ID: 1095294051

View in Genome Browser
Species Human (GRCh38)
Location 12:40508295-40508317
Sequence TAGCTCAGTGGGCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095294051_1095294054 -8 Left 1095294051 12:40508295-40508317 CCTGTCTGTGGCCCACTGAGCTA 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1095294054 12:40508310-40508332 CTGAGCTACAGCAGCCTTCCTGG 0: 1
1: 0
2: 2
3: 24
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095294051 Original CRISPR TAGCTCAGTGGGCCACAGAC AGG (reversed) Intronic
900998897 1:6137648-6137670 AAGCTCAGGGGGCCTCAGGCTGG + Intronic
904854945 1:33490745-33490767 TAACTCATTGGTCCACAGATGGG - Intronic
906250373 1:44306541-44306563 TAGCACAGTGGGCCCTGGACAGG - Intronic
906322032 1:44822972-44822994 GAGCCCTGTGGCCCACAGACAGG - Intronic
906652029 1:47519672-47519694 CAACTCAGTGGGCCAAGGACAGG + Intergenic
907707161 1:56842484-56842506 CAGCTCAGTGGACAGCAGACTGG + Intergenic
908814375 1:68016550-68016572 TTGCTCAGTGGACCAGGGACTGG - Intergenic
912496911 1:110097719-110097741 TAGCTCAGTGAGCCAAGGAAAGG - Intergenic
913182800 1:116338546-116338568 AAGCTCAGTGAGCTACAAACAGG + Intergenic
915840003 1:159205889-159205911 TGCCTCCCTGGGCCACAGACTGG + Exonic
916352322 1:163864789-163864811 TAGCTCAGTTTACCAGAGACTGG - Intergenic
916998761 1:170331754-170331776 CAGCCCAGTGGGCCAAACACAGG - Intergenic
917058719 1:171013222-171013244 CAGCTCCCTGGGCCACATACTGG + Intronic
917242725 1:172966434-172966456 TAGCTCAGAGAGACACAGAAAGG + Intergenic
917534009 1:175861531-175861553 TAGCTCAGTGGGTCACACGTTGG - Intergenic
918775506 1:188625042-188625064 TAGCTCAGTGAGACCCAGATTGG - Intergenic
919712049 1:200738794-200738816 ATGCTCAGTGGGCCGGAGACGGG + Intergenic
922564226 1:226590724-226590746 GAGCTCAGTGGTACACAGACTGG - Intronic
923858811 1:237872353-237872375 AAGCACACTGGGCCACAGAGTGG + Intergenic
1062981222 10:1724620-1724642 TGCCTCAGTGAGCCACAGCCTGG + Intronic
1065604732 10:27405856-27405878 TTGCTGAGTGGTTCACAGACTGG - Intronic
1065711404 10:28521800-28521822 TGGCTCGGTAGGCCCCAGACAGG - Intergenic
1067457005 10:46426132-46426154 TGGCTCCCTGGGCCACAGACAGG - Intergenic
1067630199 10:47958507-47958529 TGGCTCCCTGGGCCACAGACAGG + Intergenic
1070214719 10:74364983-74365005 TAGCTCTATGGAACACAGACTGG - Intronic
1070278750 10:75033561-75033583 CAGCCCAGTGGGCCACACATCGG + Intergenic
1073703421 10:105955877-105955899 TAGCTCAGGGGGCCTCAGCTTGG + Intergenic
1074765869 10:116699597-116699619 TAGGTCAGGATGCCACAGACGGG - Intronic
1075291342 10:121233649-121233671 TAGCCCAGCAGGCCACAGAAGGG + Intergenic
1075352900 10:121741435-121741457 AAGCACAGTGGTTCACAGACAGG + Exonic
1076782675 10:132732923-132732945 TGGCTCAGAGGACCACAGGCTGG + Intronic
1078049118 11:7946352-7946374 TAGCTGCATGGGCCACAGTCAGG + Intergenic
1078856892 11:15213396-15213418 TAGATCAGTGGTCCTCAGCCTGG - Intronic
1082834436 11:57641141-57641163 GAGCTGAGTGGGCCAGGGACTGG + Intergenic
1085690444 11:78659797-78659819 AAGCTCTGTGAGCCACAGAAGGG - Intronic
1091541050 12:1463010-1463032 AAGCTCAGTGAGCCACAGAGGGG - Intronic
1092844119 12:12568299-12568321 TAGGCCAGTGGGCCTCAGCCTGG + Intergenic
1095294051 12:40508295-40508317 TAGCTCAGTGGGCCACAGACAGG - Intronic
1095294354 12:40511248-40511270 CAGGTCAGTGGGCCTCAGACAGG - Intronic
1095709326 12:45271037-45271059 TAGTACAGTGAGCCATAGACAGG - Intronic
1098910848 12:76206934-76206956 TAGCGCACTTGGCCACAGATGGG - Intergenic
1102653178 12:114457892-114457914 TAGCTCTGTGGAGCAAAGACTGG - Intergenic
1106395312 13:29374341-29374363 AAGCTCAGTGAACCACAAACAGG + Intronic
1107097559 13:36552818-36552840 TAGGACAGTGGGCGAGAGACTGG + Intergenic
1107729097 13:43330332-43330354 CACCTCAGTGGTCCACAGAGTGG + Intronic
1108138649 13:47393897-47393919 TAGATCAGTGGGCCAGGGGCTGG + Intergenic
1112734539 13:102401406-102401428 TAGCTCGATGAGCAACAGACAGG + Intronic
1113027230 13:105954491-105954513 TAGCCCAGAGGGGCACAGATGGG + Intergenic
1113419113 13:110156020-110156042 TAGAGCAGTGGCCCACAGGCAGG - Intronic
1116034715 14:39613715-39613737 TAGCTCAGTGGTCACCAGACTGG - Intergenic
1116968837 14:51043507-51043529 TAGCTTCCTGGGCCACAGATAGG - Intronic
1117050466 14:51854878-51854900 TAGCACAGAGGGACACAGGCAGG - Intronic
1117535653 14:56700406-56700428 TAGCTCCCTGAGCCACATACTGG - Intronic
1121816971 14:96936057-96936079 TAGCTCAGAGGACCAGACACTGG + Intergenic
1122530939 14:102426494-102426516 GAGCTCAGCGGGCCTCTGACAGG + Intronic
1122939004 14:104972920-104972942 TGGCTCAGGGGGCCACTTACTGG + Intronic
1202906531 14_GL000194v1_random:76816-76838 TGGCACTGTGGGCCACAGAAGGG + Intergenic
1123632035 15:22268208-22268230 TAGCTCAGTGTGGCAAAGGCGGG + Intergenic
1124637430 15:31373983-31374005 GACCTCAGAGGGCCACAGATGGG + Exonic
1126416523 15:48423490-48423512 AAGCTCCTTGGGCCATAGACAGG - Intronic
1128282702 15:66409554-66409576 TAGGACAGATGGCCACAGACAGG + Intronic
1131808188 15:96145228-96145250 TAGCTCAGTAGGTCAGAGATTGG - Intergenic
1132080375 15:98859127-98859149 TAGCTCAGTGGAGCTCAAACTGG - Intronic
1132743976 16:1429104-1429126 TAGCCCAGTGACCCACAGCCAGG - Intergenic
1135873047 16:26169954-26169976 TAGCACAGTGGAACACAGACAGG + Intergenic
1138030509 16:53556035-53556057 GAGCCCAGTGGGCAACAGATAGG - Intergenic
1139590177 16:67928977-67928999 AGGCTCAGTGGGACCCAGACTGG - Exonic
1140377764 16:74458601-74458623 TAGCTCACTGGACCTCAAACTGG - Intronic
1141780674 16:86158412-86158434 TAGCTCAGTCCTCCGCAGACAGG - Intergenic
1141970965 16:87482179-87482201 TAGCTCAGTGTGGCAAAGGCAGG - Intronic
1142000348 16:87660731-87660753 TAGCACAGTGAGGCTCAGACAGG - Intronic
1144034725 17:11354849-11354871 AAGCTCAATGGAACACAGACTGG - Intronic
1144563954 17:16344552-16344574 AAGCTCAGGGGGACACAGAGAGG - Intronic
1146815719 17:35940451-35940473 TAGCTCAAAGGGGCACCGACTGG + Intronic
1148017987 17:44536101-44536123 CAGCTCAGTGGAAGACAGACAGG + Intergenic
1153417669 18:4866927-4866949 AAGCTCAGTGGGCCCCAAAAAGG + Intergenic
1155171346 18:23269015-23269037 AAGCTCATTGGGCCACGGAACGG - Intronic
1155549949 18:26954249-26954271 TAGCTCAAGGGGCCAATGACAGG + Intronic
1158963414 18:62604449-62604471 TAGGAAAGTGGGCCACAGTCAGG + Intergenic
1160024142 18:75204877-75204899 GAGCGCAGTGGCCGACAGACAGG + Intronic
1167642224 19:50688152-50688174 TAGCCCAGAGGGCCATGGACAGG - Intronic
926743915 2:16135090-16135112 TCACTCAGTGGCCCATAGACAGG - Intergenic
932857308 2:75249558-75249580 TTGCTCCATGGGCCACAGAATGG + Intergenic
933164870 2:79064900-79064922 TAGAACAGTGGGCCAGAGAAAGG - Intergenic
934776085 2:96938374-96938396 GAGCTGAGTGCGCCACAGGCAGG + Intronic
938240486 2:129739102-129739124 AAGCTCCCTGGGCCACAGCCTGG - Intergenic
938291994 2:130155400-130155422 CAGCTCAGGGGGCCACGGGCAGG + Intronic
938464556 2:131517567-131517589 CAGCTCAGGGGGCCACGGGCAGG - Intergenic
939390323 2:141560503-141560525 TAGCTAAGTGAGCCAGAGAAAGG - Intronic
940740346 2:157500431-157500453 TTCCCCATTGGGCCACAGACTGG - Intergenic
941410127 2:165144449-165144471 GAGCTGAGTGAACCACAGACAGG - Intronic
941725555 2:168856630-168856652 TGTCTCAGTGGGACACAGCCAGG - Intronic
944145474 2:196503274-196503296 TATCTCAGAGTGCCACAGGCAGG + Intronic
1172221565 20:33277711-33277733 CAGCTCAGTGGGGCCCAGAAGGG - Intronic
1172302320 20:33858824-33858846 GAGCTCAGTGGGGCAGACACAGG + Intergenic
1172720617 20:36997971-36997993 TACCACAGTGGGCCAGAGACAGG + Exonic
1172763424 20:37337558-37337580 CAGCTCAGTGGGGCACAGGGAGG + Intergenic
1173232013 20:41205755-41205777 TAGCTTGCTGGGCCACAAACTGG - Intronic
1174391488 20:50220839-50220861 TGGCCCTGTGGGGCACAGACAGG - Intergenic
1175981550 20:62741234-62741256 CAGCTCAGCCGGGCACAGACAGG + Intronic
1176304254 21:5115001-5115023 TGGCTCACCGGGCCACATACTGG + Intergenic
1176625879 21:9091615-9091637 TGGCACTGTGGGCCACAGAAGGG + Intergenic
1177438536 21:21087662-21087684 TAGCACTCTGGGTCACAGACAGG + Intronic
1179375508 21:40846929-40846951 CAGCTCAGTGGGCCCCCGGCAGG + Exonic
1179852802 21:44147029-44147051 TGGCTCACCGGGCCACATACTGG - Intergenic
1183183606 22:36278553-36278575 TAGCTCAGTGGATCCCAAACAGG + Intergenic
1184160417 22:42694173-42694195 GAGCACAGTGGGCCATGGACTGG + Intronic
1184264665 22:43340671-43340693 TAGCTCACTGGGGCTGAGACTGG + Intronic
1184414439 22:44344029-44344051 TGGCTCAGTGGGCCAGAGAATGG - Intergenic
950909730 3:16576481-16576503 TAGCCATGTGGGCCACAGAGGGG - Intergenic
952182585 3:30933751-30933773 TGGCTCAGCAGGCCACAGAGAGG - Intergenic
954801033 3:53186926-53186948 CCGCTCCGTGGGCCACAGCCAGG + Intronic
954918070 3:54165321-54165343 TAGTTCAGTGGTCCTCAGTCAGG - Intronic
955320860 3:57973214-57973236 GAGGGCTGTGGGCCACAGACTGG - Intergenic
956288863 3:67640404-67640426 TTGATCAGTGGGCCAGAAACAGG + Intronic
959046936 3:101484918-101484940 GAGCACAGTGGGACAGAGACCGG + Intronic
959450634 3:106495108-106495130 TAACTCAGTGGTTCACAGACAGG - Intergenic
961468021 3:127093084-127093106 TAGGGCAGTGGGCCACACTCTGG + Intergenic
961871529 3:129992035-129992057 CAGGTCAGTGGGGGACAGACAGG - Intergenic
965345526 3:167544452-167544474 TAGAGCAGTGGGACATAGACCGG + Intronic
966830614 3:184005040-184005062 CAGCACACTGGGCCAGAGACAGG + Intronic
969202388 4:5616285-5616307 CAGCTCAGAGGGCCACAGAAAGG + Intronic
972778593 4:42266009-42266031 GGGCTCAGTGGGCCCCACACTGG + Intergenic
975385640 4:73756535-73756557 AAGCTCAGCAGGCCACTGACTGG - Intergenic
975702557 4:77080389-77080411 TAGCTTAGAGGGGCACAGCCAGG + Intergenic
977765167 4:100788769-100788791 TAGCCCTGTGGGCCACAGCTTGG - Intronic
978422118 4:108543874-108543896 CTTCTCATTGGGCCACAGACTGG - Intergenic
978767994 4:112424289-112424311 TAACTCAGTGGGCCTTAGAAAGG + Intronic
978830654 4:113080249-113080271 TACATCAGAGGGCCACAGCCTGG - Intronic
983076583 4:163333153-163333175 TTTCTCAGTGGGCCAAAGAAAGG - Intronic
985552953 5:542538-542560 GGGCTCAGTGGGCCCCAGGCAGG - Intergenic
985553194 5:543518-543540 GGGCTCAGTGGGCCCCAGGCAGG + Intergenic
986993830 5:13583756-13583778 TAGCATAGTGGGCCACTGTCTGG - Intergenic
988942875 5:36163693-36163715 CAGCTCAGGGAGGCACAGACAGG - Exonic
991919332 5:71638870-71638892 TTGCTCCGTGGGCTACAGAGTGG + Intronic
997270962 5:132537669-132537691 TAGGTCAGCTGGCCACAGGCAGG + Intergenic
997304051 5:132825613-132825635 TGGGACAGTGGGCCGCAGACGGG + Exonic
998139922 5:139693961-139693983 TAGCTCAGTTGGCCACTGCAGGG - Intergenic
1001479634 5:172079143-172079165 TAGGGCAGTGGGCCACAGGCAGG - Intronic
1002181159 5:177431770-177431792 TAGCTCAGTGTCACACAGCCGGG - Intronic
1002405603 5:179027788-179027810 GAGCTCAGTGGGCAGAAGACAGG - Intronic
1002560891 5:180081341-180081363 TAGCTTAGTGGGCAACGGGCAGG + Intergenic
1007993556 6:46282634-46282656 TAGATCAGTGGTCCAAAAACAGG - Intronic
1010284344 6:74058011-74058033 TAGCCCAGTGAGACACACACTGG + Intergenic
1012647942 6:101712238-101712260 CTGCTCAGTGGACCACACACAGG - Intronic
1013146165 6:107395287-107395309 AAGCTCAATAGGCCACAAACAGG - Intronic
1016841957 6:148533753-148533775 TTGCTCCCTGGGCCACAGAAAGG + Exonic
1019156598 6:170043414-170043436 CGGCTCAGTTGGCCACAGGCAGG + Intergenic
1019708534 7:2507851-2507873 AAGCTCAGTGGGGCCCAGAGTGG + Intergenic
1019831780 7:3337539-3337561 AAGCTGAGTGAGCCCCAGACAGG + Intronic
1020385031 7:7591752-7591774 AAGCTCAGTGAACCACAAACAGG - Intronic
1023549048 7:41349478-41349500 TTGACCAGTGGGCCACAGATAGG + Intergenic
1023859062 7:44206209-44206231 CAGCCCAATGGGCCACACACAGG - Intronic
1025085467 7:56019844-56019866 GAGCCCAGTGTGCAACAGACAGG + Intronic
1030082244 7:105788169-105788191 CACCCCAGTGGGCCACACACTGG + Intronic
1031118907 7:117698418-117698440 TGCTTCAGTGGTCCACAGACTGG - Intronic
1032450192 7:132023977-132023999 TGGCTGAGAGGGCAACAGACTGG + Intergenic
1032480301 7:132240731-132240753 TAGCCCAGTAAGCCACAGTCAGG + Intronic
1034895132 7:154871658-154871680 TAGCTCAATGGCCCAGGGACTGG - Intronic
1040685936 8:49873322-49873344 CAGGTCAGAGGGCCACAGAGAGG - Intergenic
1041862569 8:62531094-62531116 TAGTTCAGAGAGCCACAGTCGGG + Intronic
1045413575 8:101944241-101944263 TAGCTAACTGGACCAAAGACAGG + Intronic
1048573086 8:135670837-135670859 TAGCTCAGTGAGACCCATACTGG + Intergenic
1049684570 8:143934181-143934203 TAGGACAGTGGGCCACAGCCAGG - Intronic
1051870275 9:21728906-21728928 CAGCTCAGTGCGCCAAAGCCAGG + Intergenic
1052916359 9:33926843-33926865 GGGCTCAGTGGGGCAGAGACGGG + Intronic
1053315349 9:37046419-37046441 TATCTCAATGGGACACAGCCAGG - Intergenic
1056133316 9:83606565-83606587 TAAGTCAGTAGACCACAGACAGG + Intergenic
1059250952 9:112887575-112887597 GAGCTCAGAGGGTCACAGACTGG - Intronic
1061242466 9:129382584-129382606 TAGCCCAGTGGGAGACAGAGGGG - Intergenic
1061767023 9:132887953-132887975 CAGCACAGTGGGCCAGAGCCTGG + Intronic
1061780204 9:132991405-132991427 CAGCTCAGTGGGCAGCAGGCAGG - Exonic
1203749051 Un_GL000218v1:62036-62058 TGGCACTGTGGGCCACAGAAGGG + Intergenic
1186173671 X:6903335-6903357 TGTCTCAGTGGCCCACAGACAGG + Intergenic
1187858644 X:23660879-23660901 TAGCTAAGTGGGCCACCCACTGG + Intergenic
1187945613 X:24423784-24423806 TAGCTGAGTGGGCAGCAGGCAGG + Intergenic
1188437326 X:30176330-30176352 TAGCTCAGTGGTTCTCAGCCAGG + Intergenic
1192232821 X:69277814-69277836 GGGCTCAGTGGGCCCCAGCCAGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195733050 X:107984882-107984904 CAGTTCAGTGAGCCACTGACTGG - Intergenic
1197230057 X:123994049-123994071 TAGCTCAGTGTTCTACAGTCTGG + Intronic
1197635265 X:128907628-128907650 TAACAGAATGGGCCACAGACTGG + Intergenic
1199693097 X:150324059-150324081 TAGGACAGTGGGACACACACAGG + Intergenic