ID: 1095291243

View in Genome Browser
Species Human (GRCh38)
Location 12:40482625-40482647
Sequence GGGACTACTGGACCAACAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 12, 3: 42, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095291243 Original CRISPR GGGACTACTGGACCAACAGC TGG Exonic
900427932 1:2588938-2588960 GGGACTTCTGGACGAAATGCAGG - Exonic
904167554 1:28567706-28567728 GGGACTACTGGGCAAAGAACAGG - Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905268656 1:36772156-36772178 GTGACTGCTGGACTCACAGCTGG + Intergenic
905743326 1:40391405-40391427 GGGACTGCTGCGCTAACAGCTGG - Intronic
907258319 1:53196983-53197005 GGGGCTCCCGGACCAACCGCGGG - Exonic
914944329 1:152050739-152050761 GGGACTACTGGAGTCAGAGCTGG + Intergenic
916681909 1:167112646-167112668 GAGAACACTGGACCTACAGCAGG + Intronic
917027426 1:170659531-170659553 GGAACTACAGGGGCAACAGCAGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
1066243888 10:33563356-33563378 GGGTCTACTGAACCAATAGATGG + Intergenic
1073065811 10:100758634-100758656 GTGAGAACTGGACAAACAGCCGG + Intronic
1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG + Intronic
1075443988 10:122501099-122501121 GGGACTGCAGGTCCCACAGCAGG - Intronic
1076751764 10:132546849-132546871 GTGCCTACAGGACCAAAAGCAGG - Intronic
1078946187 11:16071048-16071070 GGGACCACTGGGCCAGAAGCTGG - Intronic
1083938356 11:65882085-65882107 GGAATTATGGGACCAACAGCTGG + Intronic
1088286909 11:108199287-108199309 GGCACAACTGGACCAGCTGCGGG + Intronic
1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG + Intergenic
1094286146 12:28796062-28796084 GGAACTACTGGATTAAAAGCAGG + Intergenic
1095289830 12:40465138-40465160 GGAACTACTGGACCCTCAGTGGG + Exonic
1095291023 12:40480471-40480493 GGGGCAACTGGACCATCAGCTGG + Exonic
1095291088 12:40481128-40481150 GGAACAACTGGACTATCAGCTGG + Exonic
1095291093 12:40481188-40481210 GGGACAACTGGAGCACCAGCTGG + Exonic
1095291131 12:40481575-40481597 CAGACAACTGGACCATCAGCTGG + Exonic
1095291156 12:40481782-40481804 GAGACAACTGTACCATCAGCTGG + Exonic
1095291233 12:40482535-40482557 GGGACCACTAGACCATCATCTGG + Exonic
1095291243 12:40482625-40482647 GGGACTACTGGACCAACAGCTGG + Exonic
1095291257 12:40482718-40482740 GGGACAACTGGATCATCACCTGG + Exonic
1095291268 12:40482835-40482857 AGGACAACTAGACCATCAGCTGG + Exonic
1095291275 12:40482895-40482917 GGGACAACTGGACCATTAGCTGG + Exonic
1095291280 12:40482925-40482947 GGGACAACTGGACCATCAGCTGG + Exonic
1095291288 12:40482985-40483007 GGGACAACTGGACTATCACCTGG + Exonic
1095291304 12:40483105-40483127 GGGACAACTAGACTATCAGCTGG + Exonic
1095291308 12:40483135-40483157 GGGACAACTGGACCATCACCTGG + Exonic
1095291313 12:40483165-40483187 GGTACAACTGGAACACCAGCTGG + Exonic
1095291319 12:40483195-40483217 GGGACAACTGAACTATCAGCTGG + Exonic
1095291334 12:40483315-40483337 GGGACAAGTGGACAATCAGCTGG + Exonic
1095291340 12:40483375-40483397 GGGACAACTAGACCATCAGCTGG + Exonic
1095291352 12:40483465-40483487 GGGACAACTGGACCATCAGCTGG + Exonic
1095291357 12:40483495-40483517 GAGACAACTGGATCATCAGCTGG + Exonic
1095291365 12:40483555-40483577 GGGATAACTGGACTATCAGCTGG + Exonic
1095291372 12:40483615-40483637 GGGACAACTGGACCATCAGCTGG + Exonic
1095291379 12:40483645-40483667 GGGACAACTGGACTATCAGTTGG + Exonic
1095291391 12:40483792-40483814 AGGACAACTAGACCATCAGCTGG + Exonic
1095291399 12:40483852-40483874 GGGACAACTGAACCATTAGCTGG + Exonic
1095291413 12:40483912-40483934 GGGACAACTGGACTATCAGCTGG + Exonic
1095291431 12:40484032-40484054 GGGAAAACTGGACTATCAGCTGG + Exonic
1095291436 12:40484062-40484084 GGGACAACTGGACTATCACCTGG + Exonic
1095291456 12:40484182-40484204 GGGACAACTGGATCACTAGCTGG + Exonic
1095291462 12:40484212-40484234 GGGACAATTGGACTATCAGCTGG + Exonic
1095291468 12:40484242-40484264 GGGACAACTGGATCATCAGCTGG + Exonic
1095291474 12:40484272-40484294 GGGACAACTGGACTATCAGCTGG + Exonic
1095291486 12:40484332-40484354 GGGATAACTGGACCATCAGCTGG + Exonic
1095291501 12:40484452-40484474 GGGACAACTGGACTATCTGCTGG + Exonic
1095291515 12:40484542-40484564 GGGATAACTGGACTATCAGCTGG + Exonic
1095291519 12:40484572-40484594 GGGACAACTGGACCATCAGCTGG + Exonic
1095291539 12:40484722-40484744 GGGATAACTGGACTATCAGCTGG + Exonic
1095291549 12:40484809-40484831 GGGACAACTGGACTATCAGTTGG + Exonic
1095291559 12:40484869-40484891 GGGATAACTGGACCATCAGCTGG + Exonic
1095291590 12:40485079-40485101 GGGACAACTGGATCATCAACTGG + Exonic
1095291602 12:40485169-40485191 GGAACAACTGGACCATCAGCTGG + Exonic
1095291608 12:40485199-40485221 AGGACTACTGGACTATCAGCTGG + Exonic
1095291622 12:40485346-40485368 AGGACAACTAGACCATCAGCTGG + Exonic
1095291636 12:40485434-40485456 GGGACAACTGGACTATCAGCTGG + Exonic
1095291645 12:40485494-40485516 GGGACAACTGGACTATCAGCTGG + Exonic
1095291657 12:40485584-40485606 GAGACAACTGGACCATCAGCTGG + Exonic
1095291677 12:40485704-40485726 GGGACAATTGGATCACCAGCTGG + Exonic
1095291689 12:40485794-40485816 GGGACAACTGGACTATCAGCTGG + Exonic
1095291698 12:40485854-40485876 AGGACAACTGGACTATCAGCTGG + Exonic
1095291704 12:40485884-40485906 GGGACAATTGGACTATCAGCTGG + Exonic
1095291709 12:40485914-40485936 GGGACAACCAGACCATCAGCTGG + Exonic
1095291717 12:40485974-40485996 GGGACAACTGAACCATCAGCTGG + Exonic
1095291728 12:40486034-40486056 GGGGCAACTGGACCATTAGCTGG + Exonic
1095291741 12:40486124-40486146 GGGACAACTGTACTATCAGCTGG + Exonic
1095291767 12:40486361-40486383 GGGACAACTGGAATATCAGCTGG + Exonic
1095291773 12:40486391-40486413 GGGACAACTGGACTGTCAGCTGG + Exonic
1095291805 12:40486601-40486623 GGGACAACTGGACCATCAGGTGG + Exonic
1095291855 12:40486931-40486953 GGGACAACTGGACCATCAGCTGG + Exonic
1095291860 12:40486961-40486983 GGGACAACTGGACTATCAGCTGG + Exonic
1095291875 12:40487051-40487073 GGGACAACTGGACTATCAGCAGG + Exonic
1095291879 12:40487081-40487103 GGGACAACTGGACCATCAGCTGG + Exonic
1095291886 12:40487141-40487163 GGGACAACTGGACCATTAGCTGG + Exonic
1095291891 12:40487171-40487193 GGGACAATTGGACTATCAGCTGG + Exonic
1095291901 12:40487231-40487253 GAGAGTACTGGACTATCAGCTGG + Exonic
1095291924 12:40487381-40487403 GGGACAACTGGACCATCAGGTGG + Exonic
1095291956 12:40487591-40487613 GGGACAACTGGACTATCAGCTGG + Exonic
1095291966 12:40487681-40487703 GAGACAACCGGACCATCAGCTGG + Exonic
1095291972 12:40487711-40487733 GGGACAACAGGACTATCAGCTGG + Exonic
1095291978 12:40487741-40487763 GGGACAACTGGACCATCAGCTGG + Exonic
1095291991 12:40487831-40487853 GAGAGTACTGGACTATCAGCTGG + Exonic
1095292014 12:40488011-40488033 GGGACAACTGGGCTATCAGCTGG + Exonic
1095292024 12:40488071-40488093 GGGACAACTGGACTATCAGCTGG + Exonic
1095292030 12:40488131-40488153 GGGACAGCTGGACCATTAGCTGG + Exonic
1095292035 12:40488161-40488183 GGGACAACTGGACTATCAGCTGG + Exonic
1095292041 12:40488191-40488213 GGGACAACTGGACTATCAGCTGG + Exonic
1095292045 12:40488221-40488243 GAGACAACTGGACAATCAGCTGG + Exonic
1095292078 12:40488401-40488423 GGGACAACTGGACCATCGGGTGG + Exonic
1095292109 12:40488611-40488633 GGGACAACTGGACTATCAGCTGG + Exonic
1095292122 12:40488671-40488693 GGGACAATTGGATCATCAGCTGG + Exonic
1095292129 12:40488731-40488753 GGGACAACTGGACCATCAGCTGG + Exonic
1095292134 12:40488761-40488783 GGGACAACTGGACTATCAGCTGG + Exonic
1095292140 12:40488791-40488813 GGGACAACTGGACTATCAGCTGG + Exonic
1095292147 12:40488851-40488873 GAGACAACTGGACTATCAGCAGG + Exonic
1095292151 12:40488881-40488903 GGGACAACTGGACCATCAGCTGG + Exonic
1095292158 12:40488941-40488963 GGGACAACTGGACTATCAGCTGG + Exonic
1095292166 12:40489001-40489023 GAGAGTACTGGACTATCAGCTGG + Exonic
1095292207 12:40489361-40489383 GGGACAACTGGATCATCAGCTGG + Exonic
1095292212 12:40489391-40489413 GGCACAACTGGACCATCAGCTGG + Exonic
1095292229 12:40489481-40489503 GGGACAATTGGATCACCAGCTGG + Exonic
1095292242 12:40489571-40489593 GGGACAACTGGACTATCAACTGG + Exonic
1095292251 12:40489631-40489653 GGGATAACTAGACCATCAGCTGG + Exonic
1095292275 12:40489811-40489833 GGGACAATTGGATCATCAGCTGG + Exonic
1095292283 12:40489871-40489893 GGGACAACTGGACCATCAGCTGG + Exonic
1095292295 12:40489961-40489983 GGGACAACTGGACCATCAGCTGG + Exonic
1095292300 12:40489991-40490013 GGGACAACTGGACTATCAGCTGG + Exonic
1095292312 12:40490051-40490073 GGGATAACTGGACCATCAGCTGG + Exonic
1095292328 12:40490171-40490193 GGGACAACTGGACTATCAGCTGG + Exonic
1095292346 12:40490291-40490313 GGGAAAACTGGACCATCAGCTGG + Exonic
1095292351 12:40490321-40490343 GGGACAACTGGACTATCAGCTGG + Exonic
1095292355 12:40490351-40490373 GGGACAACTGGACTATCTGCTGG + Exonic
1095292363 12:40490411-40490433 GGGACTATTGGATCATCAGCTGG + Exonic
1095292379 12:40490531-40490553 GGGATAACTGGACTATCAGCAGG + Exonic
1095292388 12:40490648-40490670 ACGACAACTGGACCATCAGCTGG + Exonic
1095292400 12:40490738-40490760 GGGACAATTGGATCATCAGCTGG + Exonic
1095292405 12:40490798-40490820 GTGACAACTGGACTATCAGCTGG + Exonic
1095292435 12:40491008-40491030 GGGAAAACTGGACTATCAGCTGG + Exonic
1095292443 12:40491068-40491090 GGGACAACTGGATTATCAGCTGG + Exonic
1095292468 12:40491275-40491297 AGGACAACTAGACCATCAGCTGG + Exonic
1104017855 12:124972390-124972412 GGGAGTGCTGGATCAACAGGTGG + Intronic
1109638351 13:65153033-65153055 GGGACTATTGACCAAACAGCAGG + Intergenic
1110693970 13:78465252-78465274 GGGACTACTGGAAGAAAAGGAGG + Intergenic
1116948338 14:50856759-50856781 GGGAACACTGGAATAACAGCAGG - Intergenic
1119683593 14:76612143-76612165 TGAACTAATGAACCAACAGCAGG - Intergenic
1124357122 15:29003992-29004014 GGGGCTCCAGGACCAAAAGCTGG + Intronic
1129800006 15:78406365-78406387 GGGATGACTGGACTACCAGCTGG + Intergenic
1130537491 15:84797806-84797828 GGGAGTACTGGACCCAGAGGTGG - Intronic
1134440802 16:14298638-14298660 GGGGCTTCCGGACCAAGAGCGGG + Intergenic
1136548622 16:30969544-30969566 GGGACAACTGGTCCTACACCAGG - Intronic
1138558623 16:57787202-57787224 TGGACTCCTGGCCCAAGAGCTGG + Intronic
1141652843 16:85402777-85402799 GGGACTACAGGAGCCACACCCGG - Intergenic
1144873870 17:18386641-18386663 GGGGCTACTTCACCCACAGCCGG - Intronic
1147220189 17:38924112-38924134 GGGCCTTCCGGACCAACAGGGGG + Intergenic
1152218252 17:79046907-79046929 GGGCCCACAGGACCAAGAGCAGG + Intronic
1157865692 18:51182299-51182321 GGGACTACTGTACAAACAGCAGG + Intronic
1160446625 18:78932885-78932907 GGGATTACTTGAGCAACAACAGG + Intergenic
1167266625 19:48485965-48485987 GGGAGCACTGGAGGAACAGCAGG - Intronic
926646131 2:15291655-15291677 GGGACTAAAGGAGAAACAGCTGG + Intronic
927846070 2:26473534-26473556 GGGCCTACGGGACCTAAAGCGGG - Exonic
936644137 2:114349237-114349259 GGGCCTACTTGAGCCACAGCTGG + Intergenic
940853241 2:158707797-158707819 GTGACTTCTAGACCAACTGCTGG + Intergenic
944984637 2:205161542-205161564 TGGATTACTGGAACAACAGTAGG - Intronic
948743202 2:240062284-240062306 GGGTCTTCTGGCCCAACAACTGG - Intergenic
1170445478 20:16423023-16423045 TGGAGTACTGGAACAACAGGAGG + Intronic
1173593608 20:44244555-44244577 GGCACTCCTGGTCCAACTGCTGG + Intergenic
1174274708 20:49395453-49395475 GGGAATGCTGGGCCAAGAGCTGG + Intronic
1175264246 20:57692930-57692952 GGGACACCTTGACCCACAGCAGG - Intronic
1177239964 21:18443687-18443709 GGGACTATTGGGCCAGTAGCTGG - Intronic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1180999149 22:19979899-19979921 GGCACTGCTGGACCACCCGCGGG - Exonic
1181082068 22:20422792-20422814 GGGACCACAGGACCCACATCTGG - Intergenic
1181179284 22:21055657-21055679 GGGACCACTGTGCCCACAGCAGG + Intronic
1182792874 22:32967642-32967664 GGGACTTCTGAACTCACAGCAGG - Intronic
1183653753 22:39173512-39173534 GGAACCACTGGGCTAACAGCAGG + Intergenic
949594895 3:5532876-5532898 GGGACCACTGGGTCAAAAGCTGG + Intergenic
950087445 3:10270330-10270352 GGGGCTGCTGGTCCAATAGCTGG - Exonic
950910626 3:16586366-16586388 GGGAGTACTAGAACTACAGCTGG + Intergenic
951708770 3:25569046-25569068 TGGAACACTGGACCCACAGCAGG - Intronic
963146638 3:142001298-142001320 GGGCCTACTGGAGCCACACCTGG + Intronic
963655361 3:148042043-148042065 GGGACTACTGTACCACAAACTGG + Intergenic
968706987 4:2083727-2083749 GGGACCACAGGAACACCAGCAGG + Intronic
969458162 4:7312872-7312894 GGGACTTCTAGACCAGCAGAAGG + Intronic
972635038 4:40876811-40876833 GGGCCGACTGTATCAACAGCTGG + Intronic
977394636 4:96455219-96455241 GGGACCACTGGGCCAGAAGCTGG + Intergenic
980413067 4:132447714-132447736 GGCACTCCTGGACCAACCTCGGG + Intergenic
983971672 4:173882961-173882983 GGGACTACAGGAACAAAAGTAGG + Intergenic
993727789 5:91388370-91388392 GGGACTACTGGAGCAGGAGTAGG - Intergenic
995705732 5:114987496-114987518 GGGACTACTGTGCAATCAGCTGG + Intergenic
996142491 5:119929238-119929260 GGGACTGCTGGGCCAGAAGCTGG + Intergenic
999101669 5:149030422-149030444 CCCACCACTGGACCAACAGCTGG + Intronic
1002564269 5:180101078-180101100 GGAACTTCTGGAGCCACAGCAGG - Exonic
1005933479 6:30500673-30500695 GGCACTACTGCAAGAACAGCAGG + Intergenic
1010198386 6:73262426-73262448 GAAACTACTGGTCCAACAGCAGG + Intronic
1015734568 6:136384850-136384872 GGGTCTACTATACCAACAGCAGG - Intronic
1017931498 6:158959388-158959410 GGGACTACTTGAGCCACAGCTGG + Intergenic
1023834178 7:44058808-44058830 GGGGCTACTGGGCCGACAGCTGG + Intronic
1024840603 7:53582827-53582849 GTGACTACTTGACCAAAAGAGGG + Intergenic
1029379731 7:100205174-100205196 GGGGCTACTGGGCCCTCAGCAGG - Intronic
1030231533 7:107213001-107213023 GGGAATACTGGAGTAACTGCAGG + Intronic
1030533256 7:110736085-110736107 GGGCCTACTTGAGCCACAGCTGG - Intronic
1037594829 8:20346249-20346271 GTGACCACTGTACCAACAACTGG + Intergenic
1042648245 8:71010918-71010940 GGGACTGCTGAAAAAACAGCAGG + Intergenic
1049737022 8:144214022-144214044 GGCACTGCAGGACCAACATCAGG - Intronic
1057118872 9:92552366-92552388 GGGACTGCTGGATCAACTGGTGG + Intronic
1059504279 9:114783659-114783681 TGGACAACTGGACAAACATCAGG + Intergenic
1060842738 9:126806238-126806260 GGGGCTACTGGAACAGTAGCAGG + Intronic
1061050182 9:128190722-128190744 GGGACTGCTGGAGCAGCTGCTGG + Exonic
1061534769 9:131240724-131240746 GGTACTGCTGGACCAAGAGGTGG + Intergenic
1062482014 9:136756912-136756934 GGGAGTGCTGGCCCACCAGCGGG + Intronic
1189757412 X:44285060-44285082 GGTACTGCTGAACCAAGAGCTGG - Intronic
1191217948 X:57952491-57952513 AGGACTACTGGTCCAGAAGCTGG + Intergenic
1196637934 X:118025213-118025235 GGGACTACTGTACTATCATCTGG - Intronic
1198312416 X:135435476-135435498 GGGTCTCCTTGGCCAACAGCAGG - Intergenic
1198719652 X:139602609-139602631 GGGCCTACTGTACTAGCAGCTGG + Intronic
1200235775 X:154467090-154467112 GGGGCTCCTGGACCGTCAGCAGG - Exonic