 GGACGCCGGTGCGGGGCTCCAGG + Intronic
1139958307 16:70703789-70703811 CGCCCCCTCTGCTGGGCTCCGGG - Intronic
1141165974 16:81661370-81661392 GGCATCCGCTGCCGGGCACCCGG + Intronic
1141418894 16:83899090-83899112 CGCCGCCGCTGCCGCGCTTCCGG - Intergenic
1142120164 16:88383166-88383188 CGCCTCCGCTGCAGAGCGCTGGG + Intergenic
1142434462 16:90047742-90047764 CGACTCCGCTTCTGGGCCCCAGG - Intergenic
1142627859 17:1203617-1203639 CGCCGCCGCTGCGAGGAGCCCGG + Intronic
1142982359 17:3679582-3679604 GGCCTCACCTGTGGGGCTCCAGG + Exonic
1147741644 17:42673802-42673824 CCCCTCCTCCGCGGGGCTCCCGG + Exonic
1148397733 17:47323819-47323841 CGCCACCGCCCAGGGGCTCCGGG - Intronic
1149461500 17:56833559-56833581 CTCCTCCGCTGCGGAGCGGCGGG - Intronic
1150003194 17:61454768-61454790 GGGCTCCGCTGCACGGCTCCGGG + Intronic
1152191535 17:78891265-78891287 CTCCTCCTCTGCTGGGCTCCTGG + Exonic
1152471837 17:80493815-80493837 CGCCTCCTCTCTGGGCCTCCAGG - Intergenic
1153794484 18:8609734-8609756 CGCCTCTGCAGCGCGGCGCCCGG - Exonic
1154026099 18:10708570-10708592 GGCCACCGCAGCGGGGCTCAGGG + Intronic
1157557352 18:48621573-48621595 CGACTCCCCTCCTGGGCTCCAGG - Intronic
1160960609 19:1719051-1719073 CGCCGCCGCAGCGGGGCTGGGGG + Intergenic
1161531393 19:4792121-4792143 CGCCTCCGCAGCCGGCCACCTGG + Exonic
1161719679 19:5895920-5895942 CAGCTCCCCTGCAGGGCTCCAGG + Intronic
1164617168 19:29674178-29674200 CGCCTCCGCTACGGAGCGCCAGG + Exonic
1166317943 19:41999056-41999078 GGGCTCCGCTGGGGGGCCCCGGG + Exonic
1166666337 19:44682665-44682687 CACCCCGGCTTCGGGGCTCCTGG - Intronic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167091721 19:47349042-47349064 CGCCTCAGCTCCGGGACGCCGGG - Intergenic
1167434948 19:49474090-49474112 AGCCCCCGCTGCGGGGCGTCCGG + Intronic
1168293821 19:55369511-55369533 CGCCCACCCGGCGGGGCTCCTGG - Intronic
1168641367 19:58033985-58034007 AGTCACCGCTGCGGGACTCCCGG - Intergenic
925064798 2:921603-921625 CCCCTCTGCTGTGGGGCTCATGG + Intergenic
925133779 2:1512534-1512556 CTCCGCCCCTGCTGGGCTCCTGG + Intronic
926880373 2:17538897-17538919 GCACTGCGCTGCGGGGCTCCCGG - Intergenic
927684564 2:25161503-25161525 CACCATCGCTGCGGGGCTCGGGG + Exonic
928402887 2:30992082-30992104 CTCCTCCACTCCCGGGCTCCTGG - Intronic
928964874 2:36966491-36966513 TGCCTCCGCTGCTGGGCGCCGGG - Intergenic
931663844 2:64595903-64595925 TGGCACTGCTGCGGGGCTCCTGG - Intergenic
933094562 2:78162071-78162093 CGCCTCTGCTGCAGGTCTGCTGG + Intergenic
934791497 2:97066168-97066190 TGCCTCTACTGCGTGGCTCCTGG - Intergenic
934814941 2:97316375-97316397 TGCCTCTACTGCGCGGCTCCTGG + Intergenic
934822754 2:97392108-97392130 TGCCTCTACTGCGCGGCTCCTGG - Intergenic
935196637 2:100820230-100820252 CGCCGCGGCTGCGGGTCTCCGGG - Exonic
935593680 2:104863607-104863629 GTCCTCCGCTCCAGGGCTCCAGG - Intergenic
937277647 2:120695592-120695614 CTACTCCGCTGGGGGGCTCGGGG + Intergenic
937325919 2:120989526-120989548 GGGCTCCGCTGCGGGGCTGCAGG - Exonic
937511614 2:122601739-122601761 CTCCTCCCCTGGAGGGCTCCAGG - Intergenic
939640743 2:144637926-144637948 CCCCTCTGCTGCAGGTCTCCTGG + Intergenic
939687046 2:145213079-145213101 CCCCTCTGCTGCAGGTCTCCTGG + Intergenic
942027209 2:171922343-171922365 CGCTTCCGCCGCCGGGCTCCTGG + Intronic
942046557 2:172102439-172102461 CGCCGCCGCTCGGGGGCTGCTGG + Exonic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
945467142 2:210182199-210182221 CCCCTCTGCTGCAGGTCTCCTGG - Intergenic
946161029 2:217836157-217836179 CGCCTCCGCAGAGGGGCTGGGGG + Exonic
947742522 2:232491124-232491146 GGCCTCCGCTGCTGGACACCTGG + Intergenic
947744228 2:232499427-232499449 GGCTTCCGCTGGGGGCCTCCTGG + Intergenic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948808134 2:240461718-240461740 CGCCTGCCCTGCGAGTCTCCAGG - Intronic
948916318 2:241036445-241036467 CGCCTCCCCTCCAGGGTTCCTGG - Intronic
948945484 2:241217176-241217198 CGGCTACGCTGGGGAGCTCCGGG - Intronic
949014697 2:241702499-241702521 GGCGCCCGCTGCGGGGCTCCGGG + Intronic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1173548412 20:43915927-43915949 CGCCTCGGGTTCGGGGTTCCAGG - Intronic
1173672907 20:44810403-44810425 AGGCTCCGCTGCGGGGCTGGCGG + Intergenic
1173820112 20:46014110-46014132 CTCCTCCCCTGCAGGGCGCCAGG + Exonic
1174047118 20:47741373-47741395 GGGCACCGCTGCGGGGCTCCGGG - Intronic
1174436392 20:50510190-50510212 CTCCTCCGCTTTGGGGCTCTGGG - Intergenic
1175777651 20:61663310-61663332 GGCCTGTGCTGCGGAGCTCCTGG + Intronic
1176185169 20:63774488-63774510 CACCTCCGCGGCTGGGGTCCAGG - Intronic
1176293883 21:5060321-5060343 CTCCCGTGCTGCGGGGCTCCTGG + Intergenic
1176377343 21:6093072-6093094 CCCCTCCTGTGCGGGGCTCTGGG + Intergenic
1179746131 21:43445172-43445194 CCCCTCCTGTGCGGGGCTCTGGG - Intergenic
1179863376 21:44203327-44203349 CTCCCGTGCTGCGGGGCTCCTGG - Intergenic
1180054653 21:45351615-45351637 CCGCTCCGCTGAGGGCCTCCTGG + Intergenic
1181541987 22:23578526-23578548 CGCCTCCATGGCCGGGCTCCTGG + Intronic
1182882630 22:33746830-33746852 CTCCTCCTCTCCTGGGCTCCAGG - Intronic
1183063035 22:35347116-35347138 CCCCTCAGCTGAGGGGCCCCCGG + Exonic
1185318644 22:50190204-50190226 CGCCTCTGCTGAGAGGCTGCAGG + Intronic
1185409443 22:50674447-50674469 CGCCGCCCCTGCGGAGCCCCCGG + Intergenic
949580505 3:5383537-5383559 CCCCTCTGCTGCAGGTCTCCTGG + Intergenic
953027563 3:39153689-39153711 CGCCTCCGGGGCGGGGCTGCCGG - Intronic
953697038 3:45167742-45167764 CACCGGCGCTGCAGGGCTCCCGG - Intergenic
954656040 3:52194858-52194880 GGACTCCTCTTCGGGGCTCCAGG + Intergenic
956406429 3:68932703-68932725 CGCCCCCACTGCCGGCCTCCAGG + Intergenic
960937537 3:122912900-122912922 GGCCCCCGTTGCGGGGCTCCGGG + Exonic
961464095 3:127071050-127071072 AGCCTCAGCTGCAGTGCTCCAGG + Intergenic
963061691 3:141231698-141231720 CGCCTCCGGGGCGGAGCTCCAGG + Intronic
964749174 3:160038947-160038969 CTCTGTCGCTGCGGGGCTCCAGG + Intergenic
965590583 3:170357471-170357493 CGCCGCCACTTCGCGGCTCCCGG - Intergenic
968133631 3:196207469-196207491 CGTGTCCGCCGCGGGCCTCCTGG - Exonic
968518009 4:1022945-1022967 CGCCTGCTCCGCTGGGCTCCTGG + Intronic
968611288 4:1558276-1558298 CCCCTCCGCAGTGTGGCTCCGGG - Intergenic
968917902 4:3505234-3505256 CGCAGCCGCTGCGGGACACCAGG - Intergenic
969295844 4:6270274-6270296 CCCGCCCGCGGCGGGGCTCCAGG - Intronic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970290299 4:14564216-14564238 CGCCTTCCCTGCTGGCCTCCAGG + Intergenic
973774899 4:54233554-54233576 AGCCTCCGCTCCGGGCCCCCGGG - Intronic
975812261 4:78181785-78181807 CGCCAACGCTGCGGGGCAGCGGG + Intronic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
985963260 5:3319850-3319872 CGCCCCCACTGTGGGCCTCCAGG + Intergenic
992052799 5:72956348-72956370 CGGCCCCGCTGCGGGCCCCCGGG - Intronic
992431522 5:76715703-76715725 CGCCAGGGCTGCGGGGCTGCAGG + Intergenic
995048378 5:107673548-107673570 CGCCTGCTCTGCGGGGCCACAGG + Intergenic
997171704 5:131728937-131728959 CCCCTCCGCTGCAGGTCTGCTGG + Intronic
999733468 5:154493595-154493617 CTCCTCCGCAGCCGGGTTCCCGG + Intergenic
1002176605 5:177404453-177404475 CCCCTCCGCCCCAGGGCTCCGGG - Intronic
1002185981 5:177455000-177455022 GGGCTCCGCTGCGTGGCCCCGGG - Exonic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007275226 6:40668436-40668458 AGCTTCAGCCGCGGGGCTCCAGG - Intergenic
1007902514 6:45423775-45423797 CGCCCCCGCTTCGGGGCTTGCGG - Intronic
1010378530 6:75202335-75202357 CGCCCGCTCTTCGGGGCTCCTGG + Intronic
1011517133 6:88166593-88166615 CTCCTCCGCCGCCGCGCTCCCGG + Intergenic
1013220649 6:108074617-108074639 CACCTCCGCTGCGCGGCTGTCGG + Exonic
1013242635 6:108260634-108260656 CGCCTCTGCAAGGGGGCTCCCGG + Intronic
1013273483 6:108561947-108561969 AGCCTCCGCTGCGAGGCTTTGGG + Intronic
1014802218 6:125790501-125790523 AGCCTCCGCTGCCGCGATCCCGG - Intronic
1014802345 6:125790974-125790996 GGCCTCTGCTGCTGGGCGCCGGG - Exonic
1016241968 6:141940983-141941005 CCCCTCCGCTGCAGGTCTGCTGG - Intergenic
1017028562 6:150201547-150201569 GGCTTCCCCTGCTGGGCTCCCGG - Intronic
1019029250 6:168995931-168995953 GGCCTCCGGAGCGGGGCTCTCGG - Intergenic
1019184388 6:170212648-170212670 AGCGTCCTCTGCTGGGCTCCAGG + Intergenic
1019354391 7:571218-571240 GGCCTGCGCTGCGAGGCTCCTGG - Intronic
1019645164 7:2125027-2125049 CCCCTTCCCTGCTGGGCTCCCGG + Intronic
1019696836 7:2450935-2450957 TGCCACCCCTGCGGGGGTCCAGG - Intergenic
1020640006 7:10742808-10742830 CCCCTCTGCTGCAGGTCTCCTGG - Intergenic
1024578420 7:50782771-50782793 CGGCTCCGCGGAGGGGCCCCCGG - Intronic
1026806710 7:73433727-73433749 AGCCCCCGGGGCGGGGCTCCGGG - Intergenic
1029367925 7:100128023-100128045 CGGCTCCGCTCCTGGGCTGCGGG - Exonic
1029422259 7:100477720-100477742 CGCCGAAGCTGTGGGGCTCCAGG + Exonic
1029438078 7:100573629-100573651 GGCGTCCGCTCCGGCGCTCCAGG + Intronic
1029927012 7:104328809-104328831 CGCCGCCGCCGCGATGCTCCCGG + Exonic
1030331652 7:108277990-108278012 CCCCTCCGCTGCAGGTCTGCTGG + Intronic
1032391277 7:131556701-131556723 CGCCGCCGCTGGCGGGCTCCTGG - Intronic
1033354071 7:140585467-140585489 CACCTGCCCTGCCGGGCTCCTGG - Intronic
1033477213 7:141702262-141702284 CGCCTCCGCGGCGGGGCCCCGGG - Intergenic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034441157 7:151086690-151086712 CGCCTCCGCCGCGCCGCCCCGGG + Intronic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1035367506 7:158358553-158358575 CCCCTCAGCTGCTGGGCGCCTGG - Intronic
1042837892 8:73093450-73093472 GGCCTCCCCCGCCGGGCTCCTGG - Intronic
1049599355 8:143499897-143499919 CGGCACTGCTGCGGGCCTCCTGG - Intronic
1049709195 8:144056089-144056111 CGGGTCCACTGCGGGGCCCCTGG - Intronic
1049788394 8:144462216-144462238 AGCCCCCGCCGCGGGGCCCCAGG - Intronic
1049997521 9:1046369-1046391 CACCTGGGCTGCGTGGCTCCGGG + Intergenic
1053014108 9:34652138-34652160 CACCCCCGCTGCGGGGGCCCAGG + Intronic
1055611934 9:78032115-78032137 CGCCTCGCCCGCGCGGCTCCCGG + Intergenic
1056757385 9:89390354-89390376 AGCCACGGCTGCGGGGCTGCGGG + Intronic
1057234281 9:93346355-93346377 CGCCTCCCCTCCGTGGCTCTAGG - Exonic
1060375451 9:123112320-123112342 CGCCTGCCCCGCGGGGCTGCTGG + Intronic
1061202018 9:129143496-129143518 CGCCTCTGCTGATGGGATCCAGG - Intronic
1061543372 9:131290093-131290115 TGCCCGAGCTGCGGGGCTCCGGG - Exonic
1061570881 9:131476805-131476827 CGGCCCCTCGGCGGGGCTCCAGG - Intronic
1061884985 9:133586893-133586915 CGCCTACGCTGGGGGGTCCCAGG - Intergenic
1062033449 9:134372305-134372327 GGCCTCAGCTGAGGGCCTCCTGG + Intronic
1062236927 9:135514823-135514845 GCCCTCCCCTGCTGGGCTCCAGG - Intergenic
1062467331 9:136687055-136687077 CCGCCCCGCTCCGGGGCTCCGGG - Intronic
1062560479 9:137139413-137139435 CGCATCCCCCGCGGGGCTTCCGG - Intronic
1186181211 X:6975466-6975488 CCCCTCTGCTGCAGGTCTCCTGG + Intergenic
1187915727 X:24150365-24150387 CGCCGCCGCGCCGGGCCTCCGGG - Intronic
1189323186 X:40098188-40098210 CGCCTCCGCGGCGGGGTTTCGGG + Intronic
1190187069 X:48244493-48244515 CGCCTCAGCTTCGGGACTACAGG + Intronic
1190308599 X:49101213-49101235 CGCCTCCGCCCCTGCGCTCCGGG - Intergenic
1193949431 X:87779301-87779323 CGCCTCTGCTGCAGGTCTGCTGG - Intergenic
1196435699 X:115672471-115672493 CCCCTCTGCTGCAGGTCTCCTGG - Intergenic
1197098238 X:122621101-122621123 CCCCTCTGCTGCAGGTCTCCTGG + Intergenic
1200094268 X:153649936-153649958 CGCCTGCCCTCCGGGTCTCCCGG + Intronic
1200216541 X:154370583-154370605 CGCCTCCGCGGCTGTGCTCGCGG - Intronic
1201892395 Y:18956873-18956895 CCCCTCTGCTGCAGGGCTGCTGG - Intergenic