ID: 1095279075

View in Genome Browser
Species Human (GRCh38)
Location 12:40328135-40328157
Sequence GGGTATGTGTAGAGGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 460}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095279075 Original CRISPR GGGTATGTGTAGAGGGAAGA CGG Intronic
902643064 1:17779086-17779108 GGGTATGTATAGGAGGAACAGGG - Intronic
902790780 1:18766389-18766411 GGGTAGGTGAAGAGGGCAGAGGG + Intergenic
904232029 1:29082585-29082607 GGGTAGGGGTGGAGGGATGAAGG - Intronic
904390978 1:30185827-30185849 GGGTATGTGTAGTGGGACTGTGG - Intergenic
904908015 1:33912533-33912555 GGGGAGGGGTAGAGGAAAGAAGG + Intronic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906097616 1:43234889-43234911 GGGTATGTGGAGAAGGGAGGTGG - Intronic
906509066 1:46400844-46400866 GGGGAAGGGTAGAGGGGAGAAGG + Intronic
906627636 1:47338289-47338311 GGGTATTGTTAGAGGGAAGCTGG + Intronic
906750206 1:48251959-48251981 GGCTTTGTGGAGAGGGAAAAGGG + Intergenic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
908060527 1:60343411-60343433 GAGCATGTGGAGAGGGAAAAGGG + Intergenic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
908474068 1:64471076-64471098 GGGTCTGTGCAGAGGACAGAGGG - Intronic
908799889 1:67868710-67868732 GTGTATGTGTATGGGGTAGATGG - Intergenic
909982287 1:82116981-82117003 TGGTGTGTGTAGAGTGAAAAGGG + Intergenic
910106649 1:83638469-83638491 GGGAATGGGTGGTGGGAAGAAGG - Intergenic
910135472 1:83963371-83963393 GGCTGTGTGTAGAGGAAGGATGG - Intronic
911315730 1:96354586-96354608 AGGTAGGAGTAGAGGGAGGATGG - Intergenic
911316471 1:96362155-96362177 GGGGAAGTGAGGAGGGAAGAAGG + Intergenic
911595051 1:99790056-99790078 AGATATGCATAGAGGGAAGATGG - Intergenic
912140984 1:106726893-106726915 GGGGAAGTGTAAAGGGAAGGTGG + Intergenic
913387697 1:118277772-118277794 GGGTTAGAGCAGAGGGAAGAAGG + Intergenic
913390048 1:118300498-118300520 GAGGATGTGTGAAGGGAAGAAGG - Intergenic
915286621 1:154857425-154857447 GGGTAAGGGTAGAGGGAGGAGGG - Intronic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
915474797 1:156147219-156147241 GGGTGAGTGTAGAGGAAAGTAGG - Intergenic
915657654 1:157375067-157375089 GGGAATGTGCAGAGGGAAGGAGG - Intergenic
915671423 1:157491920-157491942 GGGAATGTGTAGAGGAAAGGAGG + Intergenic
915824110 1:159057104-159057126 GGGGATGTGAGGATGGAAGAGGG - Intergenic
916538422 1:165727865-165727887 GGGTATGATTAGAGTGAAAATGG - Exonic
916715133 1:167441481-167441503 GGGTGTGTGTAGTGGGAGGAGGG - Intronic
917017003 1:170543424-170543446 GGGCAGGAGAAGAGGGAAGAAGG + Intronic
917369253 1:174271523-174271545 GGGTATGTGTTGTTGGCAGAGGG + Intronic
918575186 1:186050000-186050022 GGGAAAGTGGAGAGGGAAAATGG - Intronic
919645066 1:200087207-200087229 GTGTATGTGTTGAAGGGAGAGGG - Intronic
920866074 1:209755043-209755065 GGGAATGAGTAGAGGACAGAGGG - Intergenic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
923280400 1:232437908-232437930 GGTCATGTGGAGTGGGAAGATGG + Intronic
924333297 1:242962335-242962357 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1063582642 10:7322668-7322690 GGGTATGTTGAAATGGAAGAGGG + Intronic
1063960833 10:11304309-11304331 GGGTTTTTGTAAATGGAAGAAGG - Intronic
1064955626 10:20905553-20905575 CCGTATGTGTTGAGGGAAGGAGG - Intronic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065166650 10:22986003-22986025 GGGTATGTGAAAAGGGCAGCAGG - Intronic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066782088 10:38962218-38962240 GGGTATTTCTGAAGGGAAGAGGG - Intergenic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1068955666 10:62817346-62817368 GGGTGTGTGAAGAGGGCAGCGGG - Intronic
1070433500 10:76364590-76364612 GGGCATGGGAAGAGGGAAAAAGG + Intronic
1070817881 10:79336514-79336536 GGGGAGGTGTGGGGGGAAGAGGG + Intergenic
1071614874 10:87066246-87066268 GGGGATATGAAGAGGGAAGCAGG - Intronic
1071755021 10:88527665-88527687 GTGTATATGTGGGGGGAAGAGGG - Intronic
1072862441 10:99020641-99020663 GTGTATGTGTTGAGGGAGGGTGG + Intronic
1073453739 10:103624199-103624221 GGGGATGTGGGGAGGGAACAGGG + Intronic
1074641478 10:115388056-115388078 TTTTATGTGTAGTGGGAAGAAGG + Intronic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1076769957 10:132657416-132657438 GGGTCTGTGGAGAGTGAAGTGGG + Intronic
1078064416 11:8068522-8068544 GGGAATGAGTAGGGAGAAGAAGG - Intronic
1078339299 11:10487510-10487532 GCATATGTGCAGAAGGAAGATGG + Intronic
1079114167 11:17630067-17630089 GTGCATGTGTAGAGGGAATTTGG - Intronic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1079631164 11:22677310-22677332 GGGCATGTGTTGAGGTAGGAAGG + Intronic
1080075461 11:28142393-28142415 GGGTAAGTGTTAAAGGAAGAAGG + Intronic
1080301776 11:30792531-30792553 GAAGATGTGTAGAGGGAACATGG - Intergenic
1080417627 11:32083621-32083643 GGTTATGTGTAGATGGAGAAGGG - Intronic
1080425231 11:32148690-32148712 GGATAAGTGCAGAGTGAAGAGGG + Intergenic
1080425340 11:32149453-32149475 GGGGTGGTGGAGAGGGAAGACGG - Intergenic
1080892966 11:36425519-36425541 GGTTATGTTTATAAGGAAGAAGG - Intronic
1081592193 11:44431643-44431665 GAATCTGTGTAGAGGGCAGATGG - Intergenic
1082274017 11:50201944-50201966 GGGTAGGTTTGCAGGGAAGATGG - Intergenic
1082806845 11:57457239-57457261 GGGTATGCCCAGAGGGAAGGGGG + Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1083427755 11:62597582-62597604 GGGTGGGTGGATAGGGAAGATGG - Intronic
1083678407 11:64340472-64340494 GGGGCTGTGGTGAGGGAAGAGGG + Intronic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084947588 11:72646994-72647016 GGATAGGTGAAGAAGGAAGAGGG - Intronic
1085173125 11:74465541-74465563 GGGTAGGTACACAGGGAAGAGGG - Intronic
1087272397 11:96124756-96124778 GGGCATGAGAGGAGGGAAGAAGG + Intronic
1088029288 11:105226709-105226731 GGGGATGTGTAGAGAGTAAAGGG + Intergenic
1088779768 11:113123056-113123078 GGGTGTGTGTAGGTGGAGGAAGG + Intronic
1088899975 11:114108539-114108561 GGGAATGTGGAGGGGGAAGAAGG - Intronic
1090353283 11:126121550-126121572 GGGAGTGTGCAGAGGGAGGAGGG + Intergenic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091311753 11:134579865-134579887 GGGTATGTGGAGAGGGGAAGAGG + Intergenic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092288595 12:7144751-7144773 GGGTGGGTTTAGAGGGGAGAGGG + Intronic
1092783885 12:12010731-12010753 GAGTGTGTGTTTAGGGAAGATGG - Intergenic
1092890323 12:12963787-12963809 GGGTGAGTGTAGTGGGAGGATGG + Intergenic
1092905288 12:13095706-13095728 GGGTAGGAGGAGAGGGAGGAGGG - Intronic
1093357866 12:18191086-18191108 GAGTCTGTGTAGTGGGAGGATGG - Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094113247 12:26883418-26883440 GGGAATGTTTAGAGAGAGGATGG + Intergenic
1094316798 12:29144888-29144910 GGGGATATGAAGATGGAAGAAGG - Intergenic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1095891812 12:47241852-47241874 GGGTAAGTGAAGAGAAAAGAAGG + Intergenic
1096661787 12:53129902-53129924 TGGTAGGAGGAGAGGGAAGAGGG - Intergenic
1097401235 12:59130385-59130407 GGGTAGTTGTAGAGGGTAGGTGG + Intergenic
1098811991 12:75106294-75106316 GGGAATGTGGAGAGGAAATATGG + Intronic
1099719673 12:86344766-86344788 GTGTGTGTGTAGCGGCAAGAGGG + Intronic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100383713 12:94085953-94085975 GAGGATGTGCATAGGGAAGATGG + Intergenic
1100646466 12:96537269-96537291 GGGAAAGTGTAGAGACAAGAAGG - Intronic
1101220561 12:102634857-102634879 GTGTATGTGTATGGGGCAGATGG + Intergenic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1103174231 12:118848055-118848077 AGGTATGTGTTGTGGGAGGAGGG - Intergenic
1103186234 12:118960265-118960287 GGGTATGTGTAATGGGAGGGGGG + Intergenic
1103530902 12:121601027-121601049 GGGTGTGTTTAGAGTGCAGAGGG + Intergenic
1103976690 12:124707279-124707301 GGGAAGGTGGAGAGGAAAGAGGG + Intergenic
1104413250 12:128577080-128577102 GGGGCTGTGGGGAGGGAAGAAGG - Intronic
1104856707 12:131905555-131905577 GTGGATGTGTACAGGGCAGAGGG + Intronic
1105391914 13:19987589-19987611 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105391918 13:19987649-19987671 GTGTGTGTGTATAGGAAAGATGG + Intronic
1106036471 13:26049825-26049847 GGGGAGGTGTAGAGGTAAAATGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106875289 13:34065337-34065359 GGTTTTGTGGAGAGTGAAGAAGG + Intergenic
1106900575 13:34351215-34351237 AGGAATGAGTAGAGGGATGATGG + Intergenic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107448066 13:40485714-40485736 GAGGAGGTGTAGAGAGAAGAAGG - Intergenic
1107756969 13:43635003-43635025 GTGTATGTGTGCAGGGAACAGGG + Intronic
1108120238 13:47178044-47178066 TGGGATGTGTAGAGGGGAGGGGG - Intergenic
1109239558 13:59868722-59868744 GGTTCTGAGGAGAGGGAAGAAGG - Intronic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1111437595 13:88231073-88231095 GGGTTTGTGTAGAGGGAATGTGG + Intergenic
1112077468 13:95929452-95929474 GGGGATTTCTAGAGGGGAGAGGG - Intronic
1112530653 13:100199239-100199261 GGGTATGTTTAGAGAGAGGCCGG - Intronic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113548533 13:111173838-111173860 GGGTGTCTGTAGAGGGATGTGGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114310653 14:21463729-21463751 AGGGATGTGAAGAGAGAAGAAGG - Exonic
1114479744 14:23025356-23025378 GCATATGTGTGGAGGGGAGAGGG - Intronic
1118247793 14:64128256-64128278 GGGAGGATGTAGAGGGAAGAAGG + Intronic
1118410375 14:65471097-65471119 TGGTAAGGGTAGAGGGATGAGGG + Intronic
1118855685 14:69620276-69620298 GGGTACATGTAAAGGAAAGATGG - Intronic
1119483834 14:74975729-74975751 GTGTATGTGTGGTGGGAAGGAGG - Intergenic
1119754299 14:77103909-77103931 GGGACTGGGTAGGGGGAAGATGG - Intronic
1119919108 14:78429701-78429723 GGGTCTGTGTGGAGTTAAGATGG + Intronic
1120184698 14:81382556-81382578 GGGGATGTGATGAGGGAGGAGGG + Intronic
1120228606 14:81818538-81818560 GGGTAGGTGAAGAGGCAGGAGGG + Intergenic
1120264052 14:82226526-82226548 GGATACATGTAGAGTGAAGATGG + Intergenic
1120825921 14:88955349-88955371 GGGTATGTGTTGGGGAAAGGAGG - Intergenic
1121241892 14:92436877-92436899 GGGTGTGGGTAAAGGGGAGAAGG - Intronic
1121489091 14:94345049-94345071 GGGGCTGGGGAGAGGGAAGATGG + Intergenic
1121647331 14:95527885-95527907 GTCTATCTGGAGAGGGAAGAAGG + Intergenic
1121672786 14:95725712-95725734 GGGCATGTGTGGAGGGACTATGG + Intergenic
1122450098 14:101798908-101798930 GGGTCTGTGTTCAGGGGAGAGGG + Intronic
1122519517 14:102333686-102333708 GGGAGTCTGTAGAGGGAAGAAGG - Intronic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1124475457 15:30029398-30029420 GGGAAGGAGGAGAGGGAAGATGG - Intergenic
1125542020 15:40475075-40475097 AGGTAGGGGTAGAGAGAAGAAGG + Intergenic
1125671999 15:41480467-41480489 GGGTATGGTGAGAGGGAACAGGG + Intronic
1125918877 15:43512647-43512669 GGGTGTCTGTAAAGGGAAGCAGG - Intronic
1126689198 15:51274838-51274860 GGGTATTTGAAGAAGAAAGAAGG + Intronic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1127478242 15:59354848-59354870 GGGTAGCTGTGGAGGGAAGCTGG - Intronic
1127814191 15:62592091-62592113 GGGGATGTGTATAAGGAGGAGGG + Intronic
1127964660 15:63914605-63914627 GGGGATGTATAGAGGGCACAGGG - Intronic
1128470415 15:67946772-67946794 GGCTAAGCCTAGAGGGAAGAGGG + Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1129050882 15:72780928-72780950 GGGTTTGTGTAAAGGGAGAAAGG - Intronic
1129692680 15:77722753-77722775 GCGTGGGTGTAGAGGAAAGAGGG + Intronic
1130560699 15:84955934-84955956 GGAAATGTGGAGAGGGAAGGAGG - Intergenic
1131902533 15:97104035-97104057 GGTTATATGTAGAGGGAAGATGG + Intergenic
1132344037 15:101096841-101096863 GGGTAGGAGGAGAGGGAGGATGG + Intergenic
1135241691 16:20812652-20812674 AGGTATGAGGAGAGGGAAGCAGG - Intronic
1135479110 16:22806441-22806463 GGGTGTGTGTGGAGCGAGGAAGG + Intergenic
1137559524 16:49493749-49493771 GGATATGTGGAAAGGGGAGAGGG + Intronic
1137574390 16:49589146-49589168 TGGAATGTGGAGTGGGAAGAGGG - Intronic
1137741814 16:50783905-50783927 GGGCATGGGGAGAGGGAAGTGGG + Intronic
1138167839 16:54819445-54819467 AGGTGTGTGTAGTGGGTAGAGGG + Intergenic
1138302567 16:55944762-55944784 GGGTATCTGGAGAGGGCAGTAGG - Intronic
1138834793 16:60421241-60421263 GGGGATGTGGGGAGGGAAGCAGG - Intergenic
1139105741 16:63824438-63824460 GGTTATGACTAGTGGGAAGATGG + Intergenic
1139528810 16:67531561-67531583 GGGGCTGAGTAGTGGGAAGAAGG + Intronic
1141155471 16:81593927-81593949 AGGTAAGGGTAGAGGGAAGAGGG - Intronic
1141393093 16:83680948-83680970 GCACATCTGTAGAGGGAAGAGGG + Intronic
1141428918 16:83960877-83960899 GGGGCTGGGTAGAGGGAGGAGGG - Intronic
1141456514 16:84145625-84145647 GGGTATGTGGTGTGGGAAGGGGG - Intronic
1141678396 16:85529721-85529743 GGGTAGGTGGAGACGGAACAGGG + Intergenic
1141840940 16:86573664-86573686 GGGTGTGTGAAGAGGGAAGGGGG + Intergenic
1142421022 16:89970182-89970204 GGGGAGGAGGAGAGGGAAGATGG - Exonic
1143642055 17:8204807-8204829 GTGTATGTATAGGGGAAAGAAGG - Exonic
1143976157 17:10831486-10831508 GGCTATGTGCAGAGGAGAGATGG + Intronic
1144550062 17:16232712-16232734 GGGTATGTGTAGAGATTTGAGGG + Intronic
1147241148 17:39091300-39091322 GGGTGTGTGTTGCGGGGAGATGG - Intronic
1147540329 17:41351927-41351949 GGGTGTGGGTAGAGTGATGAAGG + Intergenic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1148087154 17:45001184-45001206 GGGGATGTGTGGGGGGGAGAGGG - Intergenic
1148843394 17:50513828-50513850 GAGTTTGTGTAGAAGGGAGAAGG + Intronic
1149458340 17:56807635-56807657 GTTTGTGTTTAGAGGGAAGAAGG - Intronic
1149564416 17:57630939-57630961 GGGGATGAGGAGAGGGCAGAGGG - Intronic
1149658113 17:58320707-58320729 GGGTAGGGAGAGAGGGAAGAGGG + Intronic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151293635 17:73167609-73167631 GGGTATATGAAGAGTGAAGCAGG - Intronic
1152008339 17:77696058-77696080 GGGTAAATGGAGAGGGTAGAAGG - Intergenic
1152284025 17:79402150-79402172 GGGTCTCTGGAGAGAGAAGAAGG + Intronic
1203190713 17_KI270729v1_random:184996-185018 GGGTATTTCTGAAGGGAAGAGGG - Intergenic
1153966332 18:10186022-10186044 GGGTAGTTGTAGATGGAAGGGGG + Intergenic
1153993790 18:10422706-10422728 AGGGATGTGTTGAGGGAAGCTGG - Intergenic
1154308049 18:13244689-13244711 GGGTGTGTCTTGGGGGAAGAGGG - Intronic
1154366610 18:13716281-13716303 GGGCCTCTGAAGAGGGAAGAGGG - Intronic
1156600837 18:38604174-38604196 GTGTCTGTGTAAAGGGATGAGGG + Intergenic
1156698513 18:39796183-39796205 GGGGATGTGAGGATGGAAGAGGG - Intergenic
1157750740 18:50175889-50175911 GGGTATGTGTTGTGGGAAGGTGG - Intronic
1158316221 18:56213771-56213793 GGGAATGTGAAGAGGGAATAGGG + Intergenic
1159558415 18:69968734-69968756 GGAGATGTGAAGAGGGAAGAAGG - Intergenic
1160179039 18:76618686-76618708 GGCTGTGTCTTGAGGGAAGAAGG + Intergenic
1160582871 18:79897628-79897650 GGGTATGTGGAGGAGGAGGAGGG - Intronic
1160901018 19:1428772-1428794 GGGTGTGTCTAAAGGGAAGGGGG + Intronic
1161901214 19:7120920-7120942 GGGGAAGTGAAGGGGGAAGATGG + Intronic
1162018311 19:7857296-7857318 GGGCATGTGAAGTGGGGAGAAGG + Intronic
1162430866 19:10627643-10627665 GGGTGTTTGCAGAGGGCAGATGG + Intronic
1163112956 19:15172485-15172507 GGGGAGGGGTAGAGGGATGAAGG - Intronic
1163667412 19:18609896-18609918 GGGAATGTGTAAGGGGCAGAAGG + Intronic
1164929836 19:32166904-32166926 GGGGAGGTGGAGAGGGTAGAGGG + Intergenic
1164932516 19:32186521-32186543 AGGTCAGTGTAGGGGGAAGAGGG + Intergenic
1166197093 19:41214245-41214267 GGGCAGGAGTAGAGGGAAGGTGG - Intergenic
1166674635 19:44732510-44732532 GGGTATGTATGGAAGGAGGATGG + Intergenic
1167037121 19:47001133-47001155 GGGTGTGTGCAGATGGAAGGTGG - Exonic
1167053479 19:47094600-47094622 GGGTTTGTTTGTAGGGAAGATGG - Exonic
1167548545 19:50143895-50143917 GGGTATGAGGAGAGGGGAGCCGG - Intergenic
1167867870 19:52342984-52343006 GGGTGGGTGGAGAGGGAAAATGG - Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
1168348507 19:55662386-55662408 GGGTAAGGGGAGAGGGATGAGGG - Intronic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925059269 2:878574-878596 GTGTGTGTGTAGGGGCAAGAGGG - Intergenic
925201090 2:1968243-1968265 GGGCATGCGGAGAGGGCAGAGGG - Intronic
925363238 2:3294372-3294394 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363290 2:3294605-3294627 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363413 2:3295220-3295242 GTGTATGTGTGGAGAGAGGACGG - Intronic
925363421 2:3295255-3295277 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363429 2:3295288-3295310 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363477 2:3295521-3295543 GGGTGTGTGTGGAGAGACGATGG - Intronic
925363547 2:3295859-3295881 GGGTGTGTGCAGAGAGAGGATGG - Intronic
925505100 2:4553858-4553880 GGCTTTGTGTAGAGGGCAGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
927103429 2:19805237-19805259 GAGGATGTGAGGAGGGAAGAAGG + Intergenic
927147642 2:20177477-20177499 AGGTGTGTGTAGAGGATAGATGG + Intergenic
928435795 2:31253730-31253752 GGGTGTGTCTTGTGGGAAGAAGG + Intronic
928581850 2:32716170-32716192 TGTTATGTTTAGAGGGAAAAAGG - Intronic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
930221515 2:48751083-48751105 GAGTATGTGGATGGGGAAGATGG + Intronic
932045637 2:68346284-68346306 AGAAATGTGTTGAGGGAAGATGG + Intergenic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932659523 2:73640308-73640330 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932666087 2:73699979-73700001 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
935196595 2:100820059-100820081 GGGGAGGTGGAGAGGGAGGAGGG + Intergenic
935416320 2:102822795-102822817 GCGTATGTGTGGAGGGACGGTGG + Intronic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937777748 2:125800220-125800242 GAGTATGTTGAGAAGGAAGAGGG - Intergenic
938300642 2:130208979-130209001 GGGTCTGTGTAGAGACAGGAGGG + Intergenic
938456083 2:131465492-131465514 GGGTCTGTGTAGAGACAGGAGGG - Intronic
938555778 2:132423111-132423133 GGACATGTGCAGAGGGAAAAGGG - Intronic
938954721 2:136287218-136287240 AGGTATGTGTATAGGGAGTAGGG - Intergenic
939087412 2:137738061-137738083 GGGTATGTGTAGAGGAATGCAGG - Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939623248 2:144446400-144446422 GGGGATGTGGAGAGGGAAGAAGG - Intronic
940004558 2:148998944-148998966 GTGTATGTGTAGGGGGAGAAGGG - Intronic
940005946 2:149009826-149009848 GGGTGTGTGTAGAGGAAAGGGGG - Intronic
941606588 2:167605086-167605108 GGGTATGGGGATAGGGAAGTAGG - Intergenic
941918397 2:170827115-170827137 GGCTATTTCTGGAGGGAAGAAGG - Intronic
942137891 2:172946709-172946731 AGGTTTGTGTTGGGGGAAGAAGG - Intronic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
944142775 2:196475347-196475369 GGGGATGCGCAAAGGGAAGAGGG + Intronic
944619460 2:201499039-201499061 GGGTGTGTGGGGATGGAAGATGG - Intronic
944652804 2:201848544-201848566 GGGAGTGTGGGGAGGGAAGATGG - Intronic
945587374 2:211683326-211683348 GGGTAAGTTTAAAGGGAAGGTGG - Intronic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947847818 2:233259738-233259760 GGGAAGATCTAGAGGGAAGAAGG - Intronic
1169787390 20:9374526-9374548 GGTGAGGTGAAGAGGGAAGACGG + Intronic
1170011001 20:11723842-11723864 GGGTACCTGTAGAAGCAAGAGGG + Intergenic
1170217680 20:13908877-13908899 GGGTATGTACAAAGGGAAGCTGG - Intronic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172789211 20:37490953-37490975 TGGAGAGTGTAGAGGGAAGATGG - Intergenic
1172969999 20:38866283-38866305 GTGTCTGTGCAGCGGGAAGAAGG + Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173149860 20:40557697-40557719 GTATATGTGAATAGGGAAGAAGG - Intergenic
1173209535 20:41021436-41021458 GGGCTTGTGGAGAGGGAGGATGG + Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173441188 20:43077692-43077714 GGGTATATGCAGAGGGAAAAAGG + Intronic
1173979058 20:47208882-47208904 GGGTATGAGTAGAATGAAGCCGG - Intergenic
1173995811 20:47337894-47337916 GAGTATGTGTCAAGGGGAGAGGG + Intronic
1175048847 20:56133936-56133958 GGCCAAGTGTAGAGGGGAGAAGG - Intergenic
1175787897 20:61723543-61723565 GGGTATCTGTAAAGTGAGGATGG - Intronic
1175817427 20:61890619-61890641 GGGGATGGGTAGACGGATGAGGG + Intronic
1176028577 20:62999075-62999097 GGGGAAGGGGAGAGGGAAGAGGG + Intergenic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1181438658 22:22924610-22924632 GGGTCTTTGTAGAAGAAAGAGGG - Intergenic
1182675498 22:32036079-32036101 GGGGCAGTGAAGAGGGAAGATGG - Intergenic
1183073098 22:35409983-35410005 GGGTATGGGAAGAGGGGAGTTGG + Intronic
1183414640 22:37675387-37675409 GGGGAGGTGGAGAGGGATGAAGG + Intergenic
1183733906 22:39632960-39632982 AGTTTTGTGGAGAGGGAAGATGG + Intronic
951257184 3:20463661-20463683 GGGTATTTTAAGTGGGAAGAAGG - Intergenic
951685353 3:25337821-25337843 GGGGATGTAGACAGGGAAGAGGG - Intronic
951700851 3:25495238-25495260 GGGTATCAGAGGAGGGAAGATGG + Intronic
951955003 3:28243799-28243821 GTGTCTGTGTAGGGGGAAAAGGG - Intronic
952037565 3:29221146-29221168 GGACAGGTGTAGAGGGAAGATGG - Intergenic
953203757 3:40801586-40801608 GGGTATGGGCAGAGGAAGGAAGG + Intergenic
954859877 3:53678709-53678731 GAGAATGTGAAGAGGGAAGGTGG + Intronic
954974096 3:54676521-54676543 TGGGCTGTGTAGAGGGCAGAAGG + Intronic
955179473 3:56653771-56653793 AGGTATGTGTATAGGGAAACAGG - Intronic
955959272 3:64322287-64322309 GGGCAGCTGTAGAGGGAAAATGG + Intronic
956527204 3:70178240-70178262 GGGGATGTGTGGAGGAAGGAGGG + Intergenic
957232617 3:77539509-77539531 GGGTATGTGTATAGGTATAATGG + Intronic
957457670 3:80472964-80472986 GGGCATGTGGAAAGGGAATATGG + Intergenic
958661022 3:97067770-97067792 GGGAATGGGTTGTGGGAAGAAGG + Intronic
958801023 3:98756028-98756050 GTGTATGTGTGGAGAGAAGCTGG + Intronic
958913788 3:100025212-100025234 GGGGCTGTGTAGTGGCAAGAAGG - Intronic
959362639 3:105413421-105413443 GCAAATGTGTAGAGAGAAGATGG - Intronic
959717986 3:109454440-109454462 GGGTGTGTGTAGGGGGAAGTGGG + Intergenic
960461775 3:117944397-117944419 GGGTATTTGGAGGGGGAAGCGGG - Intergenic
960619327 3:119623660-119623682 GGGTGTGTGGAGAGGGAGCAGGG + Intronic
961345288 3:126260120-126260142 GGAGATGTGGAGAGGGAAGGGGG - Intergenic
961345405 3:126260528-126260550 GGGGAGGAGGAGAGGGAAGAGGG - Intergenic
961345450 3:126260661-126260683 GGAGATGTGGAGAGGAAAGAGGG - Intergenic
962084044 3:132172101-132172123 GGGTATGTGTGGAGCGAGGCAGG - Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962202821 3:133414868-133414890 AGGGATGAGTAGAGGGGAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203486 3:133417492-133417514 AGGGATGAGTAGAGGGGAGAGGG - Intronic
962203496 3:133417525-133417547 AGGGATGAGTAGAGGGGAGATGG - Intronic
962844796 3:139264745-139264767 AGGTAAGTGGAGAGGGAAGCAGG - Intronic
962920942 3:139949940-139949962 ATGTGTGTGTAGAGGCAAGAAGG + Intronic
965847846 3:172985798-172985820 GGGTTTGTGTAGAGGAAGAAAGG + Intronic
967276470 3:187780330-187780352 GTGTGTGTGTAGGGGGCAGAAGG - Intergenic
967642594 3:191883832-191883854 TAGTTTGTGTAGAGAGAAGAGGG + Intergenic
968263525 3:197344066-197344088 CGGGATGAGTAGAGGAAAGAAGG - Intergenic
968887257 4:3341430-3341452 GGGTATGTGGGGAGGGGACAAGG + Intronic
969309064 4:6341693-6341715 GGGTCTGTATAGGAGGAAGAAGG + Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971205934 4:24568600-24568622 GTGTATGTGTAGTAGGAAGTGGG - Intronic
972275724 4:37555853-37555875 TGAGATGTGAAGAGGGAAGAAGG - Intronic
974036400 4:56821788-56821810 CGGTAGGTGGCGAGGGAAGAGGG + Intergenic
977781739 4:100988492-100988514 GGGCAAGTGTAGAAGTAAGAAGG + Intergenic
977826926 4:101543576-101543598 GGGTGTGTGTTGAGGGCAGGGGG + Intronic
977839362 4:101682976-101682998 GGGTATGTGAGGTGGAAAGATGG - Intronic
978091796 4:104726288-104726310 GGAGATGTGGAGAGGGAAGTGGG + Intergenic
979264257 4:118683112-118683134 GGGTGTGTGTGGCAGGAAGAGGG - Intergenic
980774664 4:137422365-137422387 GAGTATATGTAGAGGGGTGAAGG + Intergenic
981079410 4:140623608-140623630 GGGCATGTGTCGTGGGAGGAGGG - Intronic
981719440 4:147786772-147786794 GGGTATGGGTGGAGGAAAGGTGG + Intronic
982248081 4:153375203-153375225 GGGTAGGTTTAGAGGGATGGAGG + Intronic
982558289 4:156897445-156897467 GTGTATGTGTAGAGAGAGGGAGG - Intronic
983924200 4:173379938-173379960 GGGAATAGGGAGAGGGAAGAAGG - Intergenic
984074747 4:175161824-175161846 GGATATGTGTACAGGGGTGAGGG + Intergenic
984602576 4:181745391-181745413 TGGTAGCTGTAGACGGAAGAAGG + Intergenic
985167875 4:187116773-187116795 GGTTATGGGTAGATGGAAGTTGG + Intergenic
985909738 5:2869498-2869520 GGATGTGTGCTGAGGGAAGATGG + Intergenic
986192209 5:5508151-5508173 GGGGAACTGCAGAGGGAAGAGGG - Intergenic
986627489 5:9736329-9736351 TGGTAAGTGCAGAGGGAATAAGG - Intergenic
986929573 5:12801508-12801530 GGGTGTGTGTAAAGGGAGGGGGG - Intergenic
988415300 5:30939747-30939769 GGGTATGTGGAGTGGGAAGGAGG - Intergenic
988772974 5:34450385-34450407 GGAACTGTGTAGTGGGAAGAGGG - Intergenic
988806062 5:34741807-34741829 TGGCATGGGAAGAGGGAAGAGGG + Intronic
988818207 5:34855005-34855027 GGGTTTGGGTAGGTGGAAGAAGG + Intronic
989153694 5:38324373-38324395 GGGTATGTGTGGAGGGGGGCAGG - Intronic
990086368 5:51983143-51983165 GGCTAGGTGTAGATGGATGAAGG - Intergenic
990668307 5:58098443-58098465 GGATGTGTGTACAGAGAAGAAGG + Intergenic
990972782 5:61527635-61527657 GTGTATGTGTTGAAGGAAGAAGG - Intronic
991385026 5:66077747-66077769 GTGTGTGTGTAGAGGGAGGGAGG - Intronic
991593661 5:68280101-68280123 CAGAATGTGTTGAGGGAAGATGG + Intronic
991600374 5:68346130-68346152 AACTATGTGTAGTGGGAAGAAGG - Intergenic
994261363 5:97662692-97662714 GGGAATGTGTAGACACAAGAAGG - Intergenic
994534391 5:101008862-101008884 GGGTAAGGGTAAAGGGAAGTAGG + Intergenic
996003528 5:118392452-118392474 GACTTTGTGAAGAGGGAAGATGG - Intergenic
997758193 5:136420194-136420216 GTCTATGGGTAGAGGGATGAGGG + Intergenic
998170340 5:139868860-139868882 GGGTAGGGGCAGAGGGATGAGGG + Intronic
1000137219 5:158364594-158364616 GGGAAAGTGAAGAGGGAAGGAGG - Intergenic
1001266910 5:170280334-170280356 GGGAATGTGTGCAGGGAGGAGGG - Intronic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001781311 5:174371380-174371402 GGGTAAGTTTGGAGGGAACACGG - Intergenic
1001820438 5:174705956-174705978 GGGTATGTGTGGAGAGAGGCAGG - Intergenic
1003850035 6:10212346-10212368 AGGTATGTGATGAGGGAAAATGG - Intergenic
1004323078 6:14648190-14648212 GGGTTTGGGTAGCGGGAGGATGG - Intergenic
1004889739 6:20089139-20089161 GTGTATGGGTAGAGGGGACAGGG + Intergenic
1005959204 6:30684255-30684277 GTGTATGTGCAGAGCGAGGAAGG + Intronic
1006028592 6:31162819-31162841 GGGAATGACTACAGGGAAGAAGG + Exonic
1006700987 6:35972970-35972992 GGGTATGTGTAGATGGAAGGAGG - Intronic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008609055 6:53169120-53169142 GAGTATGTGTTGTGGGAAGGGGG - Intergenic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1009527722 6:64767415-64767437 GAGTATGGGGAAAGGGAAGATGG - Intronic
1010000056 6:70940067-70940089 GGGTCTGTGGAGAAGGAACAAGG + Intronic
1010621516 6:78082472-78082494 AGGAAAGGGTAGAGGGAAGAGGG + Intergenic
1011585738 6:88923405-88923427 GGCTATGTGGAGAGAGAACATGG - Intronic
1011737777 6:90329904-90329926 GAGTATGTGTATTGGGAGGAGGG - Intergenic
1011829433 6:91353425-91353447 GGGTATTATTGGAGGGAAGAGGG - Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1013065975 6:106684839-106684861 GGGTGTTTGTAGGGGGAAGTGGG - Intergenic
1013871795 6:114772227-114772249 GGGTATTTATAAAGGAAAGAAGG - Intergenic
1014827838 6:126066469-126066491 ATGTATGTCGAGAGGGAAGATGG + Intergenic
1015282429 6:131448168-131448190 GTGTATGTCTACAGAGAAGAAGG - Intergenic
1015744781 6:136498309-136498331 GGATAGGAGTAGAGGGAATAGGG + Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017827971 6:158096404-158096426 AGGGATGTCTAGAGGGAGGAAGG - Exonic
1017912930 6:158810331-158810353 GGGTAAGTGTGGAGGGATGTGGG - Intronic
1018245187 6:161815763-161815785 GTCTGTGTGTAGGGGGAAGACGG + Intronic
1019892037 7:3954603-3954625 GGGAAGGTGTAGAGGGGAGGTGG - Intronic
1020274924 7:6617987-6618009 GGGGATGTGTGGAGTCAAGAAGG + Intronic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020401980 7:7789614-7789636 GGGTCTGTGGGGAGGGGAGAAGG - Intronic
1020692394 7:11371916-11371938 GGGCATGTTTAGTGGGAAGTAGG + Exonic
1021655280 7:22868366-22868388 GGGGATGGGTTGAGGGGAGATGG - Intergenic
1022762063 7:33365677-33365699 GGGTATGTGTAAAGGGACTTTGG + Intronic
1023310468 7:38881344-38881366 GGGTCTTTGTAAATGGAAGAGGG - Intronic
1023401876 7:39796845-39796867 GAGTATGTGTAGGAGGAGGACGG + Intergenic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023894104 7:44417886-44417908 GGGGATGTGGGGTGGGAAGAAGG + Intronic
1024215695 7:47246367-47246389 GGGTATGTGTAGGGAGAAAAGGG - Intergenic
1024647742 7:51383817-51383839 GAGTATGTGTAGGAGGAGGACGG - Intergenic
1025176924 7:56806854-56806876 GAGTATGTGTAGGAGGAGGAGGG - Intergenic
1025694868 7:63769532-63769554 GAGTATGTGTAGGAGGAGGAGGG + Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1026543745 7:71303487-71303509 GGGTCTGTGTAAATGGATGAGGG + Intronic
1029328269 7:99828746-99828768 GGGGATGGGTAGACAGAAGAGGG - Intronic
1029421557 7:100474518-100474540 GGGGAGGTGGAGAGGGAGGAAGG - Intronic
1029601094 7:101563889-101563911 GGGGCTGTGGAGAGGGAGGAGGG - Intergenic
1034405423 7:150899555-150899577 GGGGCTGTGTGGAGGGAAGCAGG - Intergenic
1034422223 7:150996031-150996053 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034422249 7:150996097-150996119 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1035179934 7:157081937-157081959 GGGAATGTGAAGAGGAAAGTGGG + Intergenic
1035782373 8:2238598-2238620 GGGGAGGTGAAGAGCGAAGAGGG + Intergenic
1035809746 8:2480990-2481012 GGGGAGGTGAAGAGCGAAGAGGG - Intergenic
1035850635 8:2915819-2915841 GGGTAGGAGGAGAGAGAAGAAGG + Intergenic
1036806924 8:11841407-11841429 GGGTGTGTATAGGAGGAAGAGGG + Intergenic
1037526128 8:19725807-19725829 GTGTATGTGTTGGGGGTAGAGGG - Intronic
1038288239 8:26225637-26225659 GGTGATGTGGTGAGGGAAGAAGG - Intergenic
1038472413 8:27836533-27836555 GAGTAACTGTAGAGAGAAGAGGG + Intronic
1040042616 8:42931739-42931761 CGGGATGGGAAGAGGGAAGAGGG - Intronic
1041330480 8:56719109-56719131 GGGCAGGAGGAGAGGGAAGAGGG - Intergenic
1042169986 8:65981746-65981768 GGGTATGTGAAGTGGGGGGAGGG - Intergenic
1042694387 8:71540285-71540307 GGGTCTGTATAGAGTGAATATGG - Intronic
1044839621 8:96326765-96326787 GGGAGAGTCTAGAGGGAAGATGG + Intronic
1046816653 8:118591882-118591904 GGGTATTTTGGGAGGGAAGAAGG + Intronic
1046897708 8:119490774-119490796 GGGTGGGTGGAGAGGTAAGAAGG - Intergenic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1047454577 8:124997942-124997964 GTGTATGTGGAGAGGGCGGAAGG - Intergenic
1047681284 8:127257137-127257159 GGTTATGTGGAGAGAGAACAAGG + Intergenic
1048048702 8:130796939-130796961 GGGTGTTTGCAGAGGGAAGTTGG - Intronic
1048065721 8:130966428-130966450 GGTTAGGTGCAGAGGGAAGAAGG + Intronic
1048316226 8:133364505-133364527 GGGTATGTGAACAGGGATGCAGG - Intergenic
1048443045 8:134474011-134474033 AGGTCTGTGTAGACAGAAGAAGG - Intergenic
1049295407 8:141831435-141831457 GGGCATGTGGGGAGGGGAGATGG - Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049611323 8:143557038-143557060 GGGCACGTCCAGAGGGAAGAAGG - Intronic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1051174266 9:14347397-14347419 GGATAGGTGGAGGGGGAAGAGGG + Intronic
1051928647 9:22359573-22359595 GGGTTTGTGGAGGGGGAAGGTGG - Intergenic
1052360519 9:27551559-27551581 GGGTATGTGTAGAAGCAAACAGG + Intronic
1052708441 9:32022249-32022271 AGGTATCTGTAGAGCTAAGATGG - Intergenic
1053036284 9:34829269-34829291 TGGTATGTGTAAATGGATGATGG + Intergenic
1053448988 9:38177630-38177652 GGGCATCTGCACAGGGAAGAAGG - Intergenic
1055018670 9:71645972-71645994 GGGTATCAGTAGAGAAAAGAAGG - Intergenic
1055279698 9:74660121-74660143 GGCTATGTATAGAGGAAATAGGG - Intronic
1055752834 9:79526603-79526625 GGGAATGGGAAGAGGAAAGATGG + Intergenic
1056098383 9:83277078-83277100 TGGGATGTGTGGAGGAAAGATGG + Intronic
1057020264 9:91691885-91691907 GGGTATATGCAGAGGGAAACAGG + Intronic
1057911462 9:99023186-99023208 GGGTAGCTGTAGAGGGGAGTGGG + Intronic
1058910530 9:109516524-109516546 GGGTGTGTGTAGGGGGATGGTGG + Intergenic
1058956068 9:109949951-109949973 GCTTATGTGTAGACTGAAGATGG - Intronic
1059313134 9:113401938-113401960 GGAGATGTGCAGAGGCAAGAGGG + Intergenic
1059772510 9:117440908-117440930 GGGTTTGAGTAAATGGAAGACGG + Intergenic
1060015241 9:120081038-120081060 TGTTCTGTGTAGGGGGAAGAAGG + Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060701625 9:125756512-125756534 GGGTATGGTTAGAAGGAAGAGGG + Intronic
1061872725 9:133529308-133529330 GGGTCTCTGTAAATGGAAGATGG - Intergenic
1061911821 9:133729051-133729073 GGGGATGGGTGGAGGGATGAAGG + Intronic
1186641779 X:11463243-11463265 GGGCGTGTGGAGAGGGAGGATGG + Intronic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1187654849 X:21460070-21460092 GAGTATGTATGGTGGGAAGACGG - Intronic
1187926638 X:24256710-24256732 GGTTACTTGTAGTGGGAAGAGGG - Intergenic
1187969670 X:24647191-24647213 GGGGATGGGTGGAGGGTAGAGGG - Exonic
1189938872 X:46099801-46099823 GGGTCTGATTAGAGGGTAGAGGG - Intergenic
1192785067 X:74326904-74326926 GGGTACGTGCAGAGGGAAAGTGG - Intergenic
1193952201 X:87813593-87813615 GGGTATGTGTATAAGGAGTAAGG + Intergenic
1194128446 X:90049113-90049135 ATGTAGGTGTAGATGGAAGAGGG - Intergenic
1194142004 X:90219432-90219454 GGAGATGTTTACAGGGAAGAGGG + Intergenic
1195328134 X:103774617-103774639 GGGAATGTGGAGAGAGAAAAAGG + Intronic
1195378443 X:104249836-104249858 GGGGAGGTGTGGAGGGAAAATGG + Intergenic
1195711802 X:107778925-107778947 TGGTGTGTGTAGGGGGAATAGGG + Intronic
1198131316 X:133698041-133698063 TGGTATCTGTAGATGCAAGATGG + Intronic
1199109710 X:143916372-143916394 GAGTATGTATAGAGGGGTGAGGG - Intergenic
1199895134 X:152119986-152120008 GGGGATGGGAATAGGGAAGAGGG + Intergenic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1200487762 Y:3788545-3788567 GGAGATGTTTACAGGGAAGAGGG + Intergenic
1201184498 Y:11386572-11386594 GATTATGTGTAGAAGGTAGAGGG + Intergenic
1202391504 Y:24375052-24375074 GGGTGTGTGTGGAGTGTAGAGGG - Intergenic
1202479281 Y:25295065-25295087 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic