ID: 1095281317

View in Genome Browser
Species Human (GRCh38)
Location 12:40354615-40354637
Sequence ATATTAAAGGGAATTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095281313_1095281317 -2 Left 1095281313 12:40354594-40354616 CCTATTTTCATTGGTTTGCATAT 0: 1
1: 0
2: 4
3: 69
4: 576
Right 1095281317 12:40354615-40354637 ATATTAAAGGGAATTGTGGAAGG 0: 1
1: 0
2: 0
3: 30
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095281317 Original CRISPR ATATTAAAGGGAATTGTGGA AGG Intronic
901115340 1:6839409-6839431 AAATTAAATGGAATTTTGGGGGG - Intronic
901378437 1:8856448-8856470 ATAGAAAAGGGAATTGGGAATGG + Intergenic
901412738 1:9095869-9095891 ATATTTAAGGGTTTTTTGGAAGG - Intergenic
901517195 1:9756181-9756203 CTATTAGTTGGAATTGTGGAAGG - Intronic
901659875 1:10792353-10792375 AAAGTAAATGGAAATGTGGAGGG + Intronic
902255528 1:15186617-15186639 AGATTAAATGAAATTGTGCATGG + Intronic
903438583 1:23370368-23370390 ATATAAAATGGAATCCTGGAGGG + Exonic
905854353 1:41298088-41298110 GTATTAAATGGAATAGTGTATGG - Intergenic
907840446 1:58152053-58152075 ATATTAAAGGGTCTTGAGGTGGG + Intronic
908096556 1:60745492-60745514 ATATTAAACTTAATTCTGGATGG + Intergenic
909464929 1:75962922-75962944 TTATAAAGGGGATTTGTGGAAGG - Intergenic
910879040 1:91906008-91906030 ATTTTAAAGATAATTCTGGACGG + Intronic
912025961 1:105172742-105172764 ATGTACAAGGAAATTGTGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915200543 1:154224304-154224326 ATATTAAGGTGAGTGGTGGAGGG + Intronic
916537013 1:165712764-165712786 ATCTTATAGGGCATTGTGTAGGG + Intergenic
916884217 1:169051509-169051531 ATTTCAAAGTGAATTTTGGAAGG + Intergenic
917270984 1:173273825-173273847 CTATTAAAAGGAAGTGTGGCTGG + Intergenic
917733530 1:177899825-177899847 ATATGAAAAGGAACAGTGGAAGG + Intergenic
918430386 1:184453988-184454010 AGGTTAATGGGAATTGTGTAGGG + Intronic
918801207 1:188974539-188974561 ATAGTAAATGGAGTTGTGGCTGG + Intergenic
919371375 1:196731640-196731662 ATGTTAAAGGGAGTTCTTGAAGG - Intronic
920131716 1:203737087-203737109 AGATAAAAGTGAATTGGGGATGG - Intronic
920801632 1:209193962-209193984 ATATTAGAGAGAATGGTGGAGGG + Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921557195 1:216612868-216612890 CCATTAATGGGAATTATGGAAGG + Intronic
922779749 1:228242334-228242356 ATATCATAGTGAATTGTAGAAGG + Intronic
924083448 1:240423301-240423323 AAATTAAAGTTACTTGTGGAAGG + Intronic
924163701 1:241260688-241260710 AGATTAAAGAAAATTGTGAATGG + Intronic
924204480 1:241697760-241697782 ACATTAGAGAGAATTATGGAGGG - Intronic
924329630 1:242928805-242928827 CTATTAAAGGAAAGTCTGGAAGG - Intergenic
924805362 1:247357443-247357465 GTGTTAAGGGGAATTATGGAAGG + Intergenic
1062790074 10:298100-298122 ATATTAGGGGGAAATGAGGAAGG - Intronic
1064549510 10:16484641-16484663 ATTTTAAAGCTAATGGTGGAGGG + Exonic
1065604830 10:27407163-27407185 ATAGTAAAAGAAATTGTGGCTGG - Intronic
1066027694 10:31380185-31380207 ACATTAAAGGGAAAAGGGGAGGG - Intronic
1066088739 10:31996786-31996808 ATATTAAAGTGATTTGTAAAAGG + Intergenic
1067472538 10:46547362-46547384 AACTTTAAGGGAACTGTGGAAGG - Intergenic
1067671985 10:48332020-48332042 GTGTTAAGGGGAATTATGGAAGG - Intronic
1069059772 10:63883287-63883309 ATATTAAATTGAATTTTGGAGGG + Intergenic
1070396845 10:76018521-76018543 ACATTTAAGGGAATTGTACAAGG + Intronic
1070685411 10:78476823-78476845 AGATCAAGGGTAATTGTGGAGGG + Intergenic
1071701567 10:87944266-87944288 ACATTCAAGGGAATTGTGAGAGG + Intronic
1072073207 10:91941004-91941026 TTATTAAAGGGAGTTGAGGCCGG - Intronic
1072178726 10:92957791-92957813 ATATTAAAGTGAATTACTGAGGG + Intronic
1073166211 10:101454900-101454922 ATATAGTAGGGAATTCTGGATGG + Intronic
1073193119 10:101666429-101666451 AATTGAAAGGGAGTTGTGGAAGG + Intronic
1073262050 10:102197867-102197889 GTATTAAGGGGAATTACGGAAGG - Intergenic
1074695026 10:116042406-116042428 ACATTAGAGGGAATTGAGCAAGG - Intergenic
1079292362 11:19199764-19199786 GTCTTAAAGGGCATTGAGGATGG - Intronic
1079912003 11:26322294-26322316 ATAATAAAGGAAATTGTGCAGGG - Intronic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1084919381 11:72457007-72457029 AAATTAAATAGGATTGTGGAAGG + Intergenic
1085853713 11:80151939-80151961 ATTTTCAAGGGAATAGTGAAGGG + Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087222751 11:95564231-95564253 ATATCAAAGGGAATTTGGAATGG + Intergenic
1088274653 11:108072324-108072346 ACATTAAATGTAATTCTGGAAGG - Exonic
1089133397 11:116230056-116230078 ATGTTTAAGTGAAATGTGGAGGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1090112321 11:123926963-123926985 AAAAACAAGGGAATTGTGGAAGG - Intergenic
1090935782 11:131340817-131340839 ATATTCAAGGGAACTATAGATGG - Intergenic
1092332912 12:7602050-7602072 ATGCTAAGGGGAATTATGGAAGG + Intergenic
1092958112 12:13569039-13569061 ATAATAGATGGAACTGTGGAAGG - Intronic
1094012256 12:25821622-25821644 ATATTCAAGGTAAGTGTGGAAGG - Intergenic
1094063999 12:26343918-26343940 AAATTAAATTGAATTTTGGAGGG - Intronic
1095281317 12:40354615-40354637 ATATTAAAGGGAATTGTGGAAGG + Intronic
1096875607 12:54627976-54627998 ACATTTAAGGGCTTTGTGGAAGG + Intergenic
1097381492 12:58900451-58900473 ATTTTAAAGGGATTTTAGGAAGG + Intronic
1098206689 12:68118375-68118397 GTATTACGGGGAATTATGGAAGG + Intergenic
1099233697 12:80056941-80056963 AAATTAAAGAGGATTGAGGAGGG - Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1100206833 12:92358934-92358956 ATGTTAAATGGAAGTGGGGAGGG - Intergenic
1103841314 12:123867527-123867549 ATAGTGGAAGGAATTGTGGATGG + Exonic
1105042949 12:132975842-132975864 ATATTCAAGGTAATTATTGATGG - Intergenic
1105793747 13:23830649-23830671 ATATTACTAGGAATAGTGGAAGG - Intronic
1106667007 13:31862180-31862202 ATATTAAACGATATTGTGGCAGG - Intergenic
1106795258 13:33198492-33198514 ATATTCAAGGTAATTAAGGAAGG - Intronic
1109020787 13:57089676-57089698 AAATAAAAGGGAGTTGTGGAAGG + Intergenic
1110297264 13:73882830-73882852 ATTTTAAAGCAAATTATGGAAGG + Intronic
1110435370 13:75472436-75472458 ATAAAAAAAAGAATTGTGGATGG + Intronic
1110830944 13:80030192-80030214 TTCTGAAAGGGACTTGTGGATGG - Intergenic
1111362821 13:87197605-87197627 ATATATTAGGGAATTGTAGAAGG + Intergenic
1111579979 13:90210017-90210039 TGATTAAAGGGAATTGAGGCTGG - Intergenic
1111628534 13:90819724-90819746 GTTTTAAAGTGAATTTTGGAAGG + Intergenic
1112136583 13:96584926-96584948 ATATGGAGGGGAATTGGGGAAGG + Intronic
1112400308 13:99071756-99071778 AAACTAAAGCGAATGGTGGAAGG - Intronic
1112681858 13:101776137-101776159 ATAATAATGTGAAGTGTGGAAGG - Intronic
1113173488 13:107533908-107533930 ACATTAATGGGAAATGGGGAGGG + Intronic
1113452567 13:110421885-110421907 CCATCAAAGGGAATTGAGGAAGG + Intronic
1114212914 14:20631323-20631345 AAATTAAAAGGAATTTTTGAAGG + Intergenic
1115817878 14:37182441-37182463 TTAAGAAAGGGAATAGTGGAGGG + Intergenic
1116127896 14:40812895-40812917 AAATTAAAGGGAATTGATTAGGG + Intergenic
1116166759 14:41343439-41343461 ATATTAAAGGGAGTTGATTAAGG + Intergenic
1116709102 14:48342490-48342512 TTATTAAAGAGAATACTGGAGGG + Intergenic
1117938125 14:60930477-60930499 ATATTAAATGTAATTGTGCTGGG + Intronic
1120258902 14:82157450-82157472 ATATGAAAGCGAAATCTGGAAGG + Intergenic
1120274474 14:82354142-82354164 ATATTAAGGGGTAAGGTGGAGGG - Intergenic
1120853586 14:89193334-89193356 ACATTAAAGGAAATTGTAGAGGG + Intronic
1122109582 14:99488207-99488229 ATATTAGAGGGTATTAGGGAGGG - Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128805601 15:70528709-70528731 ATATGAGAGGTAATTTTGGAAGG + Intergenic
1129062288 15:72869604-72869626 ATAGAAAAGGGAATTGAGTAGGG - Intergenic
1129367707 15:75066878-75066900 GTGTTAAGGGGAATTATGGAAGG + Intronic
1129982942 15:79891017-79891039 ATATAAATGGGATTTGAGGAAGG - Intronic
1130852457 15:87808258-87808280 ATATTAGAAGGAAATGTAGACGG - Intergenic
1131047313 15:89324301-89324323 TAAACAAAGGGAATTGTGGAAGG - Intronic
1131671051 15:94619829-94619851 ATCTGAAAGAGAATTGAGGATGG + Intergenic
1131802987 15:96091097-96091119 ACAAGAAAGGGAATTCTGGAAGG + Intergenic
1133877767 16:9751016-9751038 ATATGAAGGGGAATAGAGGAGGG + Intergenic
1136088936 16:27904545-27904567 ACATTAGAGGGATTTATGGAGGG - Intronic
1136270057 16:29143076-29143098 GTATTAAGGGGAATTTTGGCCGG + Intergenic
1137918104 16:52455120-52455142 ATATAAAATGTAATTGTGAAAGG - Intronic
1138777380 16:59740202-59740224 ATATTAATAGGAATTTTTGAAGG - Intronic
1140465404 16:75177233-75177255 ATACTAAAGGGAACTGGGCACGG + Intergenic
1143916722 17:10299108-10299130 ATGTTAAGGGGAACTGTGGGTGG + Intronic
1143983476 17:10891265-10891287 AAATTAAATACAATTGTGGAGGG - Intergenic
1146450583 17:32970925-32970947 TTGTTAAGGGGAATTATGGAAGG + Intronic
1147375446 17:40020073-40020095 ATATAAAAGGCAATTGGGGAGGG + Intronic
1148483116 17:47973214-47973236 ATATTATGGGGAATTGAGAATGG + Intronic
1150296351 17:64010052-64010074 ATTTTAGAGGACATTGTGGAGGG - Intronic
1152060055 17:78065932-78065954 ATATTAAAATTAATTGTGGCTGG + Intronic
1152361075 17:79833160-79833182 ATATTAAATGGAGATGTTGAAGG - Exonic
1152449622 17:80368971-80368993 ATATTGAAGGGTATTGTTGCCGG + Intronic
1155022548 18:21909976-21909998 ATTTTAAAGTGAATGGAGGAGGG - Intergenic
1155046827 18:22110155-22110177 AGATTAAAGGCAATGGTGGGTGG + Intergenic
1155748118 18:29386605-29386627 ATATCAAAGGGAATTTTGCCTGG + Intergenic
1159021407 18:63146034-63146056 AAAATAAAGGGAATTTTGGCAGG - Intronic
1159121001 18:64170578-64170600 AGATTAAAAGGAATTAGGGAGGG - Intergenic
1159478972 18:68962539-68962561 ACATTAAATGGAATAATGGATGG - Intronic
1159494151 18:69179026-69179048 ACATTAATGGGAATAGTAGAAGG - Intergenic
1160140162 18:76314070-76314092 ATATTTAAGGGAATTATTTAAGG + Intergenic
1165237016 19:34429545-34429567 ATAGTAAATGAAATTGTGTATGG + Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
925260843 2:2527149-2527171 ATCTTATAGGGAATTCTAGAAGG - Intergenic
925445087 2:3920545-3920567 GCATTAAAGGGATGTGTGGATGG + Intergenic
926367112 2:12143682-12143704 ATATTAAAGTGAGTTGTACATGG + Intergenic
926408930 2:12581714-12581736 ATATTAAAGGTATTAGTGGTGGG + Intergenic
926925006 2:17978439-17978461 ATATTAGAGGGATGTGTGAAAGG - Intronic
928142372 2:28740849-28740871 ATATTCAAGGGAATTCTGATAGG - Intergenic
928679624 2:33687773-33687795 ATATTTAAAGTAATTGTGAAAGG + Intergenic
929161602 2:38837851-38837873 TTATTAGAGTGGATTGTGGATGG - Exonic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930954093 2:57183105-57183127 AAATTAAAGGCAGTTGTGTAAGG - Intergenic
932017631 2:68048783-68048805 ATATTGTAGGGATTTGGGGAGGG - Intronic
934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG + Intronic
935265287 2:101388072-101388094 ATATTAAAGGAAGATGTGCATGG - Intergenic
935489217 2:103696572-103696594 ATATTAAAGGTAAATGTAAATGG - Intergenic
937367219 2:121272118-121272140 ATAATAAAGGGAGTTCTGGAAGG - Intronic
937687793 2:124717748-124717770 AAAGTTAAGGGAATTGAGGATGG + Intronic
939502146 2:143001223-143001245 ATATTCAATGGAATTGTGGTAGG - Intronic
939541400 2:143498551-143498573 ATATTAAAGGGAAATATCTAAGG - Intronic
941237447 2:162992909-162992931 ATATGGAAGGGCATTTTGGAAGG + Intergenic
941314443 2:163975063-163975085 ATACTAAAGGAAATTATGAAGGG + Intergenic
942501277 2:176593308-176593330 ATCTGAAAGAGAATTGTGGGAGG + Intergenic
943294297 2:186117376-186117398 TTTTTAAGGGGATTTGTGGAGGG - Intergenic
943430155 2:187789438-187789460 CTATGAAAGGGAATTGGGAAGGG + Intergenic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944121767 2:196248255-196248277 TTATTAAAGGGAAATGTAAAGGG + Intronic
945239494 2:207663114-207663136 ATATTAAAGGCGATTTTGGCAGG - Intergenic
945363921 2:208927626-208927648 ATAAAAAAGGGAGTTCTGGATGG + Intergenic
945774629 2:214089829-214089851 ATGGTAAAGGGATTTATGGATGG - Intronic
946508397 2:220326476-220326498 ATATTAAAAGGAATAGTGCAGGG + Intergenic
947946047 2:234103207-234103229 ATTTAAGAGGGAAGTGTGGATGG - Intergenic
1169825755 20:9767122-9767144 TTATTAAAATGAATTCTGGAAGG - Intronic
1170260337 20:14398834-14398856 ATACTAAATGGAAATATGGATGG - Intronic
1170317355 20:15057031-15057053 GAATTAAATGGAATTGAGGATGG + Intronic
1173554344 20:43954855-43954877 AAGTTAAAGGGAATTGTGCAAGG - Intronic
1175594682 20:60221682-60221704 AGGTTGAAGGGAATTGTGGAAGG + Intergenic
1176419564 21:6503334-6503356 ATTTTAAAAAGAACTGTGGATGG - Intergenic
1177096507 21:16842000-16842022 AGATTTAAGGGAATTATAGAAGG + Intergenic
1177260418 21:18722578-18722600 CTAGTAAACGGAATTGTGAAAGG + Intergenic
1177372714 21:20225651-20225673 ATATGAATGGGAAATTTGGATGG - Intergenic
1177372878 21:20228575-20228597 ATATAAAAGGGAAATTTGGATGG + Intergenic
1177839457 21:26219619-26219641 ATAATAGGGGAAATTGTGGAGGG - Intergenic
1178695535 21:34790054-34790076 ATATGAAACTGAGTTGTGGAGGG + Exonic
1178940889 21:36904549-36904571 ATATTTAAGAGAATTATGGGTGG - Intronic
1179695057 21:43111657-43111679 ATTTTAAAAAGAACTGTGGATGG - Intergenic
1183110316 22:35643966-35643988 ATAATAAAGGGAAATGAGGTTGG - Intergenic
1185084158 22:48728522-48728544 ATATTAAAGTGATTTGAGCAGGG + Intronic
949554857 3:5144090-5144112 GTATTAAGGGGAATTATGGAAGG - Intronic
949774176 3:7612675-7612697 AGGTTAAAAGGAATTTTGGAAGG + Intronic
952046103 3:29322699-29322721 ATATGCAAAGGATTTGTGGATGG + Intronic
952527668 3:34228555-34228577 ATATTAAAAGGAATTCTTAATGG - Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
953811175 3:46114142-46114164 ATGTTAAGGGGAATTATGTAAGG - Intergenic
954596380 3:51829176-51829198 AAATTAAAGATAACTGTGGAAGG + Intronic
955494791 3:59520053-59520075 ATATCAAAGCAAATTGTGAAGGG - Intergenic
955873028 3:63459939-63459961 AGATTGACGGAAATTGTGGAGGG - Intronic
956187937 3:66580308-66580330 ATAGGAAAGGGAAGTGTTGATGG + Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
957891154 3:86361025-86361047 ATATAGAAGGGTATTGAGGATGG + Intergenic
958668386 3:97170187-97170209 ATATGGAAGGGAATTGAGGAGGG + Intronic
959163446 3:102746734-102746756 AAATAAAAGGGAATGGTGGAAGG - Intergenic
959387666 3:105732380-105732402 ATATTACAGGGAGATGTTGAAGG - Intronic
959969219 3:112390016-112390038 AAATTAAAGCAAATGGTGGAAGG + Intergenic
962131567 3:132683607-132683629 ATATTAAAGGGTAATTTTGAGGG + Intronic
962182764 3:133225668-133225690 ATCTTAAAGTCAATTTTGGAGGG + Intronic
962545462 3:136429615-136429637 AAATTAAAGCAAATAGTGGAAGG + Intronic
962772755 3:138628403-138628425 ATATTGAAGGGCATTTTGTATGG + Intronic
962890894 3:139672174-139672196 ATATTAAAGGCAGGTGTGTAGGG - Intronic
963880750 3:150525582-150525604 ATTTTAATAGGAATTCTGGAGGG + Intergenic
965896909 3:173588899-173588921 AAATGACAGGCAATTGTGGATGG + Intronic
966121138 3:176521893-176521915 CTTTTAAGGGGATTTGTGGAGGG + Intergenic
966165087 3:177008033-177008055 ATGTTAAGGTGAATTGTGGTGGG + Intergenic
967163723 3:186761749-186761771 ATACTCAAGTGAATGGTGGAAGG + Intergenic
967446771 3:189576454-189576476 ACATTCAAGGGCATTGTTGAAGG - Intergenic
967630789 3:191741286-191741308 GTGTTAAGGGGAATTATGGAAGG - Intergenic
968414709 4:420913-420935 ATTTTAACGTGAATTTTGGAGGG + Intergenic
969382082 4:6808479-6808501 AGATCAAAGGGAATGGTAGAGGG + Intronic
969430961 4:7154077-7154099 ATACTAGAGGGGAGTGTGGATGG + Intergenic
971000220 4:22314330-22314352 ATATAAGAGGGAATTGAGGGGGG + Intergenic
971272332 4:25161566-25161588 TTTTTAAGGGGATTTGTGGAGGG - Intronic
972278948 4:37585122-37585144 ATTTCAGAGCGAATTGTGGAGGG + Intronic
972675809 4:41257937-41257959 AAATTTAAGGCAATTGTGGACGG - Intronic
974050354 4:56936386-56936408 CTATTAAGGGGACTTGTGGTTGG - Intergenic
976934917 4:90618670-90618692 ATATTAAAGGGAAGGGAAGAAGG + Intronic
977093693 4:92712828-92712850 ATATTCAAGGGAATTATTGATGG - Intronic
977794938 4:101153174-101153196 CTATTAAAGGGTTTTGTGTAGGG + Intronic
977859800 4:101943260-101943282 ATATTAAAGGGGTTTATGCAGGG + Intronic
979144986 4:117235622-117235644 ATAAAAATGGGAATTGTGGCTGG + Intergenic
979784031 4:124692525-124692547 ATTTTAAAGTGAATTTTGGGAGG - Intronic
980530641 4:134047878-134047900 ATTTTAAAGGGAGTTGGAGAAGG + Intergenic
981048697 4:140290387-140290409 ATAGTGGATGGAATTGTGGAGGG + Intronic
981300198 4:143178400-143178422 GTGTTAAGGGGAATTATGGAAGG - Intergenic
982265197 4:153532208-153532230 ATAATTATGGGAAATGTGGATGG + Intronic
982403418 4:154994256-154994278 ATATTAAAGAGAAGTCTGGGGGG - Intergenic
982782804 4:159508682-159508704 GTCTTAAAGGGAATGATGGAAGG - Intergenic
983006771 4:162493525-162493547 GTATAGAAGGGAAATGTGGATGG + Intergenic
983728324 4:170959144-170959166 AAATTAAAGGCAATTATGGGAGG + Intergenic
984395339 4:179190702-179190724 ATATTCAAAGGAACTGGGGAGGG + Intergenic
985030401 4:185783509-185783531 ATATTATAGAGAAGTCTGGAAGG + Intronic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
987641428 5:20616780-20616802 TTATTTAAGGGTATTGTGAAAGG - Intergenic
987647370 5:20691249-20691271 AAATAAAAGGGAATTGTTTATGG + Intergenic
989142745 5:38218195-38218217 ATATTAACGGAAATCATGGATGG + Intergenic
989221024 5:38964224-38964246 ATATAAAAGGTAATGATGGAAGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
994220675 5:97191848-97191870 ATATTTAAGGGAATAATCGAGGG - Intergenic
994464615 5:100110997-100111019 ATATTAAAGAGTCTTGAGGATGG + Intergenic
994879738 5:105474369-105474391 ATTTTAAAGGAAATGGTTGAAGG + Intergenic
996328051 5:122298324-122298346 ATATTAAAGGTAATTGGGTCAGG + Intergenic
996542631 5:124646450-124646472 ATAGTAAAAGGAACTGTGGATGG - Intronic
996655116 5:125926062-125926084 GTGTTAAGGGGAATTATGGAAGG + Intergenic
997027531 5:130082902-130082924 ATATTTAAAGGAATTGTGATGGG + Intronic
997064387 5:130544778-130544800 GTGTTAAGGGGAATTATGGAAGG - Intergenic
997910904 5:137872259-137872281 ATTATAAAGGGAATTTGGGAGGG - Intronic
1000240040 5:159400817-159400839 CTATTAAAGGGAATTGAGGCTGG - Intergenic
1000893874 5:166831383-166831405 AATCTAAAGGGAAATGTGGATGG + Intergenic
1000945123 5:167412761-167412783 ATTTCAAAGGGAATTCTGCAAGG - Intronic
1001851479 5:174970716-174970738 GTATGAATGGGAATAGTGGATGG - Intergenic
1002122278 5:177014573-177014595 ACATTAAAGGTAATATTGGAAGG + Intronic
1004249375 6:14010828-14010850 ATGTTAAGGGGAAGTGTGAAAGG + Intergenic
1006977295 6:38115096-38115118 ATATCAAAGGGAATGATGCAGGG + Intronic
1007519608 6:42441451-42441473 TTATTAAAAGGAATGGGGGATGG + Intronic
1011131157 6:84052927-84052949 AGATGAAAGGGAATAGTGTAAGG + Intronic
1011326557 6:86154603-86154625 GTATTAAAGGGGATGGTGAATGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1013297708 6:108774184-108774206 ATTTAAAAGGAAATTGTGCAAGG + Intergenic
1014249573 6:119101366-119101388 ATATGAAAGTGCATTGTGGCTGG - Intronic
1014566700 6:122957512-122957534 ATATTTGAGGGAATAGTTGAGGG + Intergenic
1014843468 6:126246779-126246801 ATTTTAATGGGATTTATGGAGGG - Intergenic
1016115938 6:140285946-140285968 ATAAACAAGGGAGTTGTGGAGGG + Intergenic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1017413224 6:154191811-154191833 ATAATAGAGGAAATTGTGTATGG + Intronic
1017636894 6:156452935-156452957 AAATTAAAGTGAATTTTGGAGGG + Intergenic
1017862926 6:158415829-158415851 ATATGAAAGGGAGTTTTTGAAGG + Intronic
1018670066 6:166169746-166169768 AGATAAAAGGGAAAAGTGGAGGG + Intergenic
1020844052 7:13260276-13260298 ATCTCACAGGGAATTGTGAAGGG - Intergenic
1021205264 7:17772546-17772568 ATATGAAAAGGAATTTTGGTTGG - Intergenic
1021522358 7:21550671-21550693 GTGTTAAGGGGAATTATGGAAGG - Intronic
1023093870 7:36640754-36640776 ACAATAAAGTGAATAGTGGAGGG + Intronic
1024208618 7:47184876-47184898 ATATTTAAGGGTATTGTGTGGGG + Intergenic
1024395746 7:48864757-48864779 AAATTAAAGGGATTTGGGGGTGG + Intergenic
1024399488 7:48907519-48907541 AAATTAAAGGGATTTGGGGGTGG - Intergenic
1024749955 7:52454116-52454138 ATACAAAAAGGACTTGTGGAAGG + Intergenic
1025039023 7:55623420-55623442 ATATTAATAGGAATTTTGCAAGG - Intergenic
1025754848 7:64328783-64328805 ATATTTAAGTGAATTGTGCTTGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026882624 7:73917069-73917091 AGATTAGAGGGACTTTTGGAGGG + Intergenic
1027007819 7:74710567-74710589 TTATTACAGGGATTTGTGTAAGG - Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027635343 7:80665607-80665629 ATATTACAGAGAGATGTGGAGGG + Intronic
1028124863 7:87101017-87101039 ATATTCTAGGTAATTGTAGAAGG - Intergenic
1028492203 7:91424852-91424874 ATATAATACAGAATTGTGGAAGG - Intergenic
1028613082 7:92734064-92734086 ATACTAAAAGGATTTTTGGAAGG - Intronic
1030747722 7:113188104-113188126 ATATTAAAGGAATTTTTGCAGGG - Intergenic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1032637212 7:133722631-133722653 ATTTTAAAGGTCATTGGGGAAGG + Intronic
1033934054 7:146561141-146561163 ATATGGAAGGGAAATGTAGAAGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035091438 7:156316209-156316231 ATATTAATGGGCATGGTGGCGGG - Intergenic
1035878811 8:3221255-3221277 TTATTAAAGGAAATTTAGGAAGG + Intronic
1037604896 8:20429826-20429848 AAATTGAAAGGAATTGTGAAAGG - Intergenic
1038921337 8:32088155-32088177 ACATTAAAGGGGTTTGTGAAGGG - Intronic
1039127875 8:34224094-34224116 ATAAAAAAGGGAATTATGTATGG + Intergenic
1041879623 8:62734549-62734571 ATAAGAAAGGGAATTCTGAATGG - Intronic
1043704710 8:83333563-83333585 AAATTAAAGGGCATTGTGCTTGG + Intergenic
1043773888 8:84240314-84240336 ACATTAATTGGAATTTTGGAAGG - Intronic
1043816278 8:84805819-84805841 ATATTAAAGTGTATTATGAAAGG + Intronic
1045323434 8:101099113-101099135 ATATTAAAGGGAATTGCAATCGG + Intergenic
1045767756 8:105695201-105695223 ATATTACAGGGAATTGTACGTGG - Intronic
1045938266 8:107708523-107708545 AGAAGAAAGGGAATTGTGTACGG - Intergenic
1045985413 8:108244602-108244624 ATTTTAATGGTAATGGTGGAAGG - Intronic
1046192340 8:110812805-110812827 ATTTAAAAGGGAATTGTTGATGG - Intergenic
1046553292 8:115744104-115744126 ATAGTAAAAGGAAATGTGCAAGG - Intronic
1047140452 8:122133190-122133212 ATATTACAGTGACTTGTGGGAGG - Intergenic
1047609007 8:126502470-126502492 ATAGTAAAGGGAGTTATGCAAGG - Intergenic
1048348649 8:133597874-133597896 AGATAAAAGGGATTTGGGGACGG + Intergenic
1050266374 9:3894681-3894703 ATAATATAGGGAAATGTAGAAGG - Intronic
1050777263 9:9280826-9280848 ATATTGAAGGAAAAGGTGGAGGG + Intronic
1050969479 9:11851068-11851090 TTATTTAAAGTAATTGTGGAAGG - Intergenic
1051026440 9:12617744-12617766 ATAATTTAGGGAAGTGTGGAAGG + Intergenic
1052184335 9:25573173-25573195 AGTTTAAAGGGTGTTGTGGAAGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053259946 9:36653844-36653866 ATATTAAAGGAATTTGAGGGAGG - Intronic
1054808171 9:69412677-69412699 TTACTAAAGGGAACTGAGGATGG + Intergenic
1055371865 9:75608275-75608297 ACATTAAAGTGAATTTTGAAGGG - Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1057434258 9:95024715-95024737 ATACTCAAGGGAATGGTGGGAGG + Intronic
1057717930 9:97509841-97509863 ATAAAAAAGCAAATTGTGGAAGG - Intronic
1057776670 9:98016611-98016633 ATCTTAAAGGGATTTGAGAAAGG + Intergenic
1058101368 9:100920943-100920965 ATTTCAAAGGGAATTTGGGAGGG + Intergenic
1058235018 9:102479327-102479349 ATATGAAAGGGAATTTAGGAAGG + Intergenic
1059323727 9:113488981-113489003 ACATGAAAGACAATTGTGGAAGG + Intronic
1059644006 9:116246183-116246205 ATATTAATGGGAAGTGTGTCAGG - Intronic
1060493646 9:124102455-124102477 TTATTGAAGGGAAGGGTGGATGG - Intergenic
1185947840 X:4397742-4397764 CTTTTAAAGGGAGTTGTGGGTGG - Intergenic
1186840551 X:13480605-13480627 GTATAAAAGGGAATTGTTAATGG + Intergenic
1189506881 X:41620195-41620217 TTTTAAAAGGGAATAGTGGAAGG + Intronic
1189602082 X:42637810-42637832 TTATCAAAGGGAAGTGTGGCTGG - Intergenic
1189610758 X:42732065-42732087 TTGATAAAGGGAATTGTGGTAGG + Intergenic
1190143897 X:47873194-47873216 ATCTTTATGGGAACTGTGGAGGG + Intronic
1192587389 X:72329744-72329766 ATTTTTAAGCGAATTGGGGAGGG - Exonic
1192928420 X:75780283-75780305 AGGTTAAAGGGAATTCTGGATGG + Intergenic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1194031096 X:88816420-88816442 ATATTATAGGAAAATGTGAATGG - Intergenic
1195272752 X:103249333-103249355 AAATAAAATGGAAATGTGGAGGG + Intergenic
1195742990 X:108084978-108085000 ATACTCAAGAGAATGGTGGAAGG - Exonic
1197140308 X:123110485-123110507 ATTTTAATGGGAAATGTTGAGGG - Intergenic
1197570520 X:128145666-128145688 AGGTTTAAGCGAATTGTGGAAGG + Intergenic
1198572104 X:137968478-137968500 ATAATAAAGGGATGTGGGGATGG - Intergenic
1198698228 X:139366866-139366888 GTATTAAAGGACATTTTGGAGGG + Intergenic
1198863061 X:141091401-141091423 ATCTTTAAAGGAATTGTGTAGGG - Intergenic
1198899629 X:141495986-141496008 ATCTTTAAAGGAATTGTGTAGGG + Intergenic
1201226995 Y:11827933-11827955 CTATTAAAGGAAAGTCTGGAAGG - Intergenic
1201366947 Y:13217543-13217565 ACATAAAAGGGAATTTTGGTTGG + Intergenic
1201676945 Y:16596385-16596407 ATATTCAAGGATATTGTTGACGG - Intergenic