ID: 1095287866

View in Genome Browser
Species Human (GRCh38)
Location 12:40437588-40437610
Sequence GCTAAATACCAAACTCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095287864_1095287866 16 Left 1095287864 12:40437549-40437571 CCAGTCTAAAACAAGTTAATGGT 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1095287866 12:40437588-40437610 GCTAAATACCAAACTCCTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095287866 Original CRISPR GCTAAATACCAAACTCCTTA AGG Intronic
904715216 1:32462834-32462856 GAAAAAATCCAAACTCCTTAAGG + Intergenic
904929583 1:34075889-34075911 GCTAATTTCCAAACTCCTACAGG + Intronic
907336104 1:53700582-53700604 GCAAAAAACCAAACTCCTGCAGG - Intronic
909682179 1:78303956-78303978 AGTAAGTACCAAACTCCTTTTGG - Intronic
910905562 1:92174013-92174035 GCTTAGTACCAAAATACTTAAGG + Intronic
911229860 1:95349425-95349447 GTTAGAAACCAAACTACTTAAGG - Intergenic
913129081 1:115822247-115822269 GCTAAATACTAAACTATTTATGG + Intergenic
913277587 1:117154148-117154170 GCTAGAGAACAGACTCCTTAAGG - Intronic
916365678 1:164024863-164024885 TCTAGCTAGCAAACTCCTTAGGG - Intergenic
917514303 1:175694569-175694591 AATAAATACCAAAATCCTTATGG + Intronic
921557685 1:216618615-216618637 GCTAAATATCAAAATTGTTAAGG - Intronic
923200958 1:231710925-231710947 GCTAAATACTAAACACATTCAGG + Intronic
924365322 1:243286849-243286871 GCTAAACACCAGCCTTCTTAGGG - Intronic
1065735225 10:28745371-28745393 CCTAACTTCCAAACTCCTTGGGG - Intergenic
1065856852 10:29838304-29838326 GCTAAAAAGTAAACTCCTTGAGG - Intergenic
1070510002 10:77152470-77152492 GCTTGATAACAAACTCTTTATGG - Intronic
1071246796 10:83773719-83773741 GATAAAAACCATACTTCTTAGGG - Intergenic
1072437804 10:95429646-95429668 GCTAATTTCCAAACTTCCTAAGG + Intronic
1072817857 10:98527324-98527346 ACTAAAAATCAAGCTCCTTATGG + Intronic
1081276427 11:41155197-41155219 GCTTAATTCCAACATCCTTATGG + Intronic
1082020211 11:47526454-47526476 GATTAATACCACACTGCTTATGG + Intronic
1082776749 11:57251155-57251177 GATAAATGCAAAACTCCTCAAGG - Intergenic
1086317121 11:85607156-85607178 GCTAAATACCAGACACCTATTGG + Intronic
1087279522 11:96194691-96194713 ACTAAATACAAAATTCCTTGGGG + Intronic
1088300845 11:108356746-108356768 GTTTAATGCCAAACTGCTTATGG + Intronic
1088329249 11:108633399-108633421 CCTATAGACCAAACTCCTTGTGG + Intergenic
1089003632 11:115072793-115072815 GCTAAATGCCAAATTCCCAAGGG + Intergenic
1089989101 11:122841783-122841805 GATAGATTACAAACTCCTTATGG - Intronic
1093121335 12:15275033-15275055 AATAAAAACCAAACTCCTAAGGG - Intronic
1093432596 12:19100941-19100963 GTTAAAGACCAAAATCATTAAGG + Intergenic
1093548572 12:20377845-20377867 GTTACATACCAAACTCCTAAAGG - Intronic
1095287866 12:40437588-40437610 GCTAAATACCAAACTCCTTAAGG + Intronic
1096751947 12:53765398-53765420 TCTAAAAAAAAAACTCCTTAGGG - Intergenic
1097940593 12:65300527-65300549 ACTACATTCCAAACTCCTCAAGG - Intronic
1100913480 12:99391297-99391319 GATAAATACCAAAATCCTGAAGG + Intronic
1101405899 12:104428511-104428533 GTTAAATACCATACTACATATGG - Intergenic
1101474309 12:105029450-105029472 GTTAGATAATAAACTCCTTAAGG + Intronic
1108527220 13:51295986-51296008 GCTATATCCTAAACTCCTTAGGG - Intergenic
1115154339 14:30321102-30321124 AGTAAATACCAAATTCATTACGG + Intergenic
1118644194 14:67820997-67821019 GATAAATTCCAAACTTCTTAGGG - Intronic
1120798815 14:88666769-88666791 ACAAGATACCAAAATCCTTAGGG - Intronic
1121811403 14:96894279-96894301 GATAAAATCCAAACTCCTTTCGG - Intronic
1143805769 17:9424861-9424883 ACTAAATTTCAAACTCCTTAAGG - Intronic
1144087207 17:11821570-11821592 GCTAAATATTAAACTCCTGGAGG + Intronic
1149287207 17:55177852-55177874 AGTAAATACCAAACACCTTTTGG + Intergenic
1149872917 17:60199530-60199552 AATAAATACCAAACTTCTTAGGG - Intronic
1150802350 17:68291844-68291866 GCTAAATCCCTAAATCCTCAGGG - Intronic
1154932771 18:21017527-21017549 GCTAAATTACAAGCTCCTTGTGG + Intronic
1156220543 18:35046832-35046854 GCTAAGTACCAGTCTCATTATGG - Intronic
1157946544 18:51987155-51987177 GCTAGATACTAAACTTCTTGAGG - Intergenic
1159087235 18:63807672-63807694 GCTAGCTAACAAACTCTTTAAGG + Intergenic
1159124083 18:64202776-64202798 GCTAAAAACCAAACCTCTGAAGG - Intergenic
1159251151 18:65878579-65878601 GGTGAATACCAGACTACTTATGG + Intronic
1160382536 18:78471582-78471604 ACTAGATTCCAAACTCCTTGAGG + Intergenic
1160545832 18:79654249-79654271 GCTAACTACAAATCTACTTATGG + Intergenic
1162497038 19:11029155-11029177 GCTGAAAACCAAAATCCTTCAGG + Intronic
928942305 2:36738827-36738849 GAAAAATTCCAAAATCCTTAAGG - Intronic
929245951 2:39703815-39703837 CCTAAACACAAAACTCCTTAAGG - Intronic
932515067 2:72337824-72337846 CATAGATAGCAAACTCCTTAGGG + Intronic
935568791 2:104637175-104637197 GGCACAGACCAAACTCCTTAGGG - Intergenic
940630811 2:156236155-156236177 ACTTAATACCAAAGTCATTAAGG + Intergenic
941498890 2:166243726-166243748 GATATAAGCCAAACTCCTTAAGG - Intronic
944563860 2:200967956-200967978 ACTAAATTCTAAATTCCTTAAGG - Intergenic
946035963 2:216742465-216742487 CCTAAATACCACTCTCCTTCAGG - Intergenic
947044219 2:225960588-225960610 GCTAAATATCAAACCCTTTAGGG + Intergenic
947683345 2:232057130-232057152 GCCAAACACAAAACTGCTTATGG + Intronic
1169172012 20:3472316-3472338 GCTATATTCCAAACTCCCTGTGG - Intronic
1170436190 20:16331761-16331783 GCTAAAGACCTAACTCTTTCAGG - Intronic
1172094650 20:32454740-32454762 GCTAGATGCCAACCTCCTTGAGG - Intronic
1174118582 20:48245280-48245302 GCTAAATAGCACAGTCATTAAGG + Intergenic
1174882905 20:54300376-54300398 GATAAATTCCAGAATCCTTATGG - Intergenic
1177848738 21:26321710-26321732 GGTAAATACCAAAGACCTTAAGG - Intergenic
949845183 3:8362468-8362490 GCTAAATTTCAGCCTCCTTAAGG - Intergenic
950661596 3:14469987-14470009 TCTAATTGCCAAACTCCCTAAGG - Intronic
952182191 3:30929087-30929109 ACTAAATATCAAACTCCCTAAGG + Intergenic
953215677 3:40915504-40915526 GCTAAGTAGCAAACTCGTCATGG - Intergenic
955063952 3:55518552-55518574 GCAAAATGCCAAACTCCTAGAGG - Intronic
955349792 3:58184918-58184940 GCTAAATTCGAAGCTCCTTCCGG + Intergenic
955527060 3:59831988-59832010 GTTAACTACCCAGCTCCTTAGGG - Intronic
956526536 3:70169026-70169048 GCTAGATACAGAACTCCTTCTGG - Intergenic
956846047 3:73183773-73183795 GATAATTACCAAAGTCCTAAAGG - Intergenic
958699959 3:97576110-97576132 TCAAAATCCCAAATTCCTTAGGG - Intronic
959055927 3:101567736-101567758 GGTAAAAACCAAAGTTCTTACGG - Intergenic
960014659 3:112872822-112872844 ACAAGATCCCAAACTCCTTAGGG - Intergenic
960706512 3:120487438-120487460 GCTAAATTCAATATTCCTTATGG + Intergenic
965552974 3:169988385-169988407 GCTCAATACCAACCTTCTTGAGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967346589 3:188463678-188463700 ACTAAATATCATACTGCTTATGG - Intronic
968009921 3:195267625-195267647 GCTAGACTCTAAACTCCTTAAGG - Intronic
969835831 4:9840586-9840608 GCTAAATACCAAAATACAAATGG - Intronic
971578197 4:28303652-28303674 GCTAAATACCAAGCACCTGCCGG + Intergenic
972643157 4:40943560-40943582 TCTCCATACCAAACTCCTTGAGG + Intronic
974227335 4:59063867-59063889 GCTCAATACCATAATCCTTTAGG - Intergenic
975637104 4:76461415-76461437 TCTAATTTCCAAACTCTTTATGG - Intronic
975928154 4:79484938-79484960 GATAAATATCAAAATACTTAAGG - Intergenic
975931698 4:79532058-79532080 ACTAAATTTCAAACTCCATAAGG - Intergenic
977477666 4:97533336-97533358 CTGAAATATCAAACTCCTTATGG + Intronic
982857723 4:160406555-160406577 GCTAAATACAAGACACCTGAGGG - Intergenic
984933714 4:184871323-184871345 GTTAAAGACCAAACACCTTTTGG + Intergenic
987319760 5:16757555-16757577 TTGAAATAGCAAACTCCTTAAGG - Intronic
991496508 5:67231940-67231962 GCTACTTACCAAACTTCCTAGGG + Intergenic
991584719 5:68190234-68190256 GCCATATACCAAACTTTTTAAGG - Intronic
992896081 5:81246226-81246248 GATAAAATCCAGACTCCTTAGGG + Intronic
993136524 5:83973449-83973471 ACTAAATAACAAACTCTTTCAGG - Intronic
994435333 5:99722868-99722890 GCAGAATGCCAAACTCATTAAGG - Intergenic
995046480 5:107654313-107654335 GGCAAATACAAAAATCCTTATGG - Intronic
996352389 5:122559702-122559724 GCTAACTTCCAAACTCTGTAAGG - Intergenic
996805103 5:127445952-127445974 GCTGGATACAAAGCTCCTTATGG - Intronic
1000559596 5:162769269-162769291 GCTAAACACTAAACTCCCTGTGG - Intergenic
1002909947 6:1482226-1482248 GCTAAATCCCAAAAGCCTTTGGG + Intergenic
1008355976 6:50553729-50553751 GGTAATTACCAAACTCCATAAGG + Intergenic
1008783671 6:55139542-55139564 GATAAATTCCAAAATCTTTAAGG + Intronic
1009884199 6:69604801-69604823 GCTACTGAACAAACTCCTTAAGG + Intergenic
1009995199 6:70889001-70889023 GCTAGATACAAAACTCCTTGAGG + Intronic
1012210721 6:96515699-96515721 GCAAAATACAAAATTCCTTCTGG + Intergenic
1012696231 6:102387850-102387872 TCCAAATACTAAATTCCTTAAGG + Intergenic
1014824969 6:126039406-126039428 GAAAGATTCCAAACTCCTTAAGG + Intergenic
1016659640 6:146562815-146562837 GATACATACCAAATTCCTGATGG + Intergenic
1020530909 7:9333708-9333730 GCAAAATATCAATCTACTTAGGG + Intergenic
1020968163 7:14899462-14899484 ACTAAATAACAAACTCTTTGGGG - Intronic
1021049979 7:15971240-15971262 CCTAAAAACTAAACTCCTGAAGG + Intergenic
1027549186 7:79569170-79569192 AATAAATACCACACTACTTATGG + Intergenic
1028276332 7:88862329-88862351 GCTAAATGGCGAGCTCCTTAAGG - Intronic
1029236962 7:99128446-99128468 TCTAAATACCAGGCTCCTAAGGG + Intronic
1029799620 7:102932982-102933004 GCTAGAAAGTAAACTCCTTAAGG - Intronic
1030849722 7:114468419-114468441 GATAAAATCCAAACTACTTAAGG + Intronic
1043176969 8:77033758-77033780 ACCTAATACCAAACTCCTGAAGG + Intergenic
1043939619 8:86182256-86182278 GATAATAATCAAACTCCTTATGG + Intergenic
1044186944 8:89264661-89264683 CCTAGATAGCAACCTCCTTAGGG + Intergenic
1046086349 8:109440799-109440821 GCTGAATCCAAAACCCCTTATGG - Exonic
1046180547 8:110640875-110640897 CCTAAACACCAAACTGCCTATGG + Intergenic
1049065661 8:140311766-140311788 GATAAATTACAAACTCCTGAGGG - Intronic
1055310844 9:74977991-74978013 CTGAAATACCAAAATCCTTAAGG - Intergenic
1055524028 9:77111737-77111759 GCTAAATAACACTCTCCTCAGGG - Intergenic
1057488443 9:95505040-95505062 ATTAATTACCAAACTACTTAAGG + Intronic
1059313246 9:113402774-113402796 GCTAATAACCACACTCCATAGGG + Intergenic
1059655610 9:116354863-116354885 GATAAAGTCCCAACTCCTTAGGG + Intronic
1060581475 9:124750916-124750938 CCTAAATACTAGACTCCTTAAGG + Intronic
1186778078 X:12885565-12885587 CCTAATTTCCAAACTCCTTGGGG + Exonic
1190523157 X:51300097-51300119 AGTAAATACCTAACTCCTCAAGG + Intergenic
1192921505 X:75712117-75712139 ACTTAATACCAAACTTCTTGGGG + Intergenic
1193541524 X:82778624-82778646 ACTAAACAGTAAACTCCTTATGG - Intergenic
1194298163 X:92153386-92153408 GCTAAATACAAAACTCAGTGCGG - Intronic
1196566977 X:117219378-117219400 GATATATACCAAACTCATGATGG + Intergenic
1199246639 X:145612752-145612774 GCTAGATTCTAAATTCCTTAAGG + Intergenic
1200615771 Y:5378347-5378369 GCTAAATACAAAACTCAGTGCGG - Intronic
1201402401 Y:13617530-13617552 GCTAACTACCAAACTGGTTTGGG - Intergenic
1201868261 Y:18678435-18678457 GCTGCATAGCAAATTCCTTAAGG - Intergenic
1202062510 Y:20902553-20902575 GCCTAACACAAAACTCCTTAAGG - Intergenic