ID: 1095284196

View in Genome Browser
Species Human (GRCh38)
Location 12:40389168-40389190
Sequence TGGCATTCAGCAGTGGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 2, 2: 8, 3: 71, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095284196_1095284204 23 Left 1095284196 12:40389168-40389190 CCATCAACCACTGCTGAATGCCA 0: 1
1: 2
2: 8
3: 71
4: 295
Right 1095284204 12:40389214-40389236 CCACCCCTCCAGATTTGGCAGGG 0: 1
1: 12
2: 45
3: 120
4: 269
1095284196_1095284201 18 Left 1095284196 12:40389168-40389190 CCATCAACCACTGCTGAATGCCA 0: 1
1: 2
2: 8
3: 71
4: 295
Right 1095284201 12:40389209-40389231 TGACTCCACCCCTCCAGATTTGG 0: 1
1: 1
2: 0
3: 12
4: 113
1095284196_1095284202 22 Left 1095284196 12:40389168-40389190 CCATCAACCACTGCTGAATGCCA 0: 1
1: 2
2: 8
3: 71
4: 295
Right 1095284202 12:40389213-40389235 TCCACCCCTCCAGATTTGGCAGG 0: 1
1: 12
2: 46
3: 94
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095284196 Original CRISPR TGGCATTCAGCAGTGGTTGA TGG (reversed) Intergenic
901434176 1:9235997-9236019 TGGCATTTTTCTGTGGTTGATGG + Intronic
902388679 1:16090342-16090364 TGGCATGCAGGAGAGGCTGACGG - Intergenic
902656520 1:17872880-17872902 GGGTGTTCAGCAGTGGTTGTGGG + Intergenic
904160772 1:28520594-28520616 GGGCATTCAGGAGTGCCTGATGG + Intronic
906478501 1:46185590-46185612 TGGCAAGCAGCAGTGATTGGGGG + Exonic
906605140 1:47164049-47164071 TGGCAGCCAGCAGTGGCTGGAGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907809134 1:57851109-57851131 TAGCATTCAGCTGAGGCTGAGGG - Intronic
908400349 1:63766986-63767008 ATGCAGTCATCAGTGGTTGAGGG + Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912591948 1:110831177-110831199 TTCCTTTCAGCAGTGTTTGAGGG - Intergenic
913579621 1:120213374-120213396 TGTCTTCCAGCGGTGGTTGAAGG - Intergenic
913628552 1:120685014-120685036 TGTCTTCCAGCGGTGGTTGAAGG + Intergenic
914561555 1:148824801-148824823 TGTCTTCCAGCGGTGGTTGAAGG - Intronic
914611277 1:149305407-149305429 TGTCTTCCAGCGGTGGTTGAAGG + Intergenic
915365043 1:155310263-155310285 TGGCATTCACCTGTGGCTTATGG + Intronic
916584335 1:166137211-166137233 TGATTTTCAGCAGTGGTTGCTGG + Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917413365 1:174783068-174783090 TAGCATTCAGCAGTGATGAACGG - Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920532917 1:206717511-206717533 TGGCTTGCAGCAGTGGTTTGGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921781278 1:219167755-219167777 TGTCATTGAGCTGTGGTAGAAGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924371587 1:243356668-243356690 CGACAATCAGCAGTGGTTGTAGG - Intronic
1063255160 10:4319762-4319784 TCGAATTCATCAGTGGTTCAGGG - Intergenic
1065960879 10:30732975-30732997 TGGCATTCAGGACTGGTGGCGGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066621800 10:37362966-37362988 TGGCAGTTACCAGTGGTTGTGGG - Intronic
1067570674 10:47368824-47368846 TGGCATTCATCAGTCTTTGGGGG + Exonic
1068547461 10:58365035-58365057 TGGCAGTTAGCTTTGGTTGAGGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069678246 10:70265065-70265087 TGGGACTCAGCAGTGGGTAACGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073979483 10:109138261-109138283 TGGCATTAATATGTGGTTGAGGG - Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075424396 10:122330124-122330146 TAGAATTCAGGACTGGTTGATGG + Intronic
1075470905 10:122688354-122688376 TGGCAATCATCTGTGGGTGAGGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1078501395 11:11882134-11882156 GGGCAATGAGCAGTGATTGATGG - Intronic
1079248632 11:18771560-18771582 TGGGATGCAGAGGTGGTTGAGGG - Intronic
1079649586 11:22910033-22910055 TTTCATTGAGCAGTGGTTCAAGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081483247 11:43507932-43507954 TGGCCTACAGCAGTGGTTCTGGG - Intergenic
1081707999 11:45197048-45197070 TGGGTTTCAGGAATGGTTGAGGG + Intronic
1081708182 11:45198762-45198784 TGGGTTTCAGGAATGGTTGAGGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086248072 11:84779010-84779032 AGGCTTTCATCAGTGGCTGAAGG - Intronic
1086577778 11:88360531-88360553 TGGTCTTCAGTAGAGGTTGAAGG - Intergenic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088278112 11:108110528-108110550 TTTTCTTCAGCAGTGGTTGATGG + Intergenic
1090304049 11:125674995-125675017 AGTCATACAGCAATGGTTGATGG - Intronic
1092953082 12:13525975-13525997 TGGAATTCAGCAGTGGGAAATGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093216503 12:16368114-16368136 TGGCAGTCAGCAGTGCTTAGGGG - Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095350384 12:41203710-41203732 TAGTATTAAGCAATGGTTGAAGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096414579 12:51402240-51402262 TGGGATTCAGCTGTTGTTGAAGG + Intronic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1098771800 12:74561892-74561914 TGGCATTCATCAGTTCTTCAGGG - Intergenic
1098848655 12:75568400-75568422 AGACATTCAGCTGTGGTGGAAGG - Intergenic
1099295690 12:80825337-80825359 TGGGATTCTGCAGTGGCAGAAGG - Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104087772 12:125492329-125492351 TGGCATGCAGCAGTGTTTGGAGG - Intronic
1104485537 12:129148749-129148771 TGGCATGCAGCTGTGGAGGAGGG - Intronic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1105268605 13:18847508-18847530 AGGTATTCAGGAGTGGTTCATGG + Intergenic
1105588250 13:21764676-21764698 TGGAATTCAGCTGTATTTGAAGG + Intergenic
1106319560 13:28624940-28624962 TGGCCATCAGCAGGGATTGAGGG + Intergenic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1108158794 13:47616496-47616518 TGGCATTTAGCAGGTGTGGATGG + Intergenic
1108834219 13:54520869-54520891 TGTCATTCAGCGGTGGGAGAGGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109393506 13:61724305-61724327 TAGCATTCAGCAGTGGGTGTGGG + Intergenic
1109634364 13:65094433-65094455 TGTGATTCAGTAGTTGTTGAGGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111849841 13:93559017-93559039 AAACATTCAGCAGTGGTTGTGGG + Intronic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118451490 14:65906516-65906538 TGCAATTCAGCAGTGATTAAAGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119142733 14:72282513-72282535 TAGCATTAAGCAGGGGTGGACGG - Intronic
1119700752 14:76752975-76752997 TGGCATTCAGCAATGAGAGAAGG - Intergenic
1120128996 14:80782741-80782763 TTCCATTCAACAGAGGTTGATGG - Intronic
1120341435 14:83225694-83225716 TGTCATTCAGCAGTGGTCGACGG - Intergenic
1122995672 14:105262472-105262494 TGGCAGCCAGCAGTGGCTCAGGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1202830700 14_GL000009v2_random:26450-26472 AGGTATTCAGGAGTGGTTCACGG - Intergenic
1126084102 15:44994848-44994870 TTTCATTGAGCAGTGGTTTATGG - Intergenic
1126380934 15:48046201-48046223 TGGCAGTCAGCATTGGTCGGAGG - Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127333385 15:57960295-57960317 AGGCATTCAGTAATGGCTGAGGG + Intronic
1127930889 15:63596781-63596803 TGGCAGGCAGCAGGGCTTGAAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129253118 15:74319483-74319505 GGGCATTCAGCAGGTGGTGAGGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133505194 16:6404918-6404940 TGGAATTCAGCATTGGTAGACGG + Intronic
1133648443 16:7786462-7786484 TGGCTTTCAGCTGTGATTTATGG - Intergenic
1137556089 16:49471273-49471295 TGGCTTGCTGCAGTGGCTGAGGG + Intergenic
1137717593 16:50608252-50608274 AGGCATTGAGCAGGGGTTGGGGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1144072786 17:11689581-11689603 TGGCATCCAGCATTTGATGAGGG - Exonic
1148213349 17:45821143-45821165 TGGCCTCCAGCAGGGGTTGGTGG - Intronic
1148815564 17:50325589-50325611 AGGGATTCAACAGTGGTGGATGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150309124 17:64113259-64113281 TGGCAATATGCAGTGGTTAAGGG - Intronic
1151109937 17:71664274-71664296 GGGTATTCAGCAGGGATTGAAGG - Intergenic
1151202360 17:72477951-72477973 TGGCCTTCAGCTTTGGTTTATGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151661026 17:75518058-75518080 GGGCATGCACCAGTGGATGAAGG + Intronic
1152887371 17:82860335-82860357 TGGCCTTTCGCAGTGGTGGAGGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154419418 18:14212493-14212515 AGGTATTCAGGAGTGGTTCATGG - Intergenic
1155745442 18:29351357-29351379 TGCCATGCAGCAGTGGTTAAAGG - Intergenic
1156026606 18:32662017-32662039 TTGCTTTCAGAAGTGCTTGAAGG + Intergenic
1156523160 18:37739197-37739219 TGGCTTTCAGCAGGGTTGGAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157486314 18:48089967-48089989 TGGGATTCAGAACTGGGTGAAGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1160322337 18:77907857-77907879 TGGGTTTCACCAGTGGTTGTTGG + Intergenic
1162007761 19:7790724-7790746 TGGTTCTCAGCAGTGGTGGATGG - Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1165131758 19:33636956-33636978 GGGCAACCAGCAGTGGTTGGGGG - Intronic
1165428699 19:35759481-35759503 TGGCACTCAGCACTCTTTGAGGG - Intronic
1165690248 19:37857317-37857339 TGGAATGGAGCAGTGGTTGATGG - Intergenic
1167825820 19:51972065-51972087 TGGGATTTTGCAGTGGTAGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1202641995 1_KI270706v1_random:101326-101348 AGGTATTCAGGAGTGGTTCACGG + Intergenic
925249145 2:2415601-2415623 TGGCAGTCAGCACTGGTGAAAGG + Intergenic
927640187 2:24841113-24841135 TGGGACACAGCACTGGTTGATGG - Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928200112 2:29242528-29242550 TGGCTCTCAGATGTGGTTGAGGG - Intronic
928347674 2:30516323-30516345 CGACGTTCAGCAGTGGTGGACGG - Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931470186 2:62531755-62531777 TGGCCTGCTGCAGTGGTTGGTGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
935343868 2:102085390-102085412 TGGTATTAAGCAGTGGCTCAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939235959 2:139493325-139493347 TGGCCTTCTGCAGTGTTTGCAGG - Intergenic
939893436 2:147764236-147764258 TTGCATTCAAAAGGGGTTGATGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
947317430 2:228876550-228876572 GGGGAGTCAGCAGTGGTTGCTGG - Intronic
1171016935 20:21550315-21550337 TGACATTCAGCAGTAGATGATGG + Intergenic
1171179521 20:23082281-23082303 TGACACTCTGGAGTGGTTGAAGG - Exonic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171889103 20:30691516-30691538 AGGTATTCAGGAGTGGTTCACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173748968 20:45461268-45461290 TGGCAAACATCAGTGTTTGAGGG + Intergenic
1174744318 20:53046390-53046412 TGGCATTCAGCATGGGCTGGGGG - Intronic
1175607799 20:60325227-60325249 TTCCATTCAGCTGTGGTTTATGG - Intergenic
1176609888 21:8871288-8871310 AGGTATTCAGGAGTGGTTCACGG - Intergenic
1176853886 21:13946803-13946825 AGGTATTCAGGAGTGGTTCATGG + Intergenic
1177241107 21:18458463-18458485 TGAAATTCAGCAATGGTTGCTGG + Intronic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177676618 21:24308980-24309002 GGCCATTGAGCAGTGGTTGGAGG + Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177971395 21:27794458-27794480 TGGCATTCAGAAGTTATTAAAGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179464224 21:41561100-41561122 CGGCAGTCAGCAGTGGCTCAGGG + Intergenic
1179546765 21:42117734-42117756 GTGCATTCAACAGTTGTTGACGG + Intronic
1180057677 21:45367293-45367315 TGGCAGCCAGCAGTGGGAGAGGG - Intergenic
1180359949 22:11880538-11880560 AGGTATTCAGGAGTGGTTCACGG - Intergenic
1180842229 22:18964766-18964788 TGGCATTGAGCAGAGGGTGGTGG + Intergenic
1180875437 22:19173008-19173030 TGGCACGCAGCAGTGTGTGAGGG + Intergenic
1182247674 22:28972718-28972740 TTGCCATCAGCAGTGTTTGAGGG + Intronic
1183573161 22:38669445-38669467 GGGCATGCAGAAGTGGATGAAGG + Intronic
1185236783 22:49718500-49718522 TGTTATGCAGCAGTGGCTGACGG - Intergenic
949300635 3:2579913-2579935 GGCCATTCTTCAGTGGTTGAAGG + Intronic
949510819 3:4765212-4765234 TGGCATTTGGCAGTGGCTGGAGG + Intronic
950167578 3:10813446-10813468 TGGCATTCAAAAATGGTAGAAGG + Intergenic
950218633 3:11177838-11177860 TGGGATTCACCAATTGTTGATGG + Intronic
950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
952387466 3:32852655-32852677 CTGAATTTAGCAGTGGTTGATGG + Intronic
953282970 3:41576379-41576401 AGGCACTCAGCATTGGGTGAGGG - Intronic
954259756 3:49430105-49430127 TGGAAATCAGCAATGGATGAGGG - Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957895103 3:86411956-86411978 TGGCGTTCAGCAGGGGTGGACGG - Intergenic
959885721 3:111497404-111497426 TGGCGTTCAGCCATGGTGGATGG + Intronic
960002958 3:112752050-112752072 TGCCTTTCATCATTGGTTGAGGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961714243 3:128847800-128847822 TGGCATTCAGCAGAGGATGGAGG - Intergenic
962448011 3:135485732-135485754 TGGGATTCAGCAGTAGTAGAGGG - Intergenic
962544185 3:136415535-136415557 TTGTATTAAGAAGTGGTTGAGGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967694367 3:192514621-192514643 GGGCATTCTGCAGTGTTTGGGGG + Intronic
968135645 3:196217752-196217774 CTGCACTCAGGAGTGGTTGAGGG + Intronic
968264803 3:197354904-197354926 TGGGCTTCAGCTGTGGTTTACGG + Intergenic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
969055118 4:4396839-4396861 TGGCATTCAGCAGTGGGGGTGGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969410405 4:7024462-7024484 TGGAATTCAGCAGAGATTGCCGG + Intronic
969605343 4:8199612-8199634 TGCCAATCCGCAGTGATTGAGGG + Intronic
969907258 4:10408824-10408846 TCAAATTCAGCAGTGGTTGCTGG + Intergenic
969989344 4:11245352-11245374 TGTTATACAGTAGTGGTTGAGGG - Intergenic
970470064 4:16368961-16368983 TTTCATTGAGCAGTGGTTTATGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975980888 4:80157961-80157983 TGGCAGTCAGGAGTGGTGGGAGG - Intergenic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
977081482 4:92534723-92534745 TGGCATTCACCAGTGATGTAAGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979412893 4:120400839-120400861 TGTCATTCAGAAGTGGTTAGTGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
980878755 4:138688067-138688089 AGGCAGTCAGCAGGGGTTTATGG - Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984456500 4:179975936-179975958 TAGCATTGAGCAGAGGCTGAAGG - Intergenic
1202769364 4_GL000008v2_random:187192-187214 AGGTATTCAGGAGTGGTTCACGG + Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
987993082 5:25240599-25240621 TGCCATTCAGCAGTTTTTCAGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990326933 5:54686319-54686341 TTTCATTGAGCAGTGGCTGAAGG + Intergenic
990666030 5:58072665-58072687 TGGCATTTAGCAGCAGTTGTGGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
990905177 5:60795614-60795636 CGGCATTCAGCCCTGGTGGATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992536459 5:77709566-77709588 TGCCATCCAGCAATGTTTGATGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993656719 5:90586733-90586755 TGGGATTCAGCAGTGGGTTCAGG + Intronic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995582417 5:113615829-113615851 TGGCCTTCAGCAGAGGGTCAAGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996793860 5:127322621-127322643 TGGCCTTCACCAGTGTTTGCTGG + Intronic
997022119 5:130014010-130014032 TGGCATTGTGCAGTGCTTTAGGG - Intronic
997044715 5:130300402-130300424 TGGCTCTGAGCAGTGGTTTATGG + Intergenic
997195014 5:131973528-131973550 TGGCATTCATCAGTGTCTCATGG - Intronic
999155308 5:149453607-149453629 TAGCATTCGGCAGTGGCTGTGGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1010103330 6:72137303-72137325 AGCAATTCAGCAGTGTTTGAAGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014663298 6:124200995-124201017 TGGCTGTCAGCAATGGTTGTGGG + Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018111053 6:160537264-160537286 TGGCATTTGGTATTGGTTGATGG - Intronic
1018132623 6:160747228-160747250 TGGCATTTGGTATTGGTTGATGG + Intronic
1018137630 6:160792894-160792916 TGGCATTCAGAAGTGGAAGCTGG - Intergenic
1019779236 7:2929850-2929872 TGGCATTCTGCAGGGGGAGAGGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022643957 7:32213621-32213643 AGGCAAGCAGCAGTGTTTGAGGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024449286 7:49520517-49520539 TTGCATTGATCAGTGTTTGACGG + Intergenic
1025195889 7:56932737-56932759 TGTCTTTCAGCAGTGTTTTATGG + Intergenic
1025676059 7:63644198-63644220 TGTCTTTCAGCAGTGTTTTATGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028700578 7:93774342-93774364 AGGCATTCAGCATTGGTATAAGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032087134 7:128890447-128890469 TGGCAGGCAGCAGTGGGCGATGG + Exonic
1032122547 7:129167728-129167750 GGGCACTCAGCAGTGAGTGATGG - Intronic
1032212067 7:129924879-129924901 GGGAGTTCAGCGGTGGTTGAAGG - Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032743174 7:134759978-134760000 TGGCATTCAGCAGAGATCTAAGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035920201 8:3668223-3668245 TGAGATCCAGCAGTGGTGGACGG - Intronic
1036310815 8:7683078-7683100 TGGCTCTCAGCAGTGGGTGGGGG - Intergenic
1036766273 8:11551162-11551184 TGTCACTCAGCAGTGTTTGTGGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041828779 8:62128692-62128714 TGGTATGCAGCAGTGTTTGGGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043175417 8:77018670-77018692 TGGCATACAGGAGAGGATGATGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046647544 8:116802598-116802620 TGGGATTCAGCAGGGCTTCAGGG + Intronic
1048011024 8:130456461-130456483 TGGCACTCATCAGTGGCTCATGG - Intergenic
1049514247 8:143045019-143045041 TGGCATTGGGCAGTGGCTGCTGG - Intronic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055609407 9:78005743-78005765 AGGCCTTCAGCAGTTGATGATGG + Intronic
1057955156 9:99401410-99401432 AGGAATTCATCTGTGGTTGAAGG - Intergenic
1059287723 9:113190488-113190510 TGGAATCCAGCTGTGGTGGAAGG + Exonic
1059534720 9:115070063-115070085 TGGGATTCAGCAGTGGATGATGG + Intronic
1062137958 9:134939586-134939608 ATTCATTCAGCAGTGGTTGTGGG - Intergenic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186328010 X:8500987-8501009 TGGCCTCCAGCAATGGCTGAAGG - Intergenic
1187060525 X:15782559-15782581 TGCGATTCATCAGTGGCTGAAGG - Exonic
1187216501 X:17282219-17282241 TCCCATTCATCATTGGTTGAAGG - Intergenic
1187263242 X:17706797-17706819 TTCCATTCAGCAGCGGGTGAGGG - Intronic
1187319636 X:18228017-18228039 TGGCAATCAGCATGGGCTGATGG - Intergenic
1189584786 X:42447801-42447823 TTTCATTGAGCAGTGGTTTAGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191189214 X:57648747-57648769 TGGCTTACAGCAGTTGTTTATGG - Intergenic
1191963429 X:66728882-66728904 TGGAATTCAGCAGAGGTCGCTGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196045173 X:111249256-111249278 TGTCATTCAGCATGTGTTGAAGG + Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196595937 X:117545585-117545607 TGAGATTCATCAGTGGTTGAAGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197838710 X:130722602-130722624 TGGCATTCTGTTGTGCTTGAAGG - Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198862326 X:141084345-141084367 CGGCGTTCAGCGGTGGTGGACGG - Intergenic
1198900368 X:141503041-141503063 CGGCGTTCAGCGGTGGTGGACGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199375901 X:147109331-147109353 TGTCAGTCAGCAGGGGTTGGGGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200249675 X:154546299-154546321 GGGCATTGGGGAGTGGTTGATGG + Intronic
1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201434013 Y:13937060-13937082 TGGCCTCCAGCAATGGCTGAAGG + Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic
1202195413 Y:22295280-22295302 TGGCATGCAGGAATGGTAGAGGG - Intergenic