ID: 1095275567

View in Genome Browser
Species Human (GRCh38)
Location 12:40278662-40278684
Sequence ATGGCTATGCAGGCTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095275558_1095275567 9 Left 1095275558 12:40278630-40278652 CCTAGAAAGTTCTCCCCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG 0: 1
1: 0
2: 5
3: 22
4: 280
1095275562_1095275567 -5 Left 1095275562 12:40278644-40278666 CCCTGAGGGCTACCACACATGGC 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG 0: 1
1: 0
2: 5
3: 22
4: 280
1095275560_1095275567 -4 Left 1095275560 12:40278643-40278665 CCCCTGAGGGCTACCACACATGG 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG 0: 1
1: 0
2: 5
3: 22
4: 280
1095275556_1095275567 29 Left 1095275556 12:40278610-40278632 CCATGGTTTTAGTTTCTTTGCCT 0: 1
1: 1
2: 0
3: 40
4: 617
Right 1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG 0: 1
1: 0
2: 5
3: 22
4: 280
1095275563_1095275567 -6 Left 1095275563 12:40278645-40278667 CCTGAGGGCTACCACACATGGCT 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG 0: 1
1: 0
2: 5
3: 22
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095275567 Original CRISPR ATGGCTATGCAGGCTGTGGA TGG Intronic
901574656 1:10191251-10191273 ATGGTTCTGCAGGCTGTACAAGG + Intergenic
904619803 1:31768417-31768439 CAGGCTATGCAGGGTCTGGAAGG - Intergenic
904830362 1:33302538-33302560 ATGGCAAAGCAGGCTATGGGAGG - Intergenic
906647211 1:47483786-47483808 ATGACCAAGCAGGCTGAGGATGG + Intergenic
906652438 1:47522208-47522230 AGGGCTACTCAGGCTGAGGATGG - Intergenic
906752190 1:48274811-48274833 TTGGCTATGCAGGCTCTTTATGG + Intergenic
908562043 1:65316234-65316256 ATGGAGGTGCAGGCTGGGGAGGG - Intronic
909535135 1:76727733-76727755 ATGAGTGTGGAGGCTGTGGAGGG - Intergenic
910975089 1:92898150-92898172 ATGGTTCTGCAGGCTGTACAAGG + Intronic
911231297 1:95364333-95364355 TATGCTATGCATGCTGTGGAGGG + Intergenic
911661882 1:100510576-100510598 ATGACTATGCAGGCTGTAGAAGG - Intronic
912694568 1:111831497-111831519 ATGGTTCTGCAGGCTGTCCAGGG - Intronic
915084416 1:153375336-153375358 ATGGCTAAGCAGGCCGGGTACGG - Intronic
917514952 1:175699548-175699570 AGGGCTAAGCAGGCTAAGGAGGG + Intronic
917748309 1:178032005-178032027 ATGGTTGTGCAGGGTGTGAATGG - Intergenic
920543107 1:206794046-206794068 ATGGCTCTTCAGGTGGTGGATGG + Intergenic
922214716 1:223510853-223510875 ATGGTTCTGCAGGCTGTACAGGG - Intergenic
923519256 1:234723259-234723281 AAGGCCATGCTGGCTGTGGACGG - Intergenic
923739279 1:236640851-236640873 ATGGCAATGAAGGCTGAAGATGG + Intergenic
1065416395 10:25492001-25492023 ATGGTTCTGCAGGCTGTACAAGG + Intronic
1066229392 10:33417597-33417619 ATGCCGAGGCTGGCTGTGGACGG - Intergenic
1066436861 10:35403662-35403684 ATGGTGATGCAGGATATGGAAGG + Intronic
1067571776 10:47377000-47377022 ATGGCCAGGCAGGCTGCTGAAGG - Intronic
1067659604 10:48224436-48224458 ATGCCTATGCATGCTGGGGTGGG + Intronic
1069667437 10:70172258-70172280 ATGGCTTGGGAGGCTGGGGAAGG + Intergenic
1069728528 10:70596563-70596585 ACGGCTGTGCAGGCTGTGCAGGG - Intergenic
1069778970 10:70943067-70943089 AGGGCTCTGCAGTTTGTGGAAGG + Intergenic
1070557395 10:77539177-77539199 ATGGCCTTGCAGGCTCTTGAGGG - Intronic
1072742490 10:97917786-97917808 ATGGCCTTGCAGGCTGTGCATGG + Intronic
1073134832 10:101214810-101214832 ATGGCTATCCGGGCTCCGGATGG + Intergenic
1074800118 10:116991372-116991394 ATGGCTCTGCAGGCTCTACAAGG + Intronic
1076706479 10:132304813-132304835 AGGCCCTTGCAGGCTGTGGACGG - Intronic
1077166945 11:1146578-1146600 ATGGCTCTGCAGGTAGAGGACGG - Intergenic
1077359947 11:2136463-2136485 GTGGCCCTGCAGCCTGTGGAGGG - Intronic
1079151015 11:17899120-17899142 ATGGTTCTGCAGGCTGTACAGGG - Intronic
1079767056 11:24406951-24406973 ATCGCTGTGCTGGCTGTGGCTGG - Intergenic
1081447662 11:43146036-43146058 ATGGCCAGGAAGGCTGTGCATGG + Intergenic
1084931788 11:72561885-72561907 ATGCCTATGTGGGCTGTGGGAGG + Intergenic
1087168716 11:95028753-95028775 ATGGTTCTGCAGGCTGTGCAGGG - Intergenic
1088408228 11:109504421-109504443 ATGGCTTTGGAGGTTGGGGAAGG + Intergenic
1088832188 11:113546929-113546951 ATGGCTATGTATGCTGGGGCTGG - Intergenic
1089733778 11:120535560-120535582 CTGGCTAGGCAGGGTGTGTAGGG + Intronic
1090592978 11:128291953-128291975 ATGGCTATGCACTCTGAGGTTGG - Intergenic
1090826488 11:130390724-130390746 GTGGATATGCAGGCAGGGGAAGG + Intergenic
1090868893 11:130725690-130725712 AGGGCCTTGCAGGTTGTGGAAGG + Intergenic
1090961291 11:131559437-131559459 ATGGATATGAAGGATGTGAATGG - Intronic
1091069584 11:132550537-132550559 ATGGTTCTGCAGGCTGTGCAGGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1093319491 12:17695914-17695936 TTAGCTTGGCAGGCTGTGGATGG + Intergenic
1093907428 12:24709666-24709688 AAGGCTTTGTAGGCTATGGAAGG - Intergenic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1096680822 12:53254087-53254109 ATGGCTCTGCTGGCAGTGGTGGG + Exonic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1098185197 12:67889405-67889427 ATGCCTATGGAGGCTGAGGCAGG - Intergenic
1098949248 12:76622692-76622714 ATGGATAGGCAGGCTGTCAAGGG - Intergenic
1099008975 12:77268634-77268656 ATGGTTCTGCAGGCTGTACAGGG - Intergenic
1101294214 12:103403918-103403940 AGAGCTATGCAAGTTGTGGATGG + Intronic
1101841639 12:108331750-108331772 CTGGCTTTGAAGGCTGGGGAAGG + Intronic
1103328225 12:120135742-120135764 GTGGGTGTGCAGGCTGTGGCAGG + Intronic
1104816518 12:131649169-131649191 CTGGCTATGCAGACAGTGGTCGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105997462 13:25686143-25686165 AGGGCCATGCAGGCTTGGGAGGG + Intronic
1106790520 13:33151276-33151298 ATGGCTCTGCAGGCTGTACAAGG + Intronic
1106907727 13:34426052-34426074 ATGGCTCTGCAGCATGTGGCTGG - Intergenic
1108639686 13:52371384-52371406 ATGGCTATATAGGCTGAGTAGGG - Intergenic
1108681097 13:52781064-52781086 ATGCAGATGCAGGCTGGGGAAGG + Intergenic
1108984831 13:56573362-56573384 ATGGTTCTGCAGGCTGTTAAAGG - Intergenic
1110441684 13:75533274-75533296 ATGGATATTCAGGCTGGGCACGG + Intronic
1110553230 13:76830078-76830100 AGAGCTTTCCAGGCTGTGGAGGG - Intergenic
1111804368 13:93021097-93021119 ATGGTTCTGCAGGCTGTACAGGG + Intergenic
1112530017 13:100191946-100191968 AAGGCTATGAAGGCTCTGGTTGG + Intronic
1113303218 13:109045766-109045788 AGGGCTGTGCAGACTGTGGAAGG - Intronic
1114777037 14:25496095-25496117 ATGGTTCTGCAGGCTGTACAGGG + Intergenic
1116539935 14:46089548-46089570 ATGGTTCTGCAGGCTGTTCAAGG + Intergenic
1117778673 14:59208988-59209010 ATGGTTCTGCAGGCTGTACATGG - Intronic
1118682224 14:68254346-68254368 ATGGATCTGCTGACTGTGGAGGG - Intronic
1123408487 15:20039282-20039304 ATGGCCCTGCAGGCTGGGCATGG + Intergenic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1128057483 15:64711206-64711228 ATGGGTTTGTAGGCTGTGGTAGG - Intergenic
1128686127 15:69687078-69687100 ATGGCTATGTAGGCTATTGCAGG - Intergenic
1129337845 15:74864401-74864423 AAGGTTATGGAGGCTGTGGAGGG + Intronic
1129476176 15:75785891-75785913 ACGGCTATGTGGGCAGTGGAAGG + Intergenic
1131474267 15:92723018-92723040 TTGGCTATGCAGGCTGTTTTTGG + Intronic
1131489510 15:92850331-92850353 ATGCCTGTGCAGGCTGTGGAAGG - Intergenic
1132090862 15:98947044-98947066 ATGGCTGGGCTGGTTGTGGAAGG + Intronic
1133453328 16:5921694-5921716 ATGGTTCTGCAGGCTGTACAGGG + Intergenic
1133588011 16:7214472-7214494 ATGGAGATGGAGGCAGTGGATGG - Intronic
1133945781 16:10347081-10347103 AAGACTATGCAGGCTGGGCACGG + Intronic
1134241880 16:12512630-12512652 ATGGATACGCAGGCGGTTGATGG + Intronic
1135642310 16:24131371-24131393 ATCACTAAGGAGGCTGTGGAGGG + Intronic
1137673918 16:50294496-50294518 ATCCCTATGGAGGCTGAGGAAGG + Intronic
1138222949 16:55268599-55268621 ATGGCTTTGCAATATGTGGAGGG - Intergenic
1138300877 16:55928977-55928999 ATGGTCCTGCAGGCTGTGGCTGG - Intronic
1138670122 16:58607436-58607458 ATGGCTATCTAGGCTGGGCAAGG + Intronic
1139504704 16:67393110-67393132 ATGGGTCTGCAGGCCATGGATGG + Intronic
1140282340 16:73566176-73566198 ATGGCTATGAAGGCACTGGTGGG - Intergenic
1140892725 16:79298792-79298814 AGGGCCTTGCAGGCTTTGGAGGG + Intergenic
1141157746 16:81609191-81609213 AAGGCTTTGCTGGCTGTGGTGGG - Intronic
1141868822 16:86770271-86770293 ATGGTAATGCAGGCTGGGGCGGG + Intergenic
1142224493 16:88870983-88871005 CTGGGTCTGCAGGCTGTGCAGGG - Intergenic
1144564577 17:16349454-16349476 ATGGCACTGCTGGCTGTGGAGGG - Intronic
1144599306 17:16598702-16598724 ATGGCTCTGCAGGCTTTCCAAGG - Intergenic
1144730148 17:17521352-17521374 CTGGGGATGCAGGCTGTGCAGGG - Intronic
1145253546 17:21310345-21310367 ATGGTTATGGAGTCTTTGGAAGG - Intronic
1145323031 17:21777616-21777638 ATGGTTATGGAGTCTTTGGAAGG + Intergenic
1146510957 17:33448219-33448241 TTGGCTAATCAGGCTGTGGCTGG + Intronic
1146527039 17:33575886-33575908 ATGGCTCTGCAGGCTTAGAAAGG + Intronic
1146960656 17:36973778-36973800 ATAGCCAAGCAGGCTGGGGACGG + Intronic
1147605537 17:41771981-41772003 ATGAGGATGCAGGCTGGGGATGG + Intronic
1147836748 17:43338306-43338328 ATGGATAACCAGGCTGTGGAGGG + Intergenic
1148046493 17:44748125-44748147 TTGGCTCTGCAGCCTGTGGTTGG - Intronic
1148116625 17:45179153-45179175 ATGGCTATACAGGCCGGGCATGG + Intergenic
1150924709 17:69520770-69520792 ATGGCTATTCAGGCTCAGGAGGG + Intronic
1151183993 17:72350123-72350145 ATGGCCGTGCAGGCTGTGATGGG - Intergenic
1151419135 17:73985848-73985870 CTAGCTATGCAGGCTGAGGACGG - Intergenic
1153262256 18:3236000-3236022 ATGGCTGAGCAGACTGGGGAGGG + Intergenic
1155836045 18:30585535-30585557 ATGGTTCTGCAGGCTGTACAGGG + Intergenic
1155961119 18:31995743-31995765 AAGGCTATGCAGCTTGTGGGTGG - Intergenic
1156731195 18:40195156-40195178 ATGGTTCTGCAGGCTTTAGATGG - Intergenic
1157792004 18:50541192-50541214 GGGGCTGTGCTGGCTGTGGAAGG - Intergenic
1158487668 18:57882013-57882035 ACAGCTATGCAGGCAGTGAAGGG - Intergenic
1162273851 19:9637713-9637735 ATGGTGATGTAGGATGTGGAAGG + Intronic
1164779751 19:30882873-30882895 ATGGCCCTGCAGGGTGTGAATGG - Intergenic
1165098208 19:33421899-33421921 ATGGCGATGGTGGCTGGGGATGG + Intronic
1165601479 19:37058526-37058548 AGGGCTACCTAGGCTGTGGAGGG + Intronic
1166800253 19:45452314-45452336 ATTGCAATGAATGCTGTGGAGGG - Intronic
1167717585 19:51154002-51154024 AGAGCTATGCAGGCTGGGGCAGG - Intergenic
1167725934 19:51212486-51212508 ATGGCCATGGGGGCTGAGGATGG - Intergenic
1167955660 19:53061814-53061836 ATGGCCATTCAGCCAGTGGATGG + Intergenic
1168267880 19:55232118-55232140 TTGGCTGTGCAGCCCGTGGAGGG - Exonic
1168673684 19:58260705-58260727 ATCCGTATGCAGGCTGTGAAAGG - Intronic
925559581 2:5175737-5175759 ATGGCTTTGCATGCTGGGGTTGG - Intergenic
925904945 2:8534816-8534838 CGGGATCTGCAGGCTGTGGAAGG + Intergenic
926359963 2:12077717-12077739 ATGGCTATACATGGTGAGGATGG + Intergenic
926831226 2:16964417-16964439 ATGGTTCTGCAGGCTGTACAGGG - Intergenic
926987861 2:18643667-18643689 GAGTCTATGCAGTCTGTGGATGG - Intergenic
927511564 2:23647264-23647286 ATATTTATGGAGGCTGTGGAAGG - Intronic
927623108 2:24682939-24682961 TTGGTTTTGCAGGCTTTGGATGG + Exonic
927640439 2:24842204-24842226 ATGGCAGAGCAGGCTGTGGAGGG - Intronic
929383888 2:41382492-41382514 ATGGTGATGCAGGATATGGAAGG - Intergenic
932110487 2:68994752-68994774 AAGTCTATTCAGGCTGTGGGAGG + Intergenic
932323413 2:70838316-70838338 ATGGAAATGCAGGCTGAGGTAGG + Intergenic
934557392 2:95294675-95294697 AAGGTTAAGGAGGCTGTGGAAGG - Intergenic
934727210 2:96630833-96630855 ATAGATTTGCAGGCTATGGAGGG - Intronic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
936530215 2:113271167-113271189 CTAGCTATGCTGCCTGTGGATGG + Intronic
937988487 2:127649403-127649425 CTGGCTGTGCAGGGTGGGGATGG + Intronic
939014766 2:136889777-136889799 ATGACTATGCAGGCTGTGCAGGG - Intronic
941508141 2:166373425-166373447 ATTGATATGGAGGCTGTGGCAGG + Intronic
942695899 2:178644986-178645008 ATGGCTATGAGGGTTGTAGAGGG + Intronic
944848700 2:203695051-203695073 ATGGGTATGCATTCTGTGCAGGG + Intergenic
945532024 2:210967473-210967495 GTGGTCATGCAGGCTATGGAGGG + Intergenic
947537004 2:230946208-230946230 AGGGCTAGGGAGGGTGTGGAAGG + Intronic
948426931 2:237894453-237894475 AGGGCGAGGCTGGCTGTGGAAGG + Intronic
1168982643 20:2021116-2021138 AGGACTTTGGAGGCTGTGGAAGG - Intergenic
1171166265 20:22974692-22974714 CTGGCTCTTCAGGCTGGGGAAGG + Intergenic
1171954656 20:31451702-31451724 ATGGTTCTGCAGGCTGTACAAGG - Intergenic
1172519084 20:35555848-35555870 AGGAGTTTGCAGGCTGTGGAAGG + Intronic
1179577721 21:42318214-42318236 GTGGGAATGCAGGCTCTGGAAGG - Intergenic
1179901195 21:44395690-44395712 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901207 21:44395729-44395751 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901220 21:44395768-44395790 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901232 21:44395807-44395829 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901245 21:44395846-44395868 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901263 21:44395904-44395926 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901281 21:44395962-44395984 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901302 21:44396030-44396052 AGGGCTGTGGAGGCTGTGGAGGG + Intronic
1179901314 21:44396069-44396091 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901332 21:44396127-44396149 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901338 21:44396146-44396168 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901344 21:44396165-44396187 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901350 21:44396184-44396206 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901356 21:44396203-44396225 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901386 21:44396292-44396314 AGGGCTGTGGAGGCTGTGGAGGG + Intronic
1179901430 21:44396430-44396452 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901444 21:44396469-44396491 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901453 21:44396507-44396529 AAGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901459 21:44396526-44396548 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901470 21:44396564-44396586 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901481 21:44396603-44396625 AGGGTTGTGGAGGCTGTGGAGGG + Intronic
1179901498 21:44396652-44396674 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901515 21:44396701-44396723 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901539 21:44396770-44396792 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901556 21:44396819-44396841 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901599 21:44396938-44396960 AGGGCTGTGGAGGCTGTGGAGGG + Intronic
1179945699 21:44672949-44672971 ATGGTTCTGCAGGCTGTACAAGG - Intronic
1180105882 21:45617764-45617786 ATGGCATTGCAGGCTGTGGAAGG - Intergenic
1182260294 22:29069237-29069259 AAGGCTATGCAGGGTGTCTACGG - Intergenic
1182288848 22:29263969-29263991 CTGGCCATGCTGGCTGGGGAGGG - Exonic
1183333590 22:37234334-37234356 CTGGCTACCCACGCTGTGGAAGG + Intronic
1183368814 22:37420882-37420904 ATGGCTTTGCTGGCTCCGGAGGG + Intronic
1185127277 22:49018133-49018155 AAGGCTATCCAGGGGGTGGAGGG - Intergenic
950614244 3:14146582-14146604 ATGGCTAGGGAGGGTTTGGATGG + Intronic
950727143 3:14923821-14923843 AAGGCTATGGGGGCTGGGGAGGG - Intronic
953968001 3:47325011-47325033 ATGGCTCTGGAGTCTGTGGCAGG - Intronic
954131830 3:48564859-48564881 TTGTCTATGGTGGCTGTGGAGGG - Exonic
954205625 3:49056989-49057011 GTGGCTGTGCAGGCTGTGGCAGG - Exonic
954324884 3:49858135-49858157 CTGCCTATCCAGGCTGTGGTAGG + Exonic
954808583 3:53234355-53234377 TTGGCTGAGGAGGCTGTGGAGGG - Intronic
955104341 3:55882329-55882351 ATGGTTCTGCAGGCTGTACAAGG - Intronic
955157189 3:56428228-56428250 ATGGCCCTGCAGGCTGGGGGCGG + Intronic
955521782 3:59782408-59782430 ATGGATGTAGAGGCTGTGGATGG - Intronic
958631441 3:96688359-96688381 ATGTCTATGCCAGCTATGGATGG - Intergenic
958955747 3:100464435-100464457 ATGGCTTTGCTGGCTGGGCATGG - Intergenic
959366123 3:105459896-105459918 ATGGGACAGCAGGCTGTGGAAGG + Intronic
961192356 3:124972532-124972554 ATGGGGATGCAGACTTTGGATGG - Intronic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
962119645 3:132548314-132548336 ATGTGTAAGCAGGCTGTGAAAGG + Intergenic
962349462 3:134646107-134646129 ATGGCCATGCAGGGCATGGAAGG - Intronic
962391028 3:134973025-134973047 ACACCTATCCAGGCTGTGGAGGG - Intronic
963292198 3:143503473-143503495 GTGGCGAAGCAGGCTTTGGAGGG - Intronic
963320084 3:143801844-143801866 ATGGTGGTGCAGGATGTGGAAGG - Intronic
963638920 3:147835314-147835336 ATGGCTATGCACCTTGGGGATGG + Intergenic
967764769 3:193267118-193267140 ATGGCTATACTGGGTGGGGAAGG - Intronic
969496551 4:7529630-7529652 ATGGCTCAGCAGGGTGGGGAAGG + Intronic
969718769 4:8881531-8881553 CTGGCGATGCAGGATTTGGAGGG - Intergenic
970687075 4:18580636-18580658 TTGGCTATTCAGGCTGAAGAAGG + Intergenic
973744633 4:53951064-53951086 ATGGACGTGCAGGCTGGGGACGG + Intronic
976739615 4:88344914-88344936 ATGGTGATGCAGGATATGGAAGG + Intergenic
976922689 4:90457874-90457896 ATGGGTCTGCAGGCTGTGGATGG - Intronic
977067811 4:92341481-92341503 ATTGCAATGTAGGCTGTGGATGG - Intronic
978557912 4:110000451-110000473 ATAGTTATGCAGGCTATGGGGGG - Intronic
978764902 4:112394195-112394217 CTGGCTAGGCAGGCTGTTGTAGG + Intronic
980275048 4:130640022-130640044 ATGGCCAGGCAGGTTGTGGGGGG - Intergenic
980714740 4:136614819-136614841 ATGGTGATGTAGGATGTGGAAGG - Intergenic
982302459 4:153893632-153893654 ATGGCTATGCACTCTGGTGAAGG - Intergenic
982936402 4:161482673-161482695 ATGGTTATGCAGCCTGAGAAAGG - Intronic
983010526 4:162540126-162540148 ATGGTTCTGCAGGCTGTACAGGG + Intergenic
983794383 4:171842511-171842533 ATGGTTCTGCAGGCTGTACAGGG + Intronic
985506003 5:280637-280659 AGGGCACTGTAGGCTGTGGATGG + Intronic
985506021 5:280713-280735 AGGGCACTGTAGGCTGTGGATGG + Intronic
987367087 5:17158504-17158526 CTGGCTAGGAAGGATGTGGAGGG - Intronic
987543310 5:19283052-19283074 ATGGTTCTGCAGGCTGTACAGGG + Intergenic
989332741 5:40278812-40278834 ATGCCTATCCAGGCTGAGGGAGG + Intergenic
990232365 5:53727393-53727415 ATGGGTAGGCTGGCTGGGGAAGG - Intergenic
991022116 5:61990277-61990299 AGGACTGTGGAGGCTGTGGAAGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
994073919 5:95630168-95630190 ATGGTTCTGCAGGCTGTACAGGG + Intergenic
995039144 5:107568430-107568452 ATGCCTAGGCAGGTAGTGGAGGG + Intronic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
997195162 5:131974322-131974344 ATGGCTCTTCAGGCTGCAGATGG - Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997499970 5:134365875-134365897 TTGGCTTTGAAGGATGTGGAGGG - Intronic
999320981 5:150614923-150614945 ATGGCAAAGCAGGATGTGAATGG - Intronic
1000830395 5:166094709-166094731 ATGGTTCTGCAGGCTGTACAGGG + Intergenic
1003371954 6:5537279-5537301 ATGTCTGTGCTGTCTGTGGAAGG - Intronic
1005311570 6:24564158-24564180 CTGGCCATGCAGGCTCTGGCTGG - Intronic
1008794585 6:55287266-55287288 AGGGCAAGGCACGCTGTGGAGGG - Intergenic
1009576599 6:65470890-65470912 ATGGCTTGGGAGGCTGAGGAGGG + Intronic
1011266216 6:85522191-85522213 ATGGCTCTGCAGAATGGGGAAGG - Intronic
1012344287 6:98168054-98168076 ATGGATATTAAGGGTGTGGAAGG + Intergenic
1013287556 6:108694031-108694053 ATGGCAAGGCAGGCAATGGAAGG - Intergenic
1014145582 6:117994472-117994494 AGGTCTATGAAAGCTGTGGAAGG - Intronic
1014568685 6:122982496-122982518 ATGGTTCTGCAGGCTGTACATGG - Intergenic
1015760713 6:136657287-136657309 ATGGCTATGCAGGCGCTTTATGG + Intronic
1018153512 6:160963213-160963235 ATGTCTAGGCAGGCAATGGATGG - Intergenic
1018511381 6:164527828-164527850 ATGGCAATGGACACTGTGGATGG - Intergenic
1018710329 6:166494149-166494171 CTGGCTTTGCAGGGTATGGAGGG + Intronic
1019362728 7:613859-613881 AGGTCTCTGCAGGCTGGGGAGGG - Intronic
1019694056 7:2434795-2434817 ATGGCTATTAAGGCTGGGCACGG + Intergenic
1020080883 7:5285073-5285095 CTGGCTCTGCAGGCTGAAGAAGG + Intronic
1020413770 7:7922619-7922641 ATTGCTATGCAGATTGTTGATGG + Intronic
1020541198 7:9462441-9462463 ATTGCTTGGCAGGCTGGGGAGGG + Intergenic
1023372614 7:39527254-39527276 ATGGTTCTGCAGGCTGTCCAAGG + Intergenic
1023799794 7:43824026-43824048 ATGGCCAAGCAGGCAGTGGGTGG + Intergenic
1024391498 7:48818243-48818265 ATGCCTACCCAGGCTGAGGAAGG + Intergenic
1025198034 7:56947099-56947121 CTGGCTCTGCAGGCTGAAGAAGG - Intergenic
1025673915 7:63629838-63629860 CTGGCTCTGCAGGCTGAAGAAGG + Intergenic
1025769953 7:64495187-64495209 CTGGCTCCGCAGGCTGAGGAGGG + Intergenic
1027479117 7:78672386-78672408 ATGGCTCTGCAGACTGTATAGGG - Intronic
1031657781 7:124379798-124379820 ATGGCTGTGCTGCCTGTGGCTGG - Intergenic
1034418200 7:150976171-150976193 AGGGCTATGCTTGCTGGGGAGGG - Intronic
1035966636 8:4199282-4199304 ATTGATATGCAGGCAGTGTATGG + Intronic
1036553002 8:9831648-9831670 ATGGTTCTGCAGGCTGTGCAAGG - Intergenic
1037651626 8:20844306-20844328 ATGGTTCTGCAGGCTGTACAAGG + Intergenic
1038398069 8:27261717-27261739 ATGGCTATCCTAGCTGTGAAGGG + Intergenic
1039167519 8:34701303-34701325 ATGGTTCTGCAGGCTGTACAAGG - Intergenic
1039189793 8:34960359-34960381 ATGGCTATACAGACTGTGCAAGG + Intergenic
1039248159 8:35632417-35632439 ATGGTTATGGAGGCTGAGGAAGG + Intronic
1040648320 8:49423918-49423940 ATGGCGGTGCAGGATATGGAAGG - Intergenic
1041926916 8:63246891-63246913 TTGGCTATGCAGGCTGTTTTTGG + Intergenic
1042893962 8:73645686-73645708 ATGGTTCTGCAGGCTGTACAGGG + Intronic
1047335647 8:123933271-123933293 ATGGCTTTGAAGGATGAGGAGGG - Intronic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1048483255 8:134821957-134821979 ATGGAAATGCATGCTGTTGAGGG + Intergenic
1059178865 9:112193020-112193042 ATTGCTAGGGAGGCTGGGGAAGG - Intergenic
1059949365 9:119445641-119445663 ATGGCTGTGCTGGCTGGGCATGG - Intergenic
1061082527 9:128380470-128380492 ATGGCCATGCAGCCTTGGGAGGG + Intronic
1186297244 X:8163369-8163391 ATGTCTATTCAGGCTGGGCACGG - Intergenic
1186770083 X:12809742-12809764 ATGGCTATGCAGGACGGTGAGGG - Intronic
1188629996 X:32343928-32343950 GTGGCTATGCAAGCCTTGGAAGG - Intronic
1190634658 X:52421799-52421821 ATGGCTACCCAAGCTGTTGAGGG + Intergenic
1191867828 X:65719816-65719838 ATGGCTGTGGAGGATGAGGAAGG + Intronic
1192100886 X:68263258-68263280 CTGGCTTTGCAGGATGTGGGAGG - Intronic
1192487042 X:71536713-71536735 ATGGTTATGTATGCTGTGGCAGG + Intronic
1192764180 X:74125642-74125664 ATGGTGATGTAGGATGTGGAAGG + Intergenic
1194090875 X:89581069-89581091 ATAGCTATGCAGGGTGTCCATGG - Intergenic
1195342749 X:103920887-103920909 ATGGCCATGAAGGCAGTGGCTGG + Intronic
1195364040 X:104110669-104110691 ATGGCCATGAAGGCAGTGGCTGG - Intronic
1196117240 X:112011072-112011094 ATGTCTGAGCAGGCTGTGTAGGG + Intronic
1199035838 X:143050377-143050399 CTGGCTGTGCTGGCTTTGGATGG + Intergenic
1199305672 X:146264900-146264922 ATGGCTATGAAGGCAGAGGAAGG + Intergenic
1200291783 X:154882274-154882296 ATGGTTCTGCAGGCTGTACAAGG - Intronic
1200338621 X:155378011-155378033 ATGGTTCTGCAGGCTGTACAAGG - Intergenic
1200347848 X:155462681-155462703 ATGGTTCTGCAGGCTGTACAAGG + Intergenic
1200443525 Y:3237132-3237154 ATAGCTATGCAGGGTGTCCATGG - Intergenic
1200887277 Y:8282011-8282033 ATGGCTACCCAGGTTCTGGAAGG + Intergenic
1201233969 Y:11892446-11892468 ATGGTGGTGCAGGATGTGGAAGG + Intergenic