ID: 1095293778

View in Genome Browser
Species Human (GRCh38)
Location 12:40505830-40505852
Sequence ACTTGGGTCTCTAGTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095293778_1095293782 30 Left 1095293778 12:40505830-40505852 CCTGGATCACTAGAGACCCAAGT 0: 1
1: 1
2: 2
3: 4
4: 79
Right 1095293782 12:40505883-40505905 AAACATCCTTCTTTCTAAATAGG 0: 1
1: 0
2: 0
3: 21
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095293778 Original CRISPR ACTTGGGTCTCTAGTGATCC AGG (reversed) Intronic
902334543 1:15747471-15747493 CCTTGGGCCTCCAGTGACCCGGG - Intronic
905858590 1:41331098-41331120 ACTGGGGTCTCTTGTCATCCAGG + Intergenic
910376930 1:86582652-86582674 ACTTGGATAGCTAGTGATACAGG - Intergenic
913571807 1:120127953-120127975 ACCTGGGTTTCTAGTCCTCCTGG - Intergenic
914292727 1:146289575-146289597 ACCTGGGTTTCTAGTCCTCCTGG - Intergenic
914553771 1:148740358-148740380 ACCTGGGTTTCTAGTCCTCCTGG - Intergenic
915172207 1:153986033-153986055 AGTGGGGTCACTAGTAATCCGGG + Intronic
918047076 1:180948046-180948068 GCAGGGGTCTCTAGTGACCCAGG + Exonic
920607949 1:207408557-207408579 ACTTGTCCCTCCAGTGATCCTGG + Intergenic
1070604677 10:77890409-77890431 CCTTGGGTCTCTAGGGTCCCAGG + Intronic
1072854889 10:98936318-98936340 ACTTGGAACTCTAGTGAGACAGG - Intronic
1073073569 10:100809631-100809653 ACTTGGGTCTCCAAGGCTCCTGG + Intronic
1074046731 10:109846134-109846156 ACCTGGGTCTCTAGTTCTCTGGG - Intergenic
1083877998 11:65534795-65534817 ACTTTGGTCTCTGGTCTTCCAGG - Intronic
1086992244 11:93316348-93316370 CCTTCAGTCTCAAGTGATCCTGG - Intergenic
1095293778 12:40505830-40505852 ACTTGGGTCTCTAGTGATCCAGG - Intronic
1095294088 12:40508780-40508802 ACTTGGCTCTCTAGTGATCCAGG - Intronic
1096395689 12:51264555-51264577 GTTTGGGTCTGTAGTGAGCCAGG + Intronic
1101717973 12:107327665-107327687 ACATGGGTCTCCAGTTTTCCAGG + Intronic
1103013079 12:117472869-117472891 ACTTGGGGCTCTGCTGACCCTGG + Intronic
1105706489 13:22970754-22970776 ACTTGGGTCTGTAGAGCCCCTGG + Intergenic
1117719840 14:58618783-58618805 ACTTTGTTCTCTAGTTTTCCAGG - Intergenic
1117981311 14:61344646-61344668 ACTTGGGTCTGTAGTCAGCGGGG + Intronic
1120864229 14:89282028-89282050 ACCAGGGTCTCTAGTTATCTAGG + Intronic
1129245644 15:74277282-74277304 GCTGGGGTCTCTAGGGATCTAGG - Intronic
1137520819 16:49193989-49194011 ACTTGGATCTCTAGCTACCCTGG - Intergenic
1142992299 17:3739526-3739548 ACCTGGGTCTCTTGACATCCCGG - Intronic
1143279558 17:5742401-5742423 ACTTGGGTTCCTAGTGGTCATGG - Intergenic
1145727248 17:27142016-27142038 ACTAGGGAATCAAGTGATCCAGG + Intergenic
1146866590 17:36340902-36340924 ACTAGTGCCTCTTGTGATCCTGG + Intronic
1147069459 17:37941509-37941531 ACTAGTGCCTCTTGTGATCCTGG + Intergenic
1147080988 17:38021049-38021071 ACTAGTGCCTCTTGTGATCCTGG + Intronic
1147096930 17:38145006-38145028 ACTAGTGCCTCTTGTGATCCTGG + Intergenic
1147112913 17:38277105-38277127 ACTCAGGTCTGTAGCGATCCAGG + Intergenic
1149889942 17:60379475-60379497 ACTAGTGCCTCTTGTGATCCTGG - Intronic
1151155115 17:72118577-72118599 ACTTGTGTCTGTAGAGATCCGGG - Intergenic
1155370043 18:25089296-25089318 ACTTTGGTGTCTATTAATCCAGG + Intronic
1156297690 18:35807904-35807926 GCATGGGTCTCCAGTGTTCCAGG + Intergenic
1160428103 18:78792179-78792201 AGTTGGGTCTCCACAGATCCAGG + Intergenic
1160611547 18:80091563-80091585 ACTTTGGTCTCAAGTGATGGTGG - Intronic
1162651312 19:12091126-12091148 ACTTGGGTCTCCTGTGTTCCAGG - Intergenic
1163379148 19:16952893-16952915 ACATGGATCTCAAGGGATCCTGG + Intronic
1164788266 19:30954955-30954977 TCTTGGCTCTCCATTGATCCAGG - Intergenic
1167464351 19:49642303-49642325 AGTTGGGTCGCTAGTTGTCCCGG + Intronic
925540701 2:4964457-4964479 CCTTTGGTCTTTAGTGATTCGGG + Intergenic
942707125 2:178787247-178787269 AATTGGGTCTTTAGTGATCATGG + Intronic
945925312 2:215797145-215797167 AATTGGGGCCCTAGTGTTCCTGG - Intergenic
1170181022 20:13530181-13530203 ACTTCCGTCTCTGGTTATCCTGG - Intronic
1171896393 20:30813804-30813826 GCTTGGGTCTCTCGTTTTCCGGG + Intergenic
1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG + Intergenic
1180606220 22:17060967-17060989 ATGTGGCTCTCTAGTGGTCCCGG - Intergenic
1182508998 22:30805760-30805782 TCTTGGGTCTGTTGTCATCCAGG + Intronic
1184057980 22:42065450-42065472 ACTTGGGTCTGTAGTGACCCTGG - Intronic
1184342311 22:43892586-43892608 ACTTGGGTTTGTAGTGATTAGGG + Intergenic
1184694886 22:46133658-46133680 ACTTGGGGCTCAAGCTATCCTGG + Intergenic
958922673 3:100123935-100123957 ACTTGGATTTCTAGTGGTCTGGG + Intronic
964307270 3:155355201-155355223 GCCTGGGTCTCCACTGATCCTGG - Intergenic
974155053 4:58060860-58060882 ACTTGAATATCTAGTGATCTGGG + Intergenic
983141519 4:164155193-164155215 ACTTGGGTCTGTGGGTATCCAGG + Intronic
983289203 4:165780206-165780228 ACTTGGGTCTTTAATGACCTTGG - Intergenic
985277310 4:188250417-188250439 AATTGTGTCTCTAGTGACCTTGG + Intergenic
990251308 5:53918074-53918096 ACTTGGGCATCTAGTGTTCTTGG - Intronic
994675191 5:102812053-102812075 ATTTGGCTCTCTAGTGGCCCAGG - Intronic
995284499 5:110371425-110371447 ACTTTGCTCACTAGTGTTCCTGG - Intronic
996314496 5:122146741-122146763 ACTTGGGTCCCTGGTAATGCTGG - Intronic
997578813 5:135004629-135004651 ACTTCCCTCTCTAGTGACCCTGG - Intronic
999182809 5:149681838-149681860 ACTTTTGTCTCTAGGAATCCAGG + Intergenic
1001838880 5:174856256-174856278 ACATGGGTCTATATTGATCACGG + Intergenic
1007244354 6:40449623-40449645 ACCTGGGTATCTGGTGATCATGG + Intronic
1023742328 7:43291992-43292014 AATTCAGTCTCTAGTGATTCAGG + Intronic
1024975054 7:55106066-55106088 ACCTGGGTCTCTAGGTCTCCTGG - Intronic
1027552379 7:79615398-79615420 ACATGGATCTCTAAAGATCCTGG - Intergenic
1027829315 7:83157047-83157069 ACTTGGGCTTCTAGTGATCCAGG + Intronic
1028394372 7:90351083-90351105 ACTTGGGACACTTGAGATCCCGG + Intronic
1029219344 7:98975572-98975594 ACTTCGGGCTCTAGTTGTCCAGG + Intronic
1033980876 7:147164079-147164101 ACTTTATTCTCAAGTGATCCTGG + Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1035997051 8:4559897-4559919 ACTTGGGTTTCTCATGACCCTGG + Intronic
1036975223 8:13403722-13403744 ACTTGGATCCCGAGAGATCCAGG - Intronic
1045463191 8:102444457-102444479 TCTTGACTGTCTAGTGATCCTGG - Intergenic
1049126679 8:140795370-140795392 ACCTGGGTCTCTGCTGTTCCAGG + Intronic
1051467667 9:17398964-17398986 ACTTGAGTCCCTAATGAGCCTGG + Intronic
1056629383 9:88280796-88280818 AGGTGGGTCTCTAGTGAGGCTGG + Intergenic
1057762993 9:97891375-97891397 ACTTGTATCTCTAGAGCTCCTGG - Intergenic
1062588910 9:137264183-137264205 GCCTGGGTCTCTGGTCATCCTGG + Intronic
1199943747 X:152649366-152649388 ACTTGGGGCTGTGGTGATCAGGG + Intronic
1201638102 Y:16147840-16147862 ACTTTGTTTTCTACTGATCCAGG - Intergenic