ID: 1095313795

View in Genome Browser
Species Human (GRCh38)
Location 12:40733487-40733509
Sequence CTCTGGCAGGGGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1537
Summary {0: 1, 1: 0, 2: 7, 3: 132, 4: 1397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095313795_1095313808 20 Left 1095313795 12:40733487-40733509 CCCTCCCCCTTCCCCTGCCAGAG 0: 1
1: 0
2: 7
3: 132
4: 1397
Right 1095313808 12:40733530-40733552 TGGCATCATGAGATAAAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 303
1095313795_1095313807 0 Left 1095313795 12:40733487-40733509 CCCTCCCCCTTCCCCTGCCAGAG 0: 1
1: 0
2: 7
3: 132
4: 1397
Right 1095313807 12:40733510-40733532 GAAGAGGTACAAGAGATTTTTGG 0: 1
1: 0
2: 3
3: 24
4: 337
1095313795_1095313809 27 Left 1095313795 12:40733487-40733509 CCCTCCCCCTTCCCCTGCCAGAG 0: 1
1: 0
2: 7
3: 132
4: 1397
Right 1095313809 12:40733537-40733559 ATGAGATAAAGAAAGGCAGCAGG 0: 1
1: 0
2: 4
3: 56
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095313795 Original CRISPR CTCTGGCAGGGGAAGGGGGA GGG (reversed) Intronic
900142275 1:1143655-1143677 AACTGGCAGGGCAAGGGGGCAGG - Intergenic
900275032 1:1819784-1819806 CTTTGGGAGGCCAAGGGGGAAGG - Intronic
900344960 1:2206075-2206097 CTCTAGCATGGGAGGGGGGCAGG + Intronic
900390434 1:2431608-2431630 CTCTGGCAGGGCCTGGGGGCGGG + Intronic
900750131 1:4390459-4390481 CTCTGGCAAGAGAAGGAGGCAGG - Intergenic
901222116 1:7589184-7589206 CTCTGCCAGGAGGAAGGGGAGGG - Intronic
901390349 1:8941692-8941714 CTTTGGGAGGCCAAGGGGGATGG - Intergenic
901642252 1:10698690-10698712 CCCTGGCAGGGGAGGGCTGAGGG + Intronic
901662252 1:10805965-10805987 CTCTGGCAGGGCAGTGGGCACGG - Intergenic
901757697 1:11451272-11451294 CTGGGGCTGGGGAAGCGGGAGGG + Intergenic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
901932937 1:12608563-12608585 CACAGGCAGGGGCAGGGGCAGGG - Intronic
902092678 1:13915996-13916018 CTGTGGCAGGGGTTGGGGGCCGG + Intergenic
902129127 1:14243375-14243397 CTCTGGGAGGTGGAGGAGGAGGG + Intergenic
902533874 1:17107761-17107783 CTCTGGCAGGAGAATTGGGAAGG + Intronic
902570212 1:17342279-17342301 CTCCTGCAGGGGAGGGGGTAAGG - Exonic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
903060408 1:20664861-20664883 CTCTGGCTGGGCAGGGGGGCGGG - Intronic
903204865 1:21773892-21773914 CTTTGGGAGGGCAAGGTGGAAGG + Intronic
903221541 1:21872376-21872398 ATCTGGCAGGGGAAAAAGGAGGG + Exonic
903448715 1:23438290-23438312 CTCTGGCAGGGGTGTGGGGTGGG - Intronic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903827510 1:26156536-26156558 CTCTGGTGGGGGCTGGGGGAGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904028400 1:27519325-27519347 GCCTGGCAGGGGGATGGGGAAGG - Intergenic
904144556 1:28379515-28379537 CTCTGGCAGGCCAAGGTGGATGG - Intronic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904416992 1:30369032-30369054 CTCTGGCTGGGGCAGGAGGGAGG + Intergenic
904611165 1:31727150-31727172 CCCGGGCTGGGGAGGGGGGAGGG - Exonic
904683767 1:32246717-32246739 CCCTGGGAGGGGCAGGGAGATGG + Intergenic
904698110 1:32341852-32341874 CACAACCAGGGGAAGGGGGAGGG - Intergenic
904862488 1:33549266-33549288 ATCTGGCATGGGAAGGGTTACGG + Intronic
904985798 1:34547434-34547456 CTTGGGTAGGGGAAGGGGCAGGG + Intergenic
905116431 1:35645278-35645300 AACAGGTAGGGGAAGGGGGAAGG + Intergenic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905295695 1:36953188-36953210 ATGAGGCAGGGGCAGGGGGAGGG - Intronic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905378655 1:37543895-37543917 CTTTGGGAGGGCAAGGGGGGGGG + Intronic
905791542 1:40792198-40792220 CCCTGGGAGGGGAGGGGGCAGGG + Intronic
905796289 1:40818409-40818431 ATGTGGCAGGGGACTGGGGAGGG - Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
906009157 1:42507168-42507190 CTCTGGGAGGCCAAGGCGGATGG - Intronic
906208381 1:43998969-43998991 GCCTGGCGGGGGAAGGGGGGGGG + Intronic
906256912 1:44357401-44357423 CTTTGGCAGGCCAAGGTGGAAGG + Intergenic
906662488 1:47592987-47593009 CTCTGGGAGAGAGAGGGGGAAGG + Intergenic
906990309 1:50730075-50730097 CTCTGGAGGGTGAAGGGGGTTGG + Intronic
907111639 1:51931737-51931759 CTCTGGCAGGGGGCTGGGAAAGG + Intronic
907142877 1:52204783-52204805 TTCTGGCAGGGAAAGGGGAAAGG - Intronic
907239994 1:53075996-53076018 CTCGGGCTGGGGCAAGGGGAGGG + Intronic
907310662 1:53537184-53537206 CTCTGGCTTGGGGAGGGGGAGGG + Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907384674 1:54118333-54118355 TTCCTGCAGGGGGAGGGGGAGGG - Intergenic
907387679 1:54136612-54136634 CTCAGGTAGGGGCTGGGGGAAGG - Intronic
907554411 1:55332342-55332364 CTCAGGCACAGGAAGGGGGCTGG - Intergenic
907733835 1:57092661-57092683 GTCTGGCGGGGGAGGGGGGTGGG + Intronic
907909005 1:58810829-58810851 CTGGGGCAGGGGAAGAGGAAGGG - Intergenic
908114321 1:60925941-60925963 TTCTGGCAGGGAAGGGTGGAGGG - Intronic
910264132 1:85320814-85320836 CCCTGGCAGGGGTGAGGGGAGGG + Exonic
910349239 1:86277263-86277285 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
910576997 1:88776216-88776238 GTCAGGGAGGGCAAGGGGGAGGG - Intronic
910975185 1:92898868-92898890 CTCGGGAAGGTGAAGTGGGAGGG - Intronic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911509861 1:98798444-98798466 GTCTGGGAAGGGAAGAGGGAAGG - Intergenic
912183303 1:107244658-107244680 AGCTGGCAGGAGAAGGAGGAAGG - Intronic
912242711 1:107927688-107927710 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
912985105 1:114419755-114419777 CTCTTACAGGAGCAGGGGGATGG + Intronic
913106343 1:115617172-115617194 CATTTGCAGGGGAAGGGGGATGG + Intergenic
913314866 1:117541062-117541084 CTCTGCCTGGGGTAGGGGCAAGG + Intergenic
913531778 1:119738761-119738783 CTCTGGCAGAGCGAGGGGGTGGG + Intronic
914425014 1:147567772-147567794 TCCTAGCAGGGGGAGGGGGAAGG - Intronic
914778310 1:150759111-150759133 CTTTGGGAGGCCAAGGGGGAAGG - Intronic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915014875 1:152723735-152723757 CTCTGTTGGGGGGAGGGGGAGGG + Intergenic
915046176 1:153018749-153018771 CCCTGTCTGGTGAAGGGGGATGG - Intergenic
915079662 1:153343410-153343432 CTCTGAAAAGGGAAGGGGGTAGG - Intronic
915285235 1:154848093-154848115 CTCTGGCTGGGGAGGGGGGGAGG - Intronic
915388700 1:155520617-155520639 CTCTGGGAGGCTAAGGTGGACGG + Intronic
915462091 1:156076439-156076461 CGCTCGCTGGGGAAGGGGGGAGG - Exonic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915697791 1:157762070-157762092 CTCTGGCATGGTCAGGGGAAGGG - Intronic
915743996 1:158142152-158142174 CTATGGCAGGGGCGGGGGCAGGG + Intergenic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916124441 1:161556782-161556804 CTCGGACAGGGGTAGGGGGGTGG + Intergenic
916134333 1:161638132-161638154 CTCGGACAGGGGTAGGGGGGTGG + Intronic
916174375 1:162025300-162025322 CTTTGGGAGGGCAAGGCGGATGG - Intergenic
916452846 1:164937785-164937807 CTCAGGAAGGGGATGAGGGAAGG - Intergenic
916551148 1:165851005-165851027 CTCTGGGAGGGCAAAGGGGGAGG - Intronic
916926021 1:169521477-169521499 CTCTGTCAGGAAAAGGGGTAGGG - Intronic
917082310 1:171268675-171268697 CTCTGACAGGGGAGGGAGAAAGG - Intronic
917191234 1:172421789-172421811 TGCTGCCAGGGGATGGGGGAGGG - Intronic
917263781 1:173197674-173197696 CTGTTGCAGGGGCAAGGGGAGGG + Intronic
917459205 1:175214573-175214595 CTGTGGCAGGGGACAGGGGTGGG + Intergenic
917754803 1:178088431-178088453 AGGTGGCAGGGGAAGGAGGACGG + Intergenic
918118315 1:181515969-181515991 CTCAGCCAGGCCAAGGGGGAAGG - Intronic
918336537 1:183520599-183520621 CTCTGTTGGGGGGAGGGGGAAGG + Intronic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
919034503 1:192289280-192289302 GGCTGGGAAGGGAAGGGGGAGGG + Intergenic
919709297 1:200710369-200710391 GCCTGTGAGGGGAAGGGGGAGGG + Intergenic
919982559 1:202651301-202651323 CTCTGGCATGTGAAACGGGAAGG + Intronic
919983762 1:202658796-202658818 CACTGGCAGGGGCAAGAGGAGGG - Intronic
920129188 1:203717962-203717984 CTTTGGGAGGCCAAGGGGGAAGG + Intronic
920453333 1:206077526-206077548 CTTTGGGAGGGGAAGGAGGGAGG + Intronic
920864809 1:209743172-209743194 TTCTGGCAAGAGAAGGAGGAAGG + Intergenic
921023849 1:211259766-211259788 CTGGGGGAGGGGAAGAGGGAGGG - Intronic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921263015 1:213400526-213400548 CTCTGGAAGGGGCAGGGACAGGG - Intergenic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
921778312 1:219128977-219128999 CTTTGGGAGGCCAAGGGGGAAGG + Intergenic
922320607 1:224483093-224483115 CACTGGCAGGGGAATGGGGAGGG + Intronic
922649625 1:227326444-227326466 CTTTGGGAGGCCAAGGGGGATGG + Intergenic
922780623 1:228249872-228249894 GCCTGGGAGGGGAAGTGGGAGGG - Intronic
922946443 1:229519880-229519902 CTCTGGCAGGCTGAGGGGGGAGG + Intronic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
923659494 1:235945950-235945972 CTTTGGCAGGGGAAGGGTGCTGG + Intergenic
923712141 1:236395910-236395932 CTGCGGCATGGGCAGGGGGAAGG - Intronic
924262898 1:242250386-242250408 CCCTGGAAGGTGAAGGGGAATGG + Intronic
924333933 1:242967952-242967974 CCTTAGCAGGGGTAGGGGGACGG - Intergenic
924560888 1:245155892-245155914 CTATGGGGGGGGTAGGGGGAGGG - Intronic
924898059 1:248363721-248363743 ACATGGCTGGGGAAGGGGGAGGG + Intergenic
1063030284 10:2227757-2227779 CACTGGCAGTGGTAGGAGGAAGG + Intergenic
1063326227 10:5105833-5105855 CTCTGGCAGGGTGAGTGGGCAGG + Intronic
1063485961 10:6421239-6421261 CTTTGGAAGGCTAAGGGGGAAGG + Intergenic
1064020520 10:11805203-11805225 GTCGGGCAGGAAAAGGGGGAAGG - Intergenic
1064425695 10:15227242-15227264 CTTTGGGAGGCCAAGGGGGATGG - Intronic
1064479617 10:15726218-15726240 CACTGGCAGGGAGAGAGGGAGGG + Intergenic
1064720597 10:18225230-18225252 CCCTGGCAGAGGATGGGGGATGG + Intronic
1065113545 10:22462781-22462803 CTCTGGGAGGCGAAGGGGGGAGG - Intergenic
1065431396 10:25660998-25661020 CTCTGTCTGGGGAAAGGGGAGGG - Intergenic
1065485475 10:26232744-26232766 CTTTGGGAGGTGAAGGCGGATGG - Intronic
1066708291 10:38204256-38204278 CTCTGCCTGGGGAAAGGGGAGGG + Intergenic
1066721888 10:38348068-38348090 CCCTGGAAGGTGAAGGGGAATGG - Intergenic
1066786096 10:39005566-39005588 CTCTGGAAGTGCAAGGGGTAAGG - Intergenic
1066981218 10:42418326-42418348 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1067229728 10:44397720-44397742 CTGGGGCAGGGAATGGGGGAGGG + Intergenic
1067338731 10:45384112-45384134 CTGATGCAGGGGGAGGGGGAAGG + Intronic
1067477039 10:46574079-46574101 CTCTCGCGGGGGCAGGGGGTGGG + Intergenic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1068226053 10:54108267-54108289 TTCTGCCAGGGGATGGGGGAGGG - Intronic
1068353273 10:55878193-55878215 CTTTGGCAGGCCAAGGTGGAGGG + Intergenic
1069394742 10:67976685-67976707 CTCTGCCAGGGGCTGGGAGAGGG - Intronic
1069551377 10:69366810-69366832 CTCTCACAAGGGAAGGGGAAGGG - Intronic
1069554589 10:69389463-69389485 CTCTGGCGGGGGGAGGTGGGGGG + Intronic
1069647488 10:70013091-70013113 CTTTGGAAGGCCAAGGGGGAAGG - Intergenic
1069658042 10:70104964-70104986 CTGTGGCAGGGGGTCGGGGAGGG + Intronic
1069920938 10:71815313-71815335 CCCTGGGAGGGGACGGTGGATGG - Exonic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070146324 10:73776321-73776343 CTCTGGGAGGTCAAGGCGGATGG - Intronic
1070309972 10:75266023-75266045 CTCTGACAGGGCAAGATGGATGG + Intergenic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070780395 10:79134198-79134220 CTCAGGGCGGGGTAGGGGGAAGG + Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070835487 10:79444929-79444951 CCCTGGCAGGGAGAGGGGGCGGG + Intronic
1071363776 10:84878081-84878103 CACTGGCAGGGGCAGGGGATGGG + Intergenic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072344440 10:94489372-94489394 CACTGCCAGGGGTTGGGGGAGGG + Intronic
1072442917 10:95472783-95472805 CTCTGGCAGGCCAAGGTGGGCGG + Intronic
1072981334 10:100100367-100100389 CTTTGGGAGGCCAAGGGGGATGG - Intergenic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1073554243 10:104433329-104433351 CTCTGGGAGGCTAAGGTGGAAGG - Intronic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1073609028 10:104925058-104925080 GCCTGTCAGGGGAAAGGGGAGGG - Intronic
1073727231 10:106247629-106247651 CTGTGGCAGTGGATGGGGGTTGG - Intergenic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074080864 10:110167097-110167119 CTCAGGCTGGAGAAGGGGGCTGG - Intergenic
1074120067 10:110487529-110487551 CTCTGGCAGAGGGAGGGGGAAGG - Intergenic
1074377650 10:112952269-112952291 ACCTTCCAGGGGAAGGGGGAAGG - Intronic
1074429894 10:113385561-113385583 ATCTGGCAGGGAGAGAGGGAGGG - Intergenic
1074761520 10:116670279-116670301 GTCTGGCCGGGGAAGCGGGTGGG + Intergenic
1074769799 10:116725825-116725847 GTGTGGCAGGGGTTGGGGGAGGG - Intronic
1074781912 10:116808290-116808312 CTCTGGTGGGGAAAGGGGGACGG + Intergenic
1074852304 10:117448669-117448691 CTGTGGGAGGGGGACGGGGAGGG - Intergenic
1075190980 10:120308420-120308442 CTCTGGCAGGGGTGGGGATAAGG - Intergenic
1075237694 10:120745898-120745920 ATAAGGGAGGGGAAGGGGGAAGG - Intergenic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1075379990 10:122011234-122011256 GTGTGGCTGGGGAAGTGGGAAGG + Intronic
1075435809 10:122440594-122440616 CGTTGGCATGGGAAGGGAGAAGG - Exonic
1075574409 10:123568491-123568513 ATCTGGCAGGGCATGCGGGACGG + Intergenic
1075724585 10:124604881-124604903 CAGGGGCAGGGGAAGGGGCAGGG - Intronic
1075785020 10:125043242-125043264 CAAGGGCAGGGGAAAGGGGAGGG + Intronic
1075866831 10:125729679-125729701 AACTGGCAGGGGAAGGAGGGAGG - Intronic
1076188041 10:128464135-128464157 CTCTGACAGGGGAAGGGACCAGG - Intergenic
1076279335 10:129232522-129232544 CCCGGGCAGGGGCAGGGGCAGGG - Intergenic
1076407517 10:130222555-130222577 CTCTGCCAGGGGCAAGGGTAGGG + Intergenic
1076426388 10:130370243-130370265 CCCTGGCAGGGGAGGGGGCCTGG + Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG + Intergenic
1077046995 11:551111-551133 CACCTGCAGGGGGAGGGGGAGGG - Exonic
1077220991 11:1416107-1416129 CTAGGGCAAGGGGAGGGGGAGGG + Intronic
1077411429 11:2405662-2405684 CCCTGGCAGGAGAGGGGAGATGG - Intronic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077534114 11:3111147-3111169 CTGTGGCAGGGGGTGGGGGTGGG - Intronic
1077601955 11:3580631-3580653 CCCTAGCAGGGGAAGGGGCGGGG - Intergenic
1077618344 11:3695946-3695968 CTCTGGCAGGCCAAGGGAGGTGG + Intronic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077874677 11:6294111-6294133 CAGGGGCAGGGGAAGGGGCAGGG + Intergenic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078153464 11:8778421-8778443 AGCTGTCAGGGGCAGGGGGAGGG - Intronic
1078992505 11:16664326-16664348 CTGTGCCAGGGGATGGGGTAGGG - Intronic
1079007327 11:16801164-16801186 CCCAGCCAGGGGAAGAGGGAAGG + Intronic
1080144928 11:28970120-28970142 ATCTGGGAGGGGTTGGGGGAAGG - Intergenic
1080472188 11:32557108-32557130 CTTTGGCAGGCCAAGGCGGATGG + Intergenic
1080481982 11:32661089-32661111 CTCTGGTTGGAGAAAGGGGAAGG + Intronic
1080594480 11:33758230-33758252 GTCTGGTATGGGATGGGGGATGG - Intronic
1080694862 11:34594693-34594715 CTGAGGCAGGGGTAGGGGTAGGG - Intergenic
1080833607 11:35919233-35919255 CTCTGCCAGGGGAAAGATGATGG - Intergenic
1081100744 11:38999134-38999156 CTTTGGGAGGGTAAGGGGGACGG - Intergenic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1081677370 11:44978803-44978825 TTCATGCAGGGGAAGGGAGATGG + Intergenic
1081769424 11:45639118-45639140 CTCAGCCAGGGGATGGGGGTAGG + Intergenic
1081900843 11:46626491-46626513 CTCTGGGAGGCGGAGGCGGACGG - Intronic
1082029391 11:47593839-47593861 CTCTGGCAGGGCTTGAGGGAAGG - Intronic
1082072339 11:47949211-47949233 CTTTGGGAGGCCAAGGGGGACGG + Intergenic
1082089267 11:48076021-48076043 ACCTGGCTGGGGTAGGGGGAAGG - Intronic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1082803216 11:57429628-57429650 CTCTTGCAGGAGAATGGCGATGG - Intergenic
1082813874 11:57495580-57495602 CTTTGGAAGGGCAAGGGGGGAGG + Intronic
1083257784 11:61507385-61507407 CCACTGCAGGGGAAGGGGGATGG - Intergenic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1083784185 11:64934342-64934364 ATTGGGCAGGGGGAGGGGGAGGG + Exonic
1083826909 11:65209183-65209205 ATCTGGCAGAGGAAGTGGGCAGG - Intronic
1083904347 11:65660396-65660418 GGCTGGCAGGGGCAGGGGCACGG - Intronic
1084122374 11:67077286-67077308 CTCTGCCAGGGTGAGGAGGATGG - Intergenic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084215620 11:67645501-67645523 CTCTGGCAGGGTAGGGGAGGGGG + Intronic
1084257864 11:67955177-67955199 CCCTAGCAGGGGAAGGGGCGGGG - Intergenic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1084546086 11:69815834-69815856 GCCTAGGAGGGGAAGGGGGATGG - Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084923926 11:72496275-72496297 GGCTGGGAAGGGAAGGGGGAAGG + Intergenic
1084952711 11:72675494-72675516 CTCGGGCTGGGGAGTGGGGAGGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085223516 11:74896430-74896452 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1085337396 11:75706556-75706578 CTCGTGCAGGGCAAGTGGGAGGG - Intergenic
1085395850 11:76206725-76206747 CTCTGGCCGGGGCAGCCGGAAGG + Intronic
1085398095 11:76217799-76217821 AGGTGGCCGGGGAAGGGGGAGGG + Intergenic
1085445385 11:76597703-76597725 CAGTGGCAGGGGAGCGGGGACGG + Intergenic
1085527047 11:77170364-77170386 CTCAGGCAGGGCAAGGAGGCTGG + Intronic
1085535565 11:77215256-77215278 CTCAGGGAGGGGAAGTGGAAGGG + Intergenic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1086098192 11:83071492-83071514 CTCTGGCGGGGGAAGGTTGCTGG + Intronic
1086143383 11:83523823-83523845 CAATGGCAGGGGCAGGGGGCGGG + Intronic
1086198892 11:84176152-84176174 GTCTGCTAGGGGGAGGGGGATGG - Intronic
1086468132 11:87076269-87076291 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1087313323 11:96576881-96576903 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1088051238 11:105517851-105517873 GTTTGCCAGGTGAAGGGGGAAGG + Intergenic
1088154789 11:106790227-106790249 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1088344355 11:108806204-108806226 CTCTGGGAGGCCAAGGCGGAGGG - Intronic
1088685600 11:112282032-112282054 CTGTGGCAGGGGATGAGGGCAGG + Intergenic
1089012378 11:115141750-115141772 ATCTGGGTGGGGAAGTGGGAGGG - Intergenic
1089167218 11:116486450-116486472 CTCTGGCTGGGAGAGGGGCATGG - Intergenic
1089207933 11:116779895-116779917 CTATGTCGGGGGAGGGGGGAGGG + Intronic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089391938 11:118108238-118108260 CTCTGGCTGGGTAAGTGGTAGGG - Intronic
1089536272 11:119162324-119162346 CAGTGGCTGGGGAAGGGGTAGGG - Exonic
1089616358 11:119696948-119696970 ACCTGGCAGGGGAGGAGGGAGGG + Intronic
1089630232 11:119779761-119779783 CTCTGGCAGTGTAAAGGGCAGGG + Intergenic
1089637294 11:119823375-119823397 CTCTGGGAGGTGCAGGGAGAGGG + Intergenic
1089774518 11:120826952-120826974 ACCTGGCAGGGGGAAGGGGAAGG + Intronic
1090073606 11:123564747-123564769 CTCTTGCTGAGGATGGGGGAGGG + Intronic
1090384003 11:126346001-126346023 GGATGGCAGGGGAAGGAGGAGGG - Intergenic
1090464748 11:126924180-126924202 CTGAGCCAGGGAAAGGGGGAAGG - Intronic
1090677048 11:129008083-129008105 CACTACCAGGGGATGGGGGAGGG + Intronic
1090681590 11:129064980-129065002 CTCTGGCAGGGAAAACTGGATGG + Intronic
1091015839 11:132050136-132050158 TGCTGGCAGGGGACTGGGGAAGG + Intronic
1091051106 11:132373553-132373575 CACTGCCAGGAGATGGGGGAGGG - Intergenic
1091135425 11:133184425-133184447 CGCTGGCATGGGATGGGGAAGGG + Intronic
1091266582 11:134276444-134276466 CCCTCGGAGGGGAAGCGGGAGGG - Intronic
1091288414 11:134422447-134422469 TCCTGCCAGGGAAAGGGGGATGG + Intergenic
1091387738 12:105319-105341 CGCTGGCAGGGGCAGGGTGGGGG + Intronic
1091583236 12:1801159-1801181 CTGAGGCAGGGGCAGGGGGTGGG - Intronic
1091601806 12:1922401-1922423 CTCGGGGAGGGGGACGGGGACGG + Intergenic
1091668931 12:2438624-2438646 ATGTGGCTGGGGAACGGGGAGGG + Intronic
1091755925 12:3051493-3051515 CTCTGTCAAGGGAAGGGGAGAGG - Intergenic
1091785273 12:3239523-3239545 CTCGGGCAGTGGAGCGGGGAAGG - Intronic
1091791219 12:3273323-3273345 CTTCGGCTGGGGAAGGGGCAGGG + Intronic
1091811583 12:3403310-3403332 CTATGGGAGGGGTTGGGGGAAGG + Intronic
1092162798 12:6325173-6325195 CTTGGGGAGGGGGAGGGGGAGGG - Intronic
1092241935 12:6840799-6840821 AGCTGGCAGGGGTGGGGGGAAGG - Intronic
1092341231 12:7677957-7677979 CTTTGGGAGGCCAAGGGGGATGG - Intergenic
1092468785 12:8760086-8760108 GTGGGGTAGGGGAAGGGGGAGGG - Intronic
1092700976 12:11230528-11230550 GGCTGGGAAGGGAAGGGGGAAGG - Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1093041377 12:14383803-14383825 CTCTGGGAGGCCAAGGCGGAAGG - Intronic
1093356511 12:18173842-18173864 CTCCTCTAGGGGAAGGGGGAGGG + Intronic
1093567663 12:20627566-20627588 CTCTGGCTGGGAAAGGGTGGGGG - Intronic
1094016236 12:25867189-25867211 TTCTGGCAGGGGAAGTGGTTGGG - Intergenic
1094380703 12:29840366-29840388 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1094419665 12:30257415-30257437 CACTGTCAGGGGATGGGGGAGGG - Intergenic
1095239427 12:39839281-39839303 CTCTGGCAGGGAAAGAAGGCAGG - Intronic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095403457 12:41841377-41841399 CCCTAGCTGGGGAAGGGAGAAGG - Intergenic
1095943009 12:47738615-47738637 CTGTGGCCTGGGAAGGGGCAGGG - Intronic
1095954231 12:47797336-47797358 TTCAGGCAAAGGAAGGGGGAAGG - Intronic
1096066910 12:48748346-48748368 ATCTGGCAAGGGAAGGGCAAGGG + Intergenic
1096183943 12:49566284-49566306 GGCTGGCAGGGGAAGGGGGCTGG - Intronic
1096656374 12:53095057-53095079 CTCTGGGAGGCCAAGGCGGAAGG + Intergenic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096781054 12:53992333-53992355 CTATAGAAGGGGAAGGGGAAAGG - Intronic
1096960220 12:55569930-55569952 CTCTGGTAGGGCAAGGCAGAAGG - Intergenic
1097017625 12:55998535-55998557 CCCTGTCAGGGGCAGGGGGAGGG + Intronic
1097113014 12:56676123-56676145 GGCTGGGAGGGGGAGGGGGAGGG + Intronic
1097216988 12:57421851-57421873 CTCTGGGAGGCCAAGGGGGGCGG + Intronic
1097333490 12:58357087-58357109 CTCTGGCAGAGGAAGTGGTCAGG - Intergenic
1097601117 12:61694503-61694525 CTCAGCCAGGGGATAGGGGATGG - Intergenic
1097692104 12:62743105-62743127 CTTTGGGAGGCCAAGGGGGATGG + Intronic
1097769983 12:63572331-63572353 CTCTGCCTGGGGAAAGGGGAAGG + Intronic
1097889937 12:64767782-64767804 CTCCGGCGGGGGGGGGGGGAGGG + Intergenic
1097899404 12:64857960-64857982 CACTGCCAGGGGATTGGGGAGGG + Intronic
1097916061 12:65021562-65021584 CGCTGGCAGTGGGAGGAGGAGGG - Intergenic
1097999119 12:65922083-65922105 CTCTGGTAGGGCCATGGGGAAGG + Intronic
1098641097 12:72839185-72839207 CTCAGGCTGGGGAAGGAGCAAGG + Intergenic
1099206077 12:79727887-79727909 CTCTAGCAGGGAAAGTGGGGTGG - Intergenic
1100511752 12:95281787-95281809 CTTTGGGAGGTGAAGGCGGATGG - Intronic
1100635448 12:96431114-96431136 CTCTGGTAGGCCAAGGCGGACGG - Intergenic
1100904793 12:99285695-99285717 CACTGCCAGGGGATGAGGGAGGG - Intronic
1100956462 12:99914674-99914696 CTCTGATAGGGAAAGGGGGAGGG + Intronic
1101026257 12:100609489-100609511 TGCTGCCAGGGGATGGGGGAGGG + Intronic
1101211501 12:102539373-102539395 CTCTGGCTGGGGATGGAGAATGG + Intergenic
1101351190 12:103930863-103930885 CTCCGGGCGGGGAGGGGGGAGGG - Intronic
1101358823 12:104007294-104007316 ATCTGGAAAGAGAAGGGGGAGGG - Intronic
1101626417 12:106447248-106447270 CTCTTGTAGGGGGAGTGGGAGGG - Intronic
1102055886 12:109896188-109896210 CTCTGGGAGGCCAAGGCGGATGG - Intergenic
1102277916 12:111597992-111598014 GTCTGGCGGGGGAAGGAGGAAGG + Intronic
1102303150 12:111785374-111785396 TTCTGGCAGGGGAAAAGGGGAGG + Intronic
1102439216 12:112948730-112948752 CTCAGAGAGGGGAAGTGGGAGGG - Intronic
1102484018 12:113244047-113244069 AACTGGCAGGGGATGGGGCAAGG - Intronic
1102527100 12:113519987-113520009 CTCAGGCAGGGGTGGGGGGGCGG + Intergenic
1102811935 12:115832007-115832029 CTTTGGGAGGCCAAGGGGGAAGG - Intergenic
1102893735 12:116581951-116581973 CTCTGGCAGGGTGAGGGTGGGGG - Intergenic
1103119443 12:118368913-118368935 CTTTGGCAGGTGGAGGCGGATGG + Intronic
1103335233 12:120184282-120184304 CTCAGGCAGAGGCAGGGGCAAGG + Intronic
1103449873 12:121021057-121021079 CTCTGGAAGGGAGAGGGAGAAGG + Exonic
1103558778 12:121781243-121781265 CTCTGACGGGTGAAGGGGAAGGG + Exonic
1103594242 12:122013928-122013950 CTCTGGGTGGGGAAGAGGGGAGG + Intergenic
1103609843 12:122116623-122116645 TTCAGGCAGGGGCAGGGGCAGGG - Intronic
1103678108 12:122672612-122672634 CTCTGGGAGGGGAGAGGGGCTGG - Intergenic
1104235860 12:126936120-126936142 CTCTGGGAGGCCAAGGTGGATGG + Intergenic
1104462933 12:128969956-128969978 CACAGGCAGAGGCAGGGGGAGGG - Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104556929 12:129809062-129809084 CTCTGGGAGGGCAAGGCGGGTGG + Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1105389233 13:19959248-19959270 CTCCGGCGGGGGGCGGGGGAGGG + Intronic
1105519916 13:21122743-21122765 ATCTGGCAGGGGGCAGGGGACGG - Intergenic
1106443226 13:29799208-29799230 CTTTGCCGGGGGCAGGGGGAAGG - Intronic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1106773688 13:32987416-32987438 CTCTGGCATGAGAAGGGGCTGGG + Intergenic
1106847539 13:33752292-33752314 CTCAAGCAGGGGAAGGGTGTTGG + Intergenic
1107715052 13:43191788-43191810 CTCTGAGAGGCGGAGGGGGAGGG + Intergenic
1107814983 13:44236664-44236686 CTACTGCAGGGGAATGGGGAGGG + Intergenic
1107910297 13:45099643-45099665 CTCTGGGAGGCCAAGGCGGATGG + Intergenic
1107926046 13:45262967-45262989 CTCTGGGAGGCCAAGGGGGGAGG - Intronic
1107937961 13:45361156-45361178 CTTTGGGAGGTGGAGGGGGAAGG - Intergenic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1108373491 13:49792814-49792836 CCCTTGCAGGGGAAGAGGGCAGG - Exonic
1108512287 13:51167301-51167323 ATCTGGGAGGGGAAGAGGAAGGG + Intergenic
1109282892 13:60377561-60377583 CTCTGGGAGGGCAAGGTGGGCGG + Intergenic
1109289847 13:60460759-60460781 CTTTGGGAGGCCAAGGGGGACGG + Intronic
1110253865 13:73410077-73410099 CTCTTGGAGGGTAAGGTGGACGG + Intergenic
1110774755 13:79394875-79394897 CTCTGGGAGGCCAAGGTGGACGG - Intronic
1110916746 13:81030608-81030630 CTCTGCCTGGGGAAAGGAGATGG - Intergenic
1111542769 13:89689873-89689895 CTCTGCCTGTGGAATGGGGAGGG + Intergenic
1111832810 13:93351424-93351446 GTCTGGGAAGGGTAGGGGGAAGG + Intronic
1112053933 13:95672079-95672101 CACTGCCAGGGGATAGGGGAGGG + Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112324722 13:98436237-98436259 CTCAGGCAGGGGGCTGGGGAGGG - Intronic
1112351597 13:98639505-98639527 CTTTGGGAGGCCAAGGGGGAAGG + Intergenic
1112810203 13:103209510-103209532 CTTTGGCAGGCCAAGGTGGACGG - Intergenic
1112912995 13:104511751-104511773 ATAGGTCAGGGGAAGGGGGAGGG - Intergenic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113149901 13:107252035-107252057 CTCTGGCAGTGGGAGAGGGCAGG + Intronic
1113516182 13:110901795-110901817 CTCTGGGAGGCCAAGGTGGAAGG + Intronic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1114050487 14:18916727-18916749 AGCTGGCATGGGAAGGAGGATGG - Intergenic
1114112070 14:19485205-19485227 AGCTGGCATGGGAAGGAGGATGG + Intergenic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114392232 14:22322455-22322477 CTCCTGCAGGGCATGGGGGAGGG - Intergenic
1114506330 14:23217269-23217291 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1114562318 14:23602329-23602351 CTCTGTCAGGGGAGGGGTGCCGG - Intergenic
1115085772 14:29513171-29513193 CTCTGCCAGGGCAAGGTGGAAGG - Intergenic
1115133965 14:30086738-30086760 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1115288041 14:31739326-31739348 CTCTGGGAGGCCAAGGCGGACGG - Intronic
1115437234 14:33388484-33388506 CTGTGGCAGGTGAATGGGGGCGG + Intronic
1115776797 14:36724329-36724351 CTCAGGCAGGGGTATGGGGAAGG - Intronic
1115903543 14:38181757-38181779 CTCTGGCAGGTTAAGTGAGATGG + Intergenic
1115947527 14:38678969-38678991 CACTGGGAAGGGTAGGGGGAGGG - Intergenic
1116057931 14:39886291-39886313 CTCTGCCTTGGGAAAGGGGAGGG + Intergenic
1116434107 14:44877495-44877517 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116448668 14:45039897-45039919 CTGTGGCAGGGGAAGTGCGCTGG - Intronic
1116481131 14:45392406-45392428 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116583574 14:46674239-46674261 TGCTGCCAGGGGATGGGGGAGGG - Intergenic
1116634993 14:47383196-47383218 GCCTGTCAGGGGATGGGGGAGGG + Intronic
1116889190 14:50250399-50250421 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1117056983 14:51922518-51922540 CTCTGGTAGGGGTAGGGGTCAGG - Intronic
1117110251 14:52446201-52446223 CACTGCCAGGGGATGGGAGAAGG - Intronic
1117218632 14:53578703-53578725 ATGTGGCAGGGGGATGGGGAAGG + Intergenic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117683185 14:58226351-58226373 CTCTGGGAGGGCAAGGTGGGAGG - Intronic
1117994966 14:61469810-61469832 CACTGGCAGGTTAGGGGGGAAGG + Intronic
1118096786 14:62546317-62546339 CACTGCCAGGGGTTGGGGGAGGG - Intergenic
1118309151 14:64680055-64680077 CTCTGGGAGGGGAAGAAGAAAGG - Intergenic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118638417 14:67769316-67769338 CTCTGTCTGGGGAAGGGCTAAGG + Intronic
1118769839 14:68935352-68935374 CTCTGACAGGAGAAGGGAGAGGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118905382 14:70019614-70019636 AGCTGGGAGGGGAAGGGGCAAGG + Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119322712 14:73741102-73741124 CTTCGGCAGTGGAAGGGGCAGGG - Intronic
1119487737 14:75002809-75002831 CTCAGGCAGAGGAAGGGGGCGGG + Intergenic
1119601862 14:75982043-75982065 CTCTGGCCTGGGGTGGGGGAGGG + Intronic
1119857467 14:77911286-77911308 CCCTGGCAGGGAAATGGAGAAGG - Intronic
1120255222 14:82110101-82110123 CTCCAGGAGGGGAAGGGAGAGGG + Intergenic
1120275834 14:82371123-82371145 CTCTTCCTGGGGAAAGGGGAGGG + Intergenic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120941683 14:89955845-89955867 CTCCGGAAGGGGAAGGGGCCGGG + Intronic
1120949323 14:90026601-90026623 GTGGGGCAGGGGGAGGGGGAGGG - Intronic
1121076974 14:91076999-91077021 CTCTGGGAGGCCAAGGTGGAAGG + Intronic
1121273390 14:92652192-92652214 GTCTGGGAGGGGCAGTGGGAAGG - Exonic
1121505378 14:94473129-94473151 TGCTGGTGGGGGAAGGGGGAAGG - Intronic
1121537244 14:94699322-94699344 CTCAGAGAGGGGAAGGGGTAGGG + Intergenic
1121956658 14:98219563-98219585 CTTTGGCAGGGGAGTTGGGAAGG + Intergenic
1121958007 14:98231558-98231580 CTCTGGCAGGGTAGGGTGGAAGG - Intergenic
1122058840 14:99123288-99123310 CAAGGGCAGGGGAAGAGGGAAGG - Intergenic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122263416 14:100535697-100535719 CTTCTGCAGAGGAAGGGGGAGGG + Intergenic
1122316541 14:100828685-100828707 CTATGGCATGGGAGGGGGGCAGG - Intergenic
1122317097 14:100832441-100832463 CACCGCCAGGGTAAGGGGGAGGG - Intergenic
1122328867 14:100899577-100899599 CTCTCCCAGGGGAAGGGAGAAGG + Intergenic
1122343744 14:101045386-101045408 CTCTGGCAGGGGTGGGGCAAGGG + Intergenic
1122360599 14:101159642-101159664 TTCTGGCAAGGAAAGGGGAAAGG - Intergenic
1122372444 14:101236070-101236092 GTCTGGCAGGGACAGGGGGATGG - Intergenic
1122442564 14:101742289-101742311 CTTTGGGAGGGCAAGGTGGATGG - Intergenic
1122577664 14:102752194-102752216 CTCTCGCAGGGAAGGGGGAAGGG - Intergenic
1122885877 14:104710030-104710052 CTCTGGCAGGGACAGGTGGGGGG + Intronic
1123053720 14:105559768-105559790 CACGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078305 14:105680191-105680213 CACGGGCAGGGGCAGGGGCAGGG - Intergenic
1123113057 14:105882019-105882041 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123115406 14:105892169-105892191 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123119657 14:105910887-105910909 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123403884 15:20009430-20009452 CTCTGGCAGCAGAAGAGGGGAGG + Intergenic
1123474847 15:20582319-20582341 CTCTGGCAGAGGCGGGGGCAGGG - Intergenic
1123513224 15:21016076-21016098 CTCTGGCAGCAGAAGAGGGGAGG + Intergenic
1123643164 15:22418038-22418060 CTCTGGCAGAGGCGGGGGCAGGG + Intergenic
1124005443 15:25792390-25792412 GACTGGCTGGGGCAGGGGGAGGG - Intronic
1124484019 15:30100277-30100299 CTATGGCAGGGGAGGTGGGTGGG + Intergenic
1124519561 15:30396947-30396969 CTATGGCAGGGGAGGTGGGTGGG - Intergenic
1124539092 15:30569274-30569296 CTATGGCAGGGGAGGTGGGTGGG + Intergenic
1124551308 15:30683481-30683503 CTCTGGCAGGGACTGGGAGAGGG - Intronic
1124679939 15:31722184-31722206 CTCTGGCAGGGACTGGGAGAGGG + Intronic
1124759558 15:32438298-32438320 CTATGGCAGGGGAGGTGGGTGGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125461925 15:39915629-39915651 CTTTGGCAGGGTGAGGCGGATGG + Intronic
1125473770 15:40030123-40030145 CTCAGGCAGGGGTTGGGGGGTGG - Intronic
1125566211 15:40680378-40680400 TGCTGCCAGGGGATGGGGGAGGG + Intergenic
1125872725 15:43116893-43116915 CTCTGGGAGGCCAAGTGGGAGGG - Intronic
1125959781 15:43819902-43819924 CTCTGGGAGGCCAAGGCGGACGG + Intronic
1126440603 15:48683902-48683924 CTCTGCCTGGGGAAAGTGGAGGG + Intergenic
1126494365 15:49274051-49274073 CTCTGGCAGGAAATGGGGAAGGG - Intronic
1127155692 15:56122767-56122789 CTCTGACTAGGGAAAGGGGAAGG - Intronic
1128072621 15:64807195-64807217 CTCTTGCAGGCGTTGGGGGAGGG - Intergenic
1128211938 15:65909182-65909204 GTATAGCAGGGGAAGGGGGTAGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128263495 15:66249566-66249588 CTCTTGGATGGGGAGGGGGAGGG + Intronic
1128387644 15:67162117-67162139 CACTGGCCTGGGAAGGGGAAAGG - Intronic
1128802913 15:70508364-70508386 CTCTGGAAGGGGCAGGGGAGGGG + Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129182518 15:73886211-73886233 CCCAGGCATGGGAAGGGGGCTGG + Intronic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129237062 15:74230014-74230036 GGCTGGCTGGGGAAGAGGGATGG + Intergenic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1129600988 15:76997992-76998014 CTCTGGGAGGCCAAGGTGGATGG + Intronic
1130068989 15:80630583-80630605 CTTTGGCAGGCCAAGGTGGAAGG - Intergenic
1130114486 15:80994809-80994831 CTCTGGCAGGGCGAGGTGGATGG - Intergenic
1130323164 15:82856834-82856856 CTCTGGCTGTGGAAGGGGACAGG + Intronic
1130336103 15:82958567-82958589 CTCTGGCAGCAGATGGGAGAAGG + Intronic
1130441098 15:83955253-83955275 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1130511854 15:84595884-84595906 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
1130745809 15:86652826-86652848 CTCTGGCAGGGGAAGTGAAAAGG - Intronic
1131109030 15:89752797-89752819 CTTTGGCAGGCCAAGGGGGGTGG + Intergenic
1131408564 15:92186696-92186718 CCCTGGCATGGGAAAGGAGAAGG - Intergenic
1131791011 15:95965584-95965606 CTTTGGGAGGCCAAGGGGGATGG - Intergenic
1132104330 15:99051768-99051790 CTCAGACAGGGGATGGGGAAGGG - Intergenic
1132674769 16:1117074-1117096 CCCAGGCAGGGGAGAGGGGAGGG - Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132894484 16:2221974-2221996 CTTTGGGAGGCCAAGGGGGACGG + Intergenic
1133026139 16:2989716-2989738 CCCTGGCTGGGGAGAGGGGAAGG + Intergenic
1133118275 16:3590589-3590611 CGCTGTCAGGGAAAGGGGGCTGG - Exonic
1133249568 16:4471827-4471849 CTTTGGGAGGGTAAGGGGGATGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133324056 16:4932659-4932681 CTCTGAGAGGGTAAGGCGGACGG - Intronic
1133749706 16:8714906-8714928 CCAGGGTAGGGGAAGGGGGATGG - Intronic
1134494765 16:14724106-14724128 CTCTGGGAGGGCGAGGCGGATGG - Intronic
1134500148 16:14763226-14763248 CTCTGGGAGGGCGAGGCGGATGG - Intronic
1134526690 16:14949838-14949860 CTCTGGGAGGGCGAGGCGGATGG - Intronic
1134545716 16:15106510-15106532 CTCTGGGAGGGCGAGGTGGATGG + Intronic
1134580431 16:15365824-15365846 CTCTGGGAGGGCGAGGCGGATGG + Intronic
1134661042 16:15984857-15984879 CTTTGGCAGGTGAAGGTGGGAGG + Intronic
1134714268 16:16348315-16348337 CTCTGGGAGGGCGAGGCGGATGG - Intergenic
1134722143 16:16391679-16391701 CTCTGGGAGGGCGAGGCGGATGG - Intronic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1134777383 16:16864981-16865003 GGGTGGCAGGGGAAGGGGTAGGG - Intergenic
1134945284 16:18320190-18320212 CTCTGGGAGGGCGAGGCGGATGG + Intronic
1134952548 16:18360343-18360365 CTCTGGGAGGGCGAGGCGGATGG + Intergenic
1135035334 16:19072424-19072446 CTCTGGCACGGTAGGGGGCAGGG - Intronic
1135309206 16:21392120-21392142 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1135413395 16:22251339-22251361 CCCTGGCATGGAAAGGGGGCAGG - Intronic
1135607605 16:23836974-23836996 CTCTGGGAGGGGGACTGGGAAGG - Intronic
1135842441 16:25888936-25888958 GTCTGGCTCAGGAAGGGGGATGG - Intronic
1136148787 16:28332447-28332469 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136150500 16:28344943-28344965 CTCTGGGAGGGCGAGGCGGATGG + Intronic
1136166737 16:28458781-28458803 CTCTGGGAGGGCGAGGCGGATGG + Intronic
1136196238 16:28656251-28656273 CTCTGGGAGGGCGAGGCGGATGG - Intronic
1136212579 16:28770376-28770398 CTCTGGGAGGGCGAGGCGGATGG - Intronic
1136257300 16:29050290-29050312 CTCTGGGAGGGCGAGGCGGATGG - Intronic
1136305949 16:29371250-29371272 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1137225749 16:46506651-46506673 CTCTGCCTGGGGAAATGGGAGGG + Intergenic
1137245164 16:46696896-46696918 CTTTGGGAGGTGAAGGGGGCGGG - Intronic
1137273444 16:46918124-46918146 CTCTGGCAGGGAAAAGTGGGTGG + Intronic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1137537950 16:49341824-49341846 CTCTGGCAGAGGGAGTGGCAGGG + Intergenic
1137626242 16:49910565-49910587 TTCTGGTGGAGGAAGGGGGAGGG - Intergenic
1137869306 16:51934129-51934151 CCCAGGCAGAGGAAGGGGCAAGG + Intergenic
1138524319 16:57593127-57593149 CTCTGGCAGGGGGTGGAGGCAGG + Intergenic
1138779640 16:59767438-59767460 GTCAGTCAGGGGACGGGGGAAGG - Intergenic
1139482426 16:67237822-67237844 CTGTTGCTGGGGAAGGGGAAGGG + Intronic
1139526152 16:67518118-67518140 CTCGGGCTGGGGAAGTGAGAGGG + Intergenic
1139711752 16:68781580-68781602 CTTTGGGAGGCCAAGGGGGATGG - Intronic
1140498259 16:75409100-75409122 CTCTGGGAGGCGAAGGTGGGTGG - Intronic
1140724817 16:77802371-77802393 CTTTGGGAGGGCAAGGGGGGTGG + Intronic
1141094963 16:81156687-81156709 CTTTGGCAGGCCAAGGTGGACGG - Intergenic
1141110760 16:81269007-81269029 CTTTGGGAGGGGAAGGGAGGAGG - Intronic
1141474261 16:84261864-84261886 CTCTGGGAGGCCAAGGTGGACGG - Intergenic
1141534083 16:84666823-84666845 CTCTGGGAGGCCAAGGGGGACGG + Intronic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141693917 16:85611314-85611336 GGCTGGGAGGGGGAGGGGGAGGG - Intergenic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1141820491 16:86442224-86442246 GTCTGGCAGGGCAGGGAGGACGG + Intergenic
1142067582 16:88071609-88071631 CTCTGCCTTGGGAATGGGGAGGG + Intronic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1142234735 16:88916647-88916669 GGCTGGGTGGGGAAGGGGGATGG + Intronic
1142688866 17:1592928-1592950 CTGGGGCAGGGGAAGGGCGGTGG - Intronic
1142759274 17:2033956-2033978 TTGTGGGAGGGAAAGGGGGAAGG - Intronic
1142851196 17:2705633-2705655 CTCTGGGAATGAAAGGGGGAGGG - Intronic
1142856868 17:2735672-2735694 CTCTGGGAGGCCAAGGCGGATGG - Intergenic
1142862471 17:2771224-2771246 CTCTGGCATGGGAAAGGAGGCGG - Intergenic
1142976216 17:3646130-3646152 ATCAGGCAGGGGAAGTGAGATGG + Intronic
1143153129 17:4819238-4819260 CTCTGGCAGGGAGAGGGTGTGGG + Intronic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143544425 17:7588086-7588108 CTCTGGCAGGTCTAGGCGGAAGG + Exonic
1143587107 17:7855799-7855821 CTCAGGCAGGGGTGGGGGCAGGG - Exonic
1143621782 17:8084911-8084933 CTCTGGCAGGGGTGGGTGCAAGG + Intronic
1143639579 17:8188521-8188543 TTCTGGCTGGGGAAGTGGTATGG + Exonic
1143660197 17:8319874-8319896 CTTTGGGAGGTGAAAGGGGACGG - Intronic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1143990356 17:10954454-10954476 CTCAGGCAGGGGAGGTGGGCAGG - Intergenic
1144027883 17:11294421-11294443 CTTTGGCAGGATAAGGGGCAGGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144649614 17:16999037-16999059 CAGGGGCTGGGGAAGGGGGAAGG - Intergenic
1144889716 17:18487638-18487660 CTCTGGCAGGTGATGGTGAACGG + Exonic
1145040986 17:19578437-19578459 CTTTGGGAGGGCAAGGTGGAAGG - Exonic
1145142495 17:20456658-20456680 CTCTGGCAGGTGATGGTGAACGG - Exonic
1145252216 17:21302853-21302875 CTCTGCCACGGGAGGGGAGATGG + Intronic
1145267678 17:21388316-21388338 CGCTGGCACGGGATGGGGTATGG - Intronic
1145793410 17:27642229-27642251 CTCTGGCAGGTGATGGTGAACGG + Exonic
1145808215 17:27749775-27749797 CTCTGGCAGGTGATGGTGAACGG + Intergenic
1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG + Intergenic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145903086 17:28500395-28500417 GTTTGGCAAGGGAAGGGGAAGGG + Intronic
1145908988 17:28531945-28531967 TTCTGGAAGGGAAAGAGGGAGGG + Intronic
1146077469 17:29744326-29744348 CTCTGGCAGGGCCAGGCCGAGGG + Intronic
1146407790 17:32554205-32554227 CTCAGGTAGGGGCAGGGGCAGGG - Intronic
1146497759 17:33338072-33338094 TTCTGGCAGGGCAGGGAGGATGG + Intronic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146497792 17:33338279-33338301 CTCTGGAAGGGCAAGGAGAATGG + Intronic
1146992593 17:37288652-37288674 CTCTGGGAGGGCAAGGCAGAAGG + Intronic
1147194944 17:38760258-38760280 AGCTGGCAGGAGAAGGGAGAGGG + Intronic
1147375105 17:40018553-40018575 CACGGGCAGGGGAGGTGGGAGGG - Intergenic
1147429233 17:40361607-40361629 CACTGGCTGGTGAAGGGGGAGGG + Intronic
1147868546 17:43570865-43570887 CTCTGGCATAGGAGGTGGGATGG - Intronic
1147878948 17:43641814-43641836 CCCTGGCTGGGGAAGGAAGAGGG + Exonic
1147992487 17:44343681-44343703 ATGAGGCAGGGGCAGGGGGATGG - Intergenic
1148045871 17:44744007-44744029 CTTTGGGAGGCCAAGGGGGAAGG + Intronic
1148084755 17:44987435-44987457 CTCTGACAGGGGAGGTGGGATGG + Intergenic
1148203821 17:45767246-45767268 CTCAGGTAGGGGATAGGGGAAGG - Intergenic
1148206163 17:45781561-45781583 CTCTGGCTGGGGCTGAGGGAAGG + Intergenic
1148218660 17:45847697-45847719 GTCTAGCTGGGGGAGGGGGAGGG + Intergenic
1148398543 17:47331737-47331759 GTTTGCCAGGGGATGGGGGAAGG - Intronic
1148644496 17:49211347-49211369 CTCATGCAGAGGCAGGGGGATGG + Intronic
1148698583 17:49575509-49575531 CTCTTGGAGAGGAAGGGAGAGGG - Intergenic
1148722357 17:49763460-49763482 CTATTGCACGGGGAGGGGGAGGG - Intronic
1148835405 17:50463295-50463317 CTCAGGCAGGGGTGGGGGGCTGG + Intronic
1148858737 17:50593139-50593161 CTCTTGCAGGGAAGGAGGGAGGG + Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149434287 17:56620016-56620038 CTCTGGCAAGGGAGGGTGAACGG - Intergenic
1149458886 17:56811364-56811386 CTCAGGCAGGGCAGGGGGTAGGG - Intronic
1149703594 17:58675623-58675645 GTCTGTCTGGGGAAGGGAGATGG - Intronic
1149718289 17:58816553-58816575 GGATGGCAGGGGATGGGGGAAGG - Intronic
1149738143 17:59016148-59016170 CTCTGGGAGGCTAAGGCGGATGG + Intronic
1149998364 17:61416732-61416754 CTCCAGGAGGGGAAGGGGGCAGG - Intergenic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1150441114 17:65192272-65192294 GACTGGGAAGGGAAGGGGGAAGG + Intronic
1150479480 17:65498353-65498375 CTTTGGGAGGCCAAGGGGGAAGG - Intergenic
1150719107 17:67599099-67599121 CTCTGGGAGGCCAAGGTGGATGG - Intronic
1150783378 17:68141963-68141985 CTTTGGTAGGCCAAGGGGGATGG - Intergenic
1150846659 17:68665686-68665708 CTCTGGGAGGCCAAGGCGGAAGG + Intergenic
1150973094 17:70052997-70053019 TTCTGGCAGAGGAAGGGGAAAGG - Intergenic
1151147921 17:72058391-72058413 CTCTGGGAGGGTGGGGGGGATGG - Intergenic
1151480836 17:74369331-74369353 CACAGGCAGGGGAAGGGGTCGGG - Intronic
1151538275 17:74750583-74750605 CATTGGCAAGGGGAGGGGGAAGG + Intronic
1151561343 17:74871541-74871563 CCTTCACAGGGGAAGGGGGAGGG + Intronic
1151582800 17:74989581-74989603 CCCTGGCAGGTGAAGGAGGCAGG + Intronic
1151728918 17:75899601-75899623 CTCGGGCAGGGAAGGGGGGGAGG + Exonic
1151767088 17:76138220-76138242 CTCTGGCAGGGGAGAGGAGGGGG + Intronic
1151770729 17:76158920-76158942 CTGTGGCAGAGTAAAGGGGAGGG - Intronic
1151816618 17:76474338-76474360 GTCTGGCAGGGGTAGGAGGGAGG + Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152078239 17:78171432-78171454 CTCTGGGAGGGGACGCGGGCAGG - Intronic
1152083563 17:78203778-78203800 CTTTGGAAGGGCAAGGCGGACGG + Intronic
1152175540 17:78784531-78784553 CTCTGGAAGCTGAAGTGGGAGGG + Intergenic
1152245425 17:79182708-79182730 CTCTGGCCGGGGAGGGGGCTGGG - Intronic
1152266118 17:79295878-79295900 CTGTGGCAGGGCATGGGGAAGGG + Intronic
1152418824 17:80181004-80181026 CTTTGAGAGGCGAAGGGGGAAGG - Intronic
1152427035 17:80223585-80223607 CTCGGGCAAGAGCAGGGGGATGG - Intronic
1152722197 17:81928556-81928578 GTCTGGCAGGGACAGGCGGAGGG - Intergenic
1152790528 17:82276356-82276378 CTCTGGAAGGCCAAGGTGGATGG - Intergenic
1152814590 17:82399904-82399926 CTCTGGGGAGGGAAGGGGGATGG + Intronic
1152870507 17:82751135-82751157 ATCTGGGAGGGGTCGGGGGAAGG - Exonic
1153070088 18:1095670-1095692 CTCTGGTAGGGGACTGAGGAAGG + Intergenic
1153268344 18:3294522-3294544 CTCTTACAGGAGAAGAGGGAAGG + Intergenic
1153302776 18:3606300-3606322 TTCTGGCAGGGGAAGGAAGCGGG - Intronic
1153688282 18:7567486-7567508 CCCGGGCAGGGGAAGGGGAGAGG + Exonic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155288126 18:24312890-24312912 CTCTGGGAGGGCAAGGTGGGCGG + Intronic
1155288763 18:24319899-24319921 CTCTGGGAGGCTAAGGCGGAAGG + Intronic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1155499592 18:26473403-26473425 CTGTAGCAGGGATAGGGGGAGGG + Intronic
1155509273 18:26560622-26560644 GTCTGGCAGGGGGTGGGGAAGGG + Intronic
1155649958 18:28129582-28129604 CTCTGGCAGGCCAAGGTGGGAGG + Intronic
1156263551 18:35466732-35466754 GCCTGGCAGGGGAATGGGAAAGG + Intronic
1157065200 18:44341706-44341728 CTCTGCCTGGGGAAAAGGGAGGG - Intergenic
1157142460 18:45123399-45123421 GTGTGGCGGGGGCAGGGGGATGG + Intergenic
1157267712 18:46242573-46242595 CTTTGGCATGGGAAGGGCAAAGG - Intronic
1157414118 18:47488079-47488101 CCCTGGCAGGGGCAGGAGAAAGG + Intergenic
1157525526 18:48377393-48377415 CTCTGCTTGGGGAAGGGGGTGGG + Intronic
1157561002 18:48645894-48645916 CTCTGGCAGGGGAAAAGGGCAGG - Intronic
1157739918 18:50083341-50083363 CTCTGGGAGAGGAAAGGGGCTGG - Intronic
1157936915 18:51883574-51883596 CACTGCCAGGGGCTGGGGGAGGG - Intergenic
1158307082 18:56117571-56117593 CTCTGCCAGGGGAAGAGGAGGGG - Intergenic
1158481217 18:57823644-57823666 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1158505786 18:58044760-58044782 CGCCGGCAGGGGGAGGGGAAAGG + Intronic
1158962777 18:62600506-62600528 CTGAGGCAGAGGTAGGGGGAGGG + Intergenic
1159080685 18:63731842-63731864 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1160377770 18:78426782-78426804 CTCTGGGATGGGTAGGGGGGAGG + Intergenic
1160488899 18:79320316-79320338 CTCTGCCAGGGGAAGGGGAGGGG + Intronic
1160798516 19:956577-956599 CTCAGGCAGCTGAAGGGGAAAGG + Intronic
1160814041 19:1027159-1027181 CTTTGGGAGGGGAAGGGGCATGG + Intronic
1160900753 19:1426961-1426983 CTCTGGCTGGGGTAGAGGGCAGG - Intronic
1161160295 19:2757877-2757899 CTCCTGCAGGGGAAGGTGAAGGG - Intronic
1161170152 19:2808456-2808478 CCCGGGCAGGGGCAGGGGCAGGG + Intronic
1161252555 19:3288602-3288624 CTTTGGCAGGGCAAGGCAGAAGG + Intronic
1161266681 19:3367480-3367502 CTACGGGAGGGGGAGGGGGAGGG - Intronic
1161515009 19:4691579-4691601 GTGTGGCACGGGAAGGGGGGCGG + Intronic
1161821623 19:6533748-6533770 CTCTGGAGGGGGAGGGGGAAGGG - Intronic
1162034026 19:7929636-7929658 CTCTGGCCTGGGAAGTGGGATGG + Intronic
1162035488 19:7936205-7936227 CTCTGGGAGGCCAAGGCGGATGG + Intronic
1162081331 19:8219571-8219593 CTCTGGGAGGCCAAGGCGGATGG + Intronic
1162089135 19:8267045-8267067 CTCTGGGAGGCCAAGGGGGGTGG + Intronic
1162095879 19:8309707-8309729 CTCTGGAAGGGGAAAGGCCACGG - Intronic
1162527923 19:11217390-11217412 CTCTGGCAGGGAAAGACAGAGGG + Exonic
1162552272 19:11364470-11364492 CGCTGGCAGGGGTAGGGGCAGGG - Exonic
1162692965 19:12449198-12449220 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1162701996 19:12523306-12523328 CTTTGGGAGGGTAAGGCGGATGG - Intronic
1162755733 19:12858457-12858479 CTCTGGCGGGGGGAGGGTGGCGG + Intronic
1162845475 19:13389144-13389166 CTCTGGCAGGCCAAGGCGGGTGG - Intronic
1162911037 19:13847840-13847862 CGCCGGCAGGGGGAGGGGGCGGG - Intergenic
1162945005 19:14037737-14037759 CACTGGGAGGCCAAGGGGGATGG + Intronic
1162947492 19:14052620-14052642 CTTTGGCAGGCCAAGGTGGAAGG + Exonic
1163018725 19:14471798-14471820 CTCGGGCAGGGGCAGGGGCAGGG - Exonic
1163327313 19:16613409-16613431 GTCTGGCTGGGGAAGGGACACGG + Intronic
1163628678 19:18405244-18405266 AGGTGGCTGGGGAAGGGGGAGGG - Intergenic
1164262351 19:23579122-23579144 TTTTGGCAGTGGGAGGGGGATGG + Intronic
1164405240 19:27938369-27938391 TTCTGGGAGAGGCAGGGGGATGG + Intergenic
1164408612 19:27977281-27977303 CTCTGCCTGGGTAATGGGGAAGG + Intergenic
1164514863 19:28925213-28925235 CTTTGGGAGGCCAAGGGGGACGG - Intergenic
1164533869 19:29069584-29069606 TTCTGGCAGGGGAAAGGAAAAGG + Intergenic
1164911628 19:32017140-32017162 CACTGGTAGGGGATGGGGAATGG - Intergenic
1165457154 19:35919309-35919331 CTTTGGCAGGCGGAGGTGGAAGG + Intergenic
1165547102 19:36548775-36548797 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1165645474 19:37431940-37431962 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1165750804 19:38258382-38258404 CTTTGGGAGGGCAAGGCGGATGG + Intronic
1165885883 19:39077912-39077934 CTCTGGGAGGCCAAGGTGGAAGG + Intergenic
1165893506 19:39128383-39128405 CTCTGGCAGGGTCAGGGAGCCGG + Intronic
1166231939 19:41429675-41429697 CTCTGGGAGGCCAAGAGGGAAGG + Intronic
1166288211 19:41845285-41845307 CTGGGGCACGGGAAGGGGGGAGG + Intronic
1166547318 19:43640969-43640991 GTCTGGGCGGGGAGGGGGGAGGG - Intergenic
1166750693 19:45162782-45162804 CTCTGCCAGGAGCACGGGGAGGG + Intronic
1167121534 19:47520258-47520280 CCCTGGCAGGGGCAGGGGCAGGG - Intergenic
1167132036 19:47593217-47593239 CTTTGGGAGGCCAAGGGGGACGG + Intergenic
1167140339 19:47646173-47646195 ATCTGGCAGGGGGTGGAGGAGGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167295692 19:48647821-48647843 CTCTGGGAGGTCAAGGTGGATGG + Intergenic
1167297472 19:48660118-48660140 CTTTGGCAGGCCAAGGTGGAAGG + Intergenic
1167371955 19:49088132-49088154 CTCTGGGAGGCCAAGGGGGGTGG - Intronic
1167557487 19:50205347-50205369 CTCTGACGGGGGCCGGGGGAAGG - Intronic
1167608856 19:50496623-50496645 CTCTGCCTGGGGAAGGGGACAGG - Intergenic
1167618737 19:50549856-50549878 CTCGGGGAGGGGATGGGGAAGGG + Intronic
1167643857 19:50695445-50695467 CCTTGGCGGGAGAAGGGGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167807431 19:51798209-51798231 AACTGGCAGGGGGAGGGGGTGGG + Intronic
1168353570 19:55689385-55689407 CCCTGGCAGGGGCAGGGACAGGG - Intronic
1168373526 19:55856388-55856410 CACTGGAAGGGGAAGGGGAGTGG - Intronic
1168468810 19:56624897-56624919 CTCTGGATGGGAGAGGGGGATGG - Exonic
1168509788 19:56965378-56965400 CAGGGGCTGGGGAAGGGGGACGG - Intergenic
1168615383 19:57833280-57833302 CTCTGCCTGTGGAAAGGGGATGG - Intronic
1168621401 19:57882167-57882189 CTCTGCCTGTGGAAAGGGGATGG + Intronic
924995781 2:359216-359238 AGCTAGCAGGGGAAGTGGGAAGG - Intergenic
925118556 2:1399975-1399997 GTCTGGCTGGAGAAGAGGGAAGG - Intronic
925269293 2:2590978-2591000 CACTGCCAGGAGATGGGGGAGGG - Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926128786 2:10287309-10287331 CTCTAGAAGGGGAAGAGGGCAGG + Intergenic
926515057 2:13832974-13832996 CTGGGGCAGGGGTGGGGGGAGGG + Intergenic
926731380 2:16038280-16038302 CTCTGTCAGGGGAGGAGGGAGGG + Intergenic
927064858 2:19461067-19461089 CAGTTGCAGGGGGAGGGGGATGG - Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927198695 2:20565418-20565440 GTCTGGCGGGGGACAGGGGATGG - Intronic
927292631 2:21419911-21419933 CTGCGGCAGGGGAAGGGACAAGG + Intergenic
927305211 2:21563380-21563402 GTCTGGGAGGGGTAGGGGGAAGG + Intergenic
927482379 2:23464531-23464553 CTTAGGCAGGGGAGTGGGGACGG - Intronic
927619165 2:24634200-24634222 CTCTATCAAGGGGAGGGGGAAGG + Intronic
927673715 2:25089711-25089733 CTCAGGCAGGGGCAGGGAGAGGG + Intronic
927692743 2:25219683-25219705 CTAAGGCAGGGGAAGGCTGAGGG + Intergenic
927738717 2:25547090-25547112 CTCTGGCAGGTCAAGGCGGGAGG - Intronic
927937749 2:27085091-27085113 ATCCAGCAGGGGAAGGGGGCTGG + Intronic
927970046 2:27299914-27299936 CTCTGGGAGGCCAAGGTGGACGG - Intronic
928293601 2:30061540-30061562 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
928376989 2:30783377-30783399 GCCTGGCTGGGGGAGGGGGAGGG + Intronic
928408894 2:31038552-31038574 CGTTGGCCGGGGGAGGGGGAGGG + Intronic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
929300970 2:40303370-40303392 CACTGGCTGGGGAAAGTGGAAGG + Intronic
929524970 2:42693474-42693496 CTCTGCCTGTGGAAAGGGGAAGG - Intronic
929525184 2:42694621-42694643 CTCTGCCAGGGGATGGGAGAGGG + Intronic
929716441 2:44315485-44315507 TTTTGGCGGGGGTAGGGGGAAGG - Intronic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929818826 2:45257497-45257519 CTCTGGCTAGGCAAGGGGGAGGG - Intergenic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
929914436 2:46122469-46122491 CTCTGGGAGGCCAAGGTGGATGG - Intronic
929926501 2:46216805-46216827 CTCTGGCTTTGGAAAGGGGAGGG - Intergenic
929928040 2:46231343-46231365 CTCTGGCAGCAGAATGGAGAAGG - Intergenic
929976970 2:46644301-46644323 CTCTGGGAGGGCAAGGTGGGTGG + Intergenic
930034549 2:47077240-47077262 TTCTGGCAGGGGACGGGTGGTGG - Intronic
930041661 2:47129644-47129666 TGCTGCCAGGGGATGGGGGAGGG + Intronic
930076895 2:47413406-47413428 CTCTGGCAGGCCAAGGTGGGTGG - Intronic
930126487 2:47801810-47801832 TTTTGGTGGGGGAAGGGGGAAGG + Intronic
930288794 2:49467709-49467731 TTCTGGCTGTGGAAAGGGGAGGG - Intergenic
930320480 2:49848408-49848430 CTGTTGGAGGGGTAGGGGGAGGG - Intergenic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930439619 2:51390166-51390188 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
930693258 2:54386074-54386096 CACTGGTCGGGGATGGGGGAGGG + Intergenic
930798607 2:55419695-55419717 CCCCGGGAGGGGAAGGGGGCTGG - Intronic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
930895559 2:56441469-56441491 CACTGCCAGGGGATGGGAGAGGG + Intergenic
931012305 2:57930427-57930449 CACTGCCAGGGGATTGGGGAGGG + Intronic
931077897 2:58736680-58736702 CTTTGGGAGGCCAAGGGGGACGG - Intergenic
931086070 2:58831772-58831794 CACTGCCAGAGGATGGGGGAGGG + Intergenic
931354252 2:61520401-61520423 CTCTGGCAGGCCAAGGTGGGAGG + Intronic
931412300 2:62044750-62044772 CTTTGGTAGGTGAAGGGAGAAGG - Intronic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931582885 2:63796497-63796519 CACTGCCAGGGGATGGGGGAGGG - Intronic
931625034 2:64249779-64249801 CTCTGGGAAGGGAAGAGGAATGG - Intergenic
931669075 2:64630687-64630709 CACTGGCAAGGGAAAAGGGATGG - Intergenic
932291758 2:70586786-70586808 GTCTGGAAGGGTAAGGGGGAAGG - Intergenic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932517436 2:72367675-72367697 CACTGCCAGGGGATGGGGGAGGG - Intronic
932544064 2:72688528-72688550 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
932572155 2:72943758-72943780 CTCTGGACTGGGAAGGGGGCAGG - Exonic
932725432 2:74176000-74176022 CTCTGGGAGGGCAAGGCGGGTGG + Intronic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933274934 2:80273626-80273648 GTGTGGCAGGAGAAGGGTGATGG - Intronic
933513481 2:83270950-83270972 AGCTGGAAGGGGAAGAGGGAGGG - Intergenic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933894125 2:86795008-86795030 GTCTGGGAGTGGGAGGGGGAAGG - Intronic
934557563 2:95295512-95295534 CTCAGGCAGTGAAAGGAGGATGG + Intergenic
934863325 2:97782339-97782361 CTCTGGCAGAGGCAGAGGAAGGG - Intronic
935018960 2:99212189-99212211 CACTGCCAGGGGATGGGGAAGGG + Intronic
935043060 2:99453115-99453137 CTCTGGGAGGCCAAGGGGGAGGG + Intronic
935065180 2:99641166-99641188 CTCTGACAGGGGAAGGAGAAGGG - Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935606316 2:104975167-104975189 CTCTGGGAGGCCAAGGCGGACGG + Intergenic
935644112 2:105318885-105318907 CCCTGGAAGTGGAAGGGAGAGGG - Intronic
935899988 2:107781431-107781453 CTTTGGGAGGGCAAGGCGGACGG + Intergenic
936097832 2:109547050-109547072 CCCTGGTTGGGGAAGGGGGCTGG - Intronic
936274661 2:111084081-111084103 CTTTGGGAGGCCAAGGGGGAAGG + Intronic
937060395 2:118976522-118976544 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
937227546 2:120378442-120378464 CTCTGACTGGGGTAGGGGGTAGG + Intergenic
937242656 2:120472327-120472349 CTGTGGCAGGGGAAGAGAAAAGG - Intergenic
937350345 2:121156534-121156556 CTCTTGGTGGGGAAGGGGGCCGG - Intergenic
937427668 2:121813578-121813600 CTCTGCTAGGGCAATGGGGAAGG + Intergenic
937512387 2:122611035-122611057 TTCTGCCAGGGGATGGGGCAGGG - Intergenic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937628388 2:124069249-124069271 CTCTGACTGTGGAAGGGGGAAGG + Intronic
937762900 2:125627386-125627408 CTGTTGCAGGGGAGGGGGCAAGG + Intergenic
937935258 2:127238853-127238875 CTTTGGGAGGCCAAGGGGGATGG + Intergenic
938647977 2:133350896-133350918 AGCTGACAGGTGAAGGGGGAAGG - Intronic
939146785 2:138425228-138425250 CAGTGGCAGGGCAAGGGGGGTGG - Intergenic
939330492 2:140753041-140753063 GTTTGCCAGGGGATGGGGGAAGG - Intronic
939405009 2:141745415-141745437 CTCTGCCAGTGGAAGGGGGAGGG - Intronic
939931538 2:148240266-148240288 GTGAGGCAGGGGGAGGGGGAAGG + Intronic
940029610 2:149247693-149247715 CTTTGGCTGGGGAAAGGGCAGGG - Intergenic
940795456 2:158072238-158072260 CTCTGCCAGTGGAAAAGGGAGGG + Intronic
940961403 2:159790496-159790518 CTCTGGCAGCAGAGAGGGGAAGG - Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941288483 2:163644911-163644933 CTATGGCAGGGGAGGAGGAATGG + Intronic
941524858 2:166594678-166594700 CTTTGGAAGGCCAAGGGGGATGG + Intergenic
941528197 2:166631999-166632021 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
941672521 2:168310339-168310361 CTCTGCCTGTGGAAAGGGGAAGG - Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
944023885 2:195140906-195140928 CTCTGGTAGTGCAAGGTGGATGG + Intergenic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944378964 2:199084901-199084923 CTCTGGGAGGCCAAGGCGGACGG + Intergenic
944903508 2:204239795-204239817 ATCTGGGAGGGGAAGGGGTAGGG - Intergenic
945253203 2:207781854-207781876 TTCTGGCAGTGAAAGGGGTAGGG + Intergenic
945289190 2:208111007-208111029 GTCAGGCTGGGGAGGGGGGAGGG - Intergenic
945611986 2:212014947-212014969 CTTTGGGAGGCGAAGGCGGATGG + Intronic
945771144 2:214044668-214044690 CTCTGCCAGGGGATGAAGGAGGG - Intronic
945955012 2:216078387-216078409 CTTTGGGAGGTCAAGGGGGATGG + Intronic
946171789 2:217899975-217899997 GGCTGGCAGGGGCCGGGGGAAGG - Intronic
946258690 2:218467183-218467205 CCTGGGCAGGGGGAGGGGGAAGG - Intronic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
947115832 2:226769283-226769305 CTTTGGCAGGGCAAGGCTGATGG - Intronic
947380806 2:229543687-229543709 CACTGGCAGGGGGTGGAGGAGGG - Intronic
947525937 2:230876836-230876858 CCCTGGCAGGAGAAGGGGTTGGG - Exonic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947687068 2:232097477-232097499 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
947733739 2:232444469-232444491 CTCTGGCCCAGGAAGGAGGAGGG - Intergenic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
947744851 2:232502241-232502263 ATCTGCCAGGGAATGGGGGAGGG + Intergenic
947859559 2:233348972-233348994 CTGTGGCAGAGGACAGGGGAAGG - Intergenic
947952184 2:234158014-234158036 CTTAGGGAGGGGATGGGGGAGGG - Intergenic
948073192 2:235144090-235144112 CTCTGGAAGGGGATGAGGGTGGG - Intergenic
948110876 2:235454838-235454860 CTCTTACAGGGGAAAGGGGGAGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948337191 2:237218520-237218542 CTCTGGCAGAGGCAGTGGGTGGG - Intergenic
948384452 2:237572927-237572949 CCCTGGCAGGGGATGGGGGAGGG - Intergenic
948535784 2:238645679-238645701 CACAGACCGGGGAAGGGGGATGG - Intergenic
948550072 2:238765333-238765355 ATCAGGAAGGGCAAGGGGGAGGG - Intergenic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948815388 2:240507725-240507747 CTCTGTCAGGGGAAGTGACATGG - Intronic
948837245 2:240631664-240631686 GTCTGGCAGGGGCAGGGGTTGGG + Intergenic
948944226 2:241211307-241211329 CGATGGGAGAGGAAGGGGGAGGG - Intronic
1168807837 20:683121-683143 CCCTGGCAGGGGGAAGGGGAGGG - Intergenic
1168899864 20:1354488-1354510 CTCTGCCTGAGGAAAGGGGAGGG - Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169243107 20:4001690-4001712 CTTTGGCAGGCCAAGGTGGAAGG + Intronic
1169252647 20:4072217-4072239 CTCTGGCAGGGGCAGTGGTGAGG + Intronic
1169855588 20:10098822-10098844 GGCTGGTAAGGGAAGGGGGAAGG + Intergenic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1170607795 20:17886766-17886788 TGCTGGCAGGGGACTGGGGATGG - Intergenic
1170668455 20:18406965-18406987 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1170687159 20:18579828-18579850 CTTTGGGAGGGCAAGGGGGGTGG + Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170899994 20:20453335-20453357 CTATGGCATGAGATGGGGGAAGG + Intronic
1171424879 20:25043058-25043080 CCCTGGCAGGGGGAGGGGCCAGG - Intronic
1171498562 20:25575507-25575529 CTTTGGGAGGGCAAGGTGGATGG + Intronic
1171779957 20:29409709-29409731 CTCTGGAAGGGAAAGAGGGAGGG - Intergenic
1172248691 20:33463728-33463750 CTTTGGCAGGCGAAGGTGGGAGG + Intergenic
1172295776 20:33809966-33809988 CTCTGGCAGGCCTAGGCGGATGG - Intergenic
1172467529 20:35167129-35167151 CTCTGGGAGGCCAAGGTGGATGG - Intergenic
1172535284 20:35667984-35668006 CTTTGGGAGGCGAAGGTGGATGG - Intronic
1172944698 20:38678068-38678090 CACTGGCAGGGGTAGGGGTGTGG + Intergenic
1172971007 20:38873039-38873061 CCCTGGCAGGAGAGGTGGGACGG - Intronic
1173363193 20:42362860-42362882 CTTTGGGAGGCCAAGGGGGACGG + Intronic
1173402355 20:42736747-42736769 CCTTGGCAGGGGAAGGGGGCAGG + Intronic
1173493132 20:43499599-43499621 CTTTGGGAGGGCAAGGCGGAAGG - Intergenic
1173515436 20:43662419-43662441 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
1173596528 20:44262172-44262194 CTCTGGTAGGGGTGGGGAGAAGG + Intronic
1173597023 20:44265114-44265136 CTTGGGCAGGGCAAGTGGGATGG - Intronic
1173648614 20:44649337-44649359 AGCTGGCAGGAGAAGTGGGAAGG - Intronic
1173730738 20:45326820-45326842 CTCTGCCAGGAAATGGGGGAAGG - Exonic
1173807490 20:45935165-45935187 CCCTCGCTGGGGTAGGGGGAGGG + Intronic
1173809006 20:45945026-45945048 CTCAGGTAGGGGAAAGGTGAAGG + Exonic
1174063969 20:47851675-47851697 CTCTGGCAGGGGATACAGGACGG - Intergenic
1174107482 20:48172800-48172822 CTCTAGCTGGGGAGGGGTGATGG + Intergenic
1174466011 20:50718042-50718064 CTCTGGGAGGTCAAGGTGGAAGG - Intergenic
1174485017 20:50855573-50855595 GACTGGAAGGGGAAGGGGAAGGG + Intronic
1174573998 20:51524109-51524131 TTCTGGAAAGAGAAGGGGGAAGG + Exonic
1174736623 20:52971923-52971945 CTCGGGGCTGGGAAGGGGGAGGG - Intergenic
1175009037 20:55716102-55716124 CTCTGCCAAGGCAAGTGGGAGGG + Intergenic
1175222570 20:57425819-57425841 CTCTGGGAGCGGAAGGGCGCAGG - Intergenic
1175554997 20:59845318-59845340 TTGTGGCGGGGGACGGGGGAAGG - Intronic
1175555958 20:59856915-59856937 GTAGGGTAGGGGAAGGGGGAGGG + Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1175926470 20:62473962-62473984 CACTGGCAGGGGAGGGATGAAGG + Intronic
1175967081 20:62665198-62665220 CTCTGGCAGCGGGGGTGGGAGGG - Intronic
1176058745 20:63162555-63162577 CTCTGTCTGGGGTAGGGGGTGGG - Intergenic
1176247447 20:64104246-64104268 CTCTGGTGGGGGCAGGGTGAGGG - Intergenic
1176303844 21:5113377-5113399 GCCTGGCCGGGGAAGGTGGAGGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177212896 21:18091860-18091882 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
1177244164 21:18501095-18501117 ATCTGGCTGGAGAAGGGGTAAGG + Intergenic
1177407265 21:20686073-20686095 CTTTGGGAGGCCAAGGGGGATGG + Intergenic
1177487945 21:21783269-21783291 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1177504025 21:21998140-21998162 CACTGCCAGGGGATGTGGGAAGG + Intergenic
1177775614 21:25562490-25562512 CGCGGGCAGAGGCAGGGGGAAGG + Intergenic
1178360868 21:31947726-31947748 CACTGACAGGGGATGGTGGAGGG - Intronic
1178600632 21:33991491-33991513 GTCAGGCAGGGGAAGGCTGATGG + Intergenic
1178690588 21:34746587-34746609 CTCTGGCTGGGGGAGGAGGGTGG + Intergenic
1178985888 21:37302751-37302773 CTCTGGGAGGACAAGGCGGATGG - Intergenic
1179126776 21:38598129-38598151 CTCTAGCACAGGAAGGAGGAGGG + Intronic
1179383998 21:40924815-40924837 CCCAGGCAGGGGCAGGGGAAAGG + Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179853186 21:44148573-44148595 GCCTGGCCGGGGAAGGTGGAGGG - Intergenic
1180086317 21:45509474-45509496 CTCGGGCAGGCGAGGGGGGCTGG - Exonic
1180468963 22:15639101-15639123 AGCTGGCATGGGAAGGAGGATGG - Intergenic
1180682159 22:17635950-17635972 CTTTGGGAGGCCAAGGGGGACGG - Intronic
1181031445 22:20150351-20150373 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1181100003 22:20532663-20532685 CTCTAGCTGAGGAAGGGGGCTGG - Intronic
1181314579 22:21963088-21963110 CTCTGGGAGGCTAAGGTGGATGG + Intronic
1181885666 22:26020325-26020347 ATCTGAAAGGGGAAGGGGTATGG + Intronic
1181917299 22:26291631-26291653 CTCTGGCTGGGCTTGGGGGATGG - Intronic
1182102982 22:27670728-27670750 CTCAGGAGGGGGAAGGGGGAAGG - Intergenic
1182310972 22:29406217-29406239 CCCGGGCAGGGGAGGGTGGAAGG - Intronic
1182447376 22:30397498-30397520 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1182690138 22:32154885-32154907 CCCGGGCAGGGGAGGGTGGAAGG + Intronic
1182757777 22:32694284-32694306 ATGTGGCAGGGGAAGGGATATGG - Intronic
1182885983 22:33774599-33774621 CTTTGGGAGGCCAAGGGGGACGG - Intronic
1182950781 22:34373739-34373761 ATATGGCTGGGGAGGGGGGAAGG + Intergenic
1183107674 22:35626774-35626796 CTCTGGCAGGTGAGGGGGCCAGG - Intronic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1183483057 22:38075353-38075375 CTCTGGCCGGGGAGCCGGGAGGG - Exonic
1183655699 22:39183469-39183491 TTTTGGCGGGGGAATGGGGATGG + Intergenic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183770142 22:39917378-39917400 ATCTGGCAGGTGAAGGGGAGAGG - Intronic
1183786316 22:40031034-40031056 CTCTGGCAGTGGGGAGGGGAAGG + Exonic
1183891609 22:40934411-40934433 ATCTTGGAGGGGCAGGGGGAGGG + Intergenic
1183914853 22:41109719-41109741 TTTTGGCAGGGGGAGGAGGACGG + Intronic
1184021961 22:41826928-41826950 CTCTGTCAGTGGTAGGGGGCTGG - Intergenic
1184311769 22:43650143-43650165 CTCCTGGAGGGGAAGGGGCAGGG + Intronic
1184313765 22:43666220-43666242 TTCTGGCTGGGGAGGGGAGAGGG + Intronic
1184347667 22:43923633-43923655 GTCTGGCGGGGGATGGGGGCGGG - Intergenic
1184608391 22:45587252-45587274 CTCTGGCCGGGCAGCGGGGATGG - Intronic
1184608405 22:45587309-45587331 CTCTGGCCGGGCAGCGGGGATGG - Intronic
1184608419 22:45587366-45587388 CTCTGGCCGGGCAGCGGGGATGG - Intronic
1184608433 22:45587423-45587445 CTCTGGCCGGGCAGCGGGGATGG - Intronic
1184752774 22:46498364-46498386 CTCTGGGAGGCCAAGGCGGATGG + Intronic
1184769360 22:46588679-46588701 ATCAGGCCGGGGAAGGAGGACGG - Intronic
1184966165 22:47973743-47973765 GTTTGGCAGGGGGTGGGGGAAGG + Intergenic
1185095213 22:48802743-48802765 CTCTGGCATGGGACGGGGTGGGG - Intronic
1185251018 22:49801809-49801831 GCCAGGCAAGGGAAGGGGGAGGG - Intronic
949470402 3:4390116-4390138 CCCTGGCAGGGGAAGAGAGAAGG + Intronic
949494541 3:4619574-4619596 GGAGGGCAGGGGAAGGGGGAAGG - Intronic
949660759 3:6275761-6275783 CTTTGGGAGGCCAAGGGGGATGG + Intergenic
949785374 3:7734235-7734257 CTTTGGCAGGGGCGGGGGGGGGG + Intronic
950113085 3:10432927-10432949 CTCTGGCTGGGGTAGGGGATGGG + Intronic
950119993 3:10475404-10475426 CTCTGGCTGGGGAACAGGTAAGG + Intronic
950265367 3:11569294-11569316 CTCTGCCTGGGGAGGGGGTATGG + Intronic
950442935 3:13020249-13020271 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
950448377 3:13051464-13051486 GACTGGCAGGGGCAGGGGCAGGG + Intronic
950627518 3:14259104-14259126 CTCTGGCGGGGGCAGGGAGGGGG - Intergenic
950695581 3:14699008-14699030 CTCTGCCTGTGGAAGAGGGAGGG - Intronic
950939992 3:16883633-16883655 CCCTGGTAGGGGAATCGGGAAGG + Intronic
951494854 3:23315189-23315211 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
951494991 3:23316349-23316371 CTCTGCCTGGGGTAAGGGGAAGG - Intronic
951586489 3:24220245-24220267 CTTTGGGAGGCTAAGGGGGATGG + Intronic
952347846 3:32504773-32504795 CTCTGGGAGGCCGAGGGGGACGG + Intergenic
952774074 3:37027846-37027868 CTCTGGGAGGCCAAGGCGGACGG + Intronic
952836866 3:37610079-37610101 CTCTGGCTGGGGGACGGGGAGGG + Intronic
952962973 3:38604351-38604373 CTCAGGCTGGGCAAGGGAGAAGG + Intronic
953791616 3:45951862-45951884 CTCTGCCAGGAGGAGGGGCAAGG + Intronic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
954193108 3:48978560-48978582 CTCTGGGAGGCCAAGGCGGATGG - Intronic
954301341 3:49702238-49702260 CCATGGCAGGGGCTGGGGGAAGG + Intronic
954570866 3:51639729-51639751 CCCTGCCTGGGGAAGGGGTAGGG + Intronic
954615661 3:51967667-51967689 CTCTGGGAGTGGCAGGGGAAGGG - Intronic
954690745 3:52394444-52394466 CTCTGGCAGGGGACAGGAGGAGG - Exonic
954873679 3:53786733-53786755 TTCTGGCTGGGGCAGGGGCAGGG - Intronic
954971712 3:54656799-54656821 TTCTAACTGGGGAAGGGGGAAGG - Intronic
955439202 3:58937354-58937376 ATCTGACTGGGGATGGGGGAAGG - Intronic
955671800 3:61410223-61410245 CTCTGGCTGGGAGAGAGGGAGGG + Intergenic
955719548 3:61866838-61866860 CTTTGGCAGGCCAAGGCGGATGG - Intronic
955736151 3:62040683-62040705 CTCTGGAAGGCCAAGGCGGACGG - Intronic
955972327 3:64447673-64447695 ATTAGGCAGGGGGAGGGGGAGGG + Intergenic
956223035 3:66923957-66923979 CTCTGCCCGTGGAAAGGGGAGGG + Intergenic
956305868 3:67824967-67824989 CTCTGACAGGGGAAAGAGAAGGG + Intergenic
956527263 3:70178763-70178785 CTCTGGGAGGCCAAGGGGGAAGG + Intergenic
956791489 3:72683499-72683521 GTCTGGCAGGGGGTGGGGGTGGG + Intergenic
957407079 3:79785321-79785343 CACAGGAAGGGGATGGGGGAGGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
959547386 3:107612981-107613003 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
959839707 3:110960140-110960162 CTTGGGGAGGGGAAGGGGGCTGG + Intergenic
960293169 3:115911585-115911607 CTCTGGGAGGTCAAGGAGGATGG - Intronic
960840919 3:121957859-121957881 CACTGCCAGGGGATGGGAGAAGG - Intergenic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
961604381 3:128082885-128082907 CTCTGCCTGGGGACAGGGGACGG - Intronic
961610285 3:128132032-128132054 CTCAGGCAGGGGATGAGAGAGGG - Intronic
961906668 3:130269883-130269905 CTGGGGCAGGGGCAGGGGCAGGG - Intergenic
961964372 3:130887565-130887587 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
962015024 3:131430886-131430908 CACTGCCAGGGGATGGAGGAGGG - Intergenic
962759065 3:138492422-138492444 CTCTGCCAGAGGAAAGGGGAAGG - Intergenic
962767641 3:138580117-138580139 CTCTGCCTGGGGAAAGGGGAGGG + Intronic
962852257 3:139316881-139316903 CTCTTGCATGTGAAGGGTGAAGG + Intronic
962906100 3:139804415-139804437 GTGGGGCAGGGGAAGAGGGAAGG + Intergenic
962918382 3:139929276-139929298 CTCTGGCAGGGCACGTGGGCTGG + Intergenic
962978846 3:140469806-140469828 GTGAGGCAGGGGAAGAGGGAGGG + Intronic
963288083 3:143456804-143456826 CTCTGGGAGGCCAAGGTGGATGG - Intronic
963310147 3:143700574-143700596 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
963771752 3:149393302-149393324 CTCTGGCAGAGGAAGTAGCATGG - Intergenic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
964339043 3:155688805-155688827 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
964398382 3:156272444-156272466 GTCTGCCTGGGGAAAGGGGAGGG - Intronic
964466273 3:156996819-156996841 CTCTGGGAGGCCAAGGTGGATGG + Intronic
965145126 3:164890875-164890897 CACTGCCAAGGGATGGGGGAGGG + Intergenic
965834934 3:172841015-172841037 CTCCAGGAGGGGGAGGGGGAGGG - Intergenic
966116389 3:176468364-176468386 GTCTGGCACAGGAAGGGGGGTGG - Intergenic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966393205 3:179474858-179474880 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
966454128 3:180095124-180095146 CACTGCCGGGGGATGGGGGAGGG + Intergenic
966736155 3:183188722-183188744 CTCTGGGAGGCAGAGGGGGATGG + Intronic
966826103 3:183966436-183966458 CTCTGGCAGGGAAACGGGTTGGG - Intronic
967027734 3:185579287-185579309 CTCTGGGAGGGCAAGGCGGGTGG - Intergenic
967675280 3:192291335-192291357 CTTTGGGAGGGCAAGGGAGAAGG + Intronic
968129517 3:196184756-196184778 CTCTGGGCGGGGAATGGGGTGGG + Intergenic
968212646 3:196861813-196861835 CTCTGGGAGGCCAAGGGGGGCGG - Intergenic
968298636 3:197596516-197596538 GCCTGGCAGGGGCAGGGGCAGGG + Intergenic
968517305 4:1020713-1020735 CCCAGGCAGGGGAAGGGGCGGGG + Intronic
968517335 4:1020771-1020793 CCCAGGCAGGGGAAGGGGTGGGG + Intronic
968517368 4:1020835-1020857 CCCAGGCAGGGGAAGGGGCGGGG + Intronic
968517397 4:1020893-1020915 CCCAGGCAGGGGAAGGGGCAGGG + Intronic
968517429 4:1020956-1020978 CCCAGGCAGGGGAAGGGGCGGGG + Intronic
968517459 4:1021014-1021036 CCCAGGCAGGGGAAGGGGCGGGG + Intronic
968517513 4:1021126-1021148 CCCAGGCAGGGGAAGGGGTGAGG + Intronic
968562972 4:1294783-1294805 CAGTGGCAGGGGACGGGGGTGGG + Intronic
968582421 4:1401305-1401327 CTCTGCCAGCGGAGGGAGGAGGG + Intergenic
968878294 4:3285748-3285770 CTCTGGAAGGGGACTGGGGTGGG - Intergenic
968966025 4:3769525-3769547 CCCAGGGATGGGAAGGGGGACGG - Intergenic
969117495 4:4880414-4880436 CTCTGTCAGAGGACGGTGGAGGG - Intergenic
969167478 4:5329498-5329520 CTCTAGCAGGTGAAGGTGGGTGG - Intronic
969390247 4:6887377-6887399 GGCTGGAGGGGGAAGGGGGAGGG + Intergenic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969503634 4:7570371-7570393 CTCTGGCAGCGGGAGTGGGAGGG - Intronic
969553501 4:7889303-7889325 CTTTGGGAGGCCAAGGGGGACGG + Intronic
970031850 4:11685109-11685131 CACTAGTAAGGGAAGGGGGAAGG + Intergenic
970319333 4:14860353-14860375 CTCTGGGGGGTGTAGGGGGAGGG + Intergenic
970346987 4:15161930-15161952 GTGTGGCAGGGGGTGGGGGAAGG + Intergenic
970420052 4:15897665-15897687 CTGAGGCAGGGGGAGGGTGATGG - Intergenic
970460735 4:16272424-16272446 CTCTGGCTGGGAAATAGGGAAGG - Intergenic
970791477 4:19862944-19862966 CTGGGGCAGGGGGAGGGGGGAGG - Intergenic
971095613 4:23399070-23399092 CTCTGCCTGTGGAAAGGGGACGG - Intergenic
971236961 4:24850844-24850866 CTCTGGTGGGGGTTGGGGGAAGG + Intronic
971914459 4:32850581-32850603 CTCTGACTGTGGAAAGGGGAGGG - Intergenic
972117180 4:35650915-35650937 GTGGGGCAGGGGAAGGGGGGAGG + Intergenic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
972288828 4:37672167-37672189 CTCTGGGAAGGGAAAGGGGCTGG - Intronic
972549962 4:40123106-40123128 CCCTTGTGGGGGAAGGGGGAGGG - Exonic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
972775563 4:42236728-42236750 CCCTGGGAGGGGAAGGGAGTGGG + Intergenic
973214498 4:47654463-47654485 CTCTTGCTGGGGAATGGGGGAGG - Intronic
973849301 4:54945520-54945542 ATCTGGCAGAGGAGGAGGGAGGG + Intergenic
974231174 4:59116192-59116214 ATCTGGCAGGGTAAGGGGGCAGG - Intergenic
974300977 4:60067051-60067073 CTCTGCCTGGGGTTGGGGGAGGG - Intergenic
974483513 4:62476116-62476138 CTATAGCAGTGGGAGGGGGAAGG - Intergenic
974488846 4:62537888-62537910 TCCTGGCAGGGGAAGGGGAAAGG + Intergenic
974633892 4:64533455-64533477 CCCTTTCAGGGGAAGTGGGATGG - Intergenic
975068824 4:70106257-70106279 GGATGGCTGGGGAAGGGGGAGGG - Intergenic
975592915 4:76017916-76017938 CACTGCCAGGGGAAGGGAGAGGG + Intronic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
975768784 4:77698517-77698539 CTCGGTCAGGGCAAGGGTGAAGG + Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
975856235 4:78627485-78627507 CTCTGGGATGGGGATGGGGAAGG + Intergenic
975885341 4:78958416-78958438 ATTTGTCAGGGGTAGGGGGATGG - Intergenic
976275698 4:83275313-83275335 CTCTGGCAAAAGAAGGGGGTGGG + Intronic
976318773 4:83687414-83687436 CTTTGGGAGGCCAAGGGGGAAGG - Intergenic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976429270 4:84944279-84944301 CTCTGGGAGGCTGAGGGGGATGG + Intronic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
976789199 4:88858719-88858741 GGCTGGCAGGGGATGGAGGAGGG + Intronic
977265090 4:94844547-94844569 CTCTGGCATGGAAATGGGGCAGG - Intronic
977809748 4:101346177-101346199 CCCTTCCAGGGGGAGGGGGAGGG + Intronic
977961733 4:103093156-103093178 CTCTGGCAGGGGAAGGATAGGGG - Intronic
978258163 4:106718095-106718117 TGCTGCCAGGGGATGGGGGAGGG - Intergenic
978617190 4:110609848-110609870 TTCTGGCAGGGGATGGAGGGTGG - Intergenic
978659584 4:111108554-111108576 CTCTGGCAGGGGAGAGGGACCGG + Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979573050 4:122252561-122252583 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
979724435 4:123942981-123943003 TTCTGGCAGGTGAAGCGGCATGG + Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
980407626 4:132374032-132374054 ATCTGTCAGTGGGAGGGGGAAGG - Intergenic
980448719 4:132944160-132944182 CTTTGGGAGGCCAAGGGGGATGG - Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981782588 4:148444550-148444572 CTGGGGCGGGGGAAGGGGAACGG + Intronic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
983228319 4:165105953-165105975 CTCACGCAGTGGAAGGTGGAAGG - Intronic
983762743 4:171432415-171432437 CTTTGGCCAGGGAAGTGGGACGG - Intergenic
983828211 4:172291722-172291744 CTGGGGCAGGGGGAGGGGGGTGG - Intronic
983880283 4:172924700-172924722 CTCTGGCCAGGGGAGTGGGAAGG + Intronic
984490768 4:180431765-180431787 CTGTGGCGGGGGAACGGGGCAGG + Intergenic
984668331 4:182452323-182452345 TTTTGGCAGGGGACGGGGGGCGG + Intronic
984791570 4:183619582-183619604 CTCCTGCAGGGGGAGGGGGGAGG + Intergenic
985573960 5:665194-665216 CTCTGGCAAGGGCAAGGGCAAGG - Exonic
985695001 5:1335252-1335274 CACAGGGATGGGAAGGGGGATGG - Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986232494 5:5879365-5879387 CTCTGGCAGGGGTATGGGAATGG - Intergenic
986275564 5:6272211-6272233 CACCAGCTGGGGAAGGGGGAAGG - Intergenic
986287078 5:6367244-6367266 CCAGGGCAGGGGAAGAGGGAGGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986544391 5:8879842-8879864 CTCTGCCTCTGGAAGGGGGAAGG - Intergenic
987390964 5:17375243-17375265 GTCTTGCAGGGGGAGGGAGAGGG - Intergenic
988340174 5:29960537-29960559 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
988570239 5:32358112-32358134 CTCTGGAAGGCCAAGGTGGAAGG + Intronic
988735980 5:34021758-34021780 CTGTGGCAGGGTGAGGGGAAAGG + Intronic
988956475 5:36324746-36324768 CACTGCCAGGGGATGGAGGAGGG + Intergenic
989024935 5:37056323-37056345 CCATGGCAGGGGAAGGTAGATGG + Intronic
989028070 5:37089008-37089030 CTATGGAAAGGAAAGGGGGAAGG + Intergenic
989102521 5:37835741-37835763 CTCTGGGAGGGGAAGGGATTAGG - Exonic
989489353 5:42032467-42032489 CTCTGCCTTGGGAAGTGGGAGGG - Intergenic
989543114 5:42641124-42641146 GTCTATCAGGGGAAGGAGGAAGG - Intronic
990009805 5:50983272-50983294 CTATGGCAAGTGAAGGGAGAAGG - Intergenic
990020214 5:51117336-51117358 ATCAGGCAGGTGAAGGGGTAGGG - Intergenic
990224971 5:53640198-53640220 TTCTGGCAGGGGTAGACGGAAGG + Intronic
990595836 5:57311478-57311500 CTATGGCAGGGGCAGGCAGAGGG + Intergenic
990956359 5:61344136-61344158 CTCTGGGAGGCCAAGGTGGATGG - Intronic
991050388 5:62266649-62266671 CCTTGGCAGAGGAAGGTGGACGG + Intergenic
991374201 5:65949005-65949027 CTCTGGGAGGCCAAGGCGGATGG - Intronic
991391840 5:66152093-66152115 CTCTGGGAGGCCAAGGCGGAAGG - Intronic
991395246 5:66198268-66198290 CTCTGCCTGGGGAAAGGAGAGGG - Intergenic
991599918 5:68341961-68341983 CTCTTCCAGGAGAAGGGGTAAGG + Intergenic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
992157688 5:73971096-73971118 CTCTGCAAGGGGCAGGGGGTGGG + Intergenic
992187700 5:74259968-74259990 GCCTGGCAGGGGTTGGGGGAGGG - Intergenic
992343561 5:75851904-75851926 CTCTGGGAGGCCAAGGAGGATGG - Intergenic
992549004 5:77844193-77844215 CTCTCACTGGGGAGGGGGGAAGG - Intronic
992995644 5:82329687-82329709 CTTTGGCAGGGGTCGGGGGAGGG + Intronic
993061753 5:83047054-83047076 CTTTGGAAGGCCAAGGGGGATGG - Intergenic
993243019 5:85415115-85415137 CTCTGGCAGGGGGAGGCTGGTGG + Intergenic
993901157 5:93584934-93584956 CGCTGGGAGGGGAAGGGGAAGGG - Exonic
993981315 5:94546126-94546148 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
994028620 5:95114562-95114584 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
995697922 5:114900442-114900464 CACTGCCAGGGGAAGGGAGAGGG + Intergenic
995733771 5:115274984-115275006 CTCTGGGAGGTTAAGGCGGATGG - Intronic
996136562 5:119849598-119849620 CTCTGGGAGGGCAAGGCGGGTGG - Intergenic
996679512 5:126215992-126216014 CTCTGGGAGGCGAAGGCGAATGG + Intergenic
996778706 5:127160312-127160334 GTTTGGGAGGGGAATGGGGATGG - Intergenic
996961626 5:129256410-129256432 TTCTGCCAGTGGATGGGGGAGGG + Intergenic
996968149 5:129330742-129330764 CCCTGCCAGGGGATGGGAGACGG - Intergenic
997059728 5:130487439-130487461 CTCTGCCAGGAGATGGGGGTTGG - Intergenic
997111413 5:131078969-131078991 CTCTGGCAGGGGATGGGGGCAGG - Intergenic
997334431 5:133095856-133095878 GGCTGTCAGGGGATGGGGGAGGG - Intronic
997587736 5:135053602-135053624 CTCTGGTGGGGCAAGGGGGGAGG - Intronic
997603126 5:135154039-135154061 CTCCTGCAGAGGAAGGGAGAGGG - Intronic
997663041 5:135603930-135603952 CACTGGCCTGGGAAGGGGGCAGG - Intergenic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998188487 5:140001616-140001638 CTTTGGCAGGGCAAGGTGGGAGG + Intronic
998291140 5:140916028-140916050 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
999052153 5:148534461-148534483 CTCTGGCAGGGGATGGCTGGAGG - Intronic
999267401 5:150275909-150275931 CTCAGGGAGGGGAGGGGGGCTGG - Intronic
999364435 5:151012751-151012773 CTCTTGCAGGGGATGGGGTAGGG + Intergenic
999517186 5:152313455-152313477 GTCAGGGAGGAGAAGGGGGAAGG - Intergenic
999629337 5:153553984-153554006 AACTGGGTGGGGAAGGGGGAGGG - Intronic
999737120 5:154521230-154521252 CTCTGGAGGGAGCAGGGGGATGG - Intergenic
999744882 5:154584418-154584440 TGCTGGCAGGGGCATGGGGATGG + Intergenic
1000015679 5:157273490-157273512 AACAGGCAGGGGCAGGGGGAGGG + Intronic
1000044430 5:157510229-157510251 CTCTGGGAGGCTAAGGTGGATGG + Intronic
1000052672 5:157575856-157575878 CTCCGCCAGGGGATGGAGGAGGG + Intergenic
1000334410 5:160231396-160231418 CTCTGGCAGGGAGGAGGGGACGG + Intronic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001012541 5:168111426-168111448 CGGTGGCAGGGGTTGGGGGAGGG + Intronic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001266216 5:170276390-170276412 GTCTGGGAGGGGAAGATGGAAGG - Intronic
1001457685 5:171877586-171877608 CTCTGGCAGAAGCAGGGGTACGG + Intronic
1001710030 5:173771180-173771202 GTCTCACAGGAGAAGGGGGAGGG - Intergenic
1002080957 5:176737135-176737157 CCCAGGAAGGGGTAGGGGGAGGG + Intergenic
1002165848 5:177345095-177345117 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002327633 5:178420386-178420408 CTCAGGGAGGGGAGGGGGAAAGG - Intronic
1002388280 5:178887897-178887919 TTCTGGCAGGGGCAGGGGTGGGG - Intronic
1002500946 5:179647297-179647319 CTCTGGGAAGGGAAGTGGCATGG + Intergenic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002706963 5:181167991-181168013 CCCGGGCAGGGGTAAGGGGAGGG - Intergenic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1003596056 6:7475246-7475268 CTTTGGGAGGTGGAGGGGGATGG - Intergenic
1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG + Intergenic
1004667649 6:17763239-17763261 CTTTGGGAGGCCAAGGGGGATGG + Intronic
1004880897 6:20007212-20007234 ATCTGGCAGAGGAAGTGGGGAGG - Intergenic
1004907743 6:20252448-20252470 CTCTGGGAGGACAAGGCGGATGG - Intergenic
1005025652 6:21460671-21460693 CTCTGGGAGGGCAAGGTGGGTGG + Intergenic
1005496338 6:26391339-26391361 GTCTGCCAGGGGAAGGGGTTTGG + Intronic
1005694532 6:28339299-28339321 TTTTGGCAGGGGAGTGGGGAAGG + Intronic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1005996995 6:30937472-30937494 GTCTGGCAGGGATAGGGGGTTGG + Intergenic
1006271142 6:32968547-32968569 CCCTGACTGGGGGAGGGGGAAGG - Intronic
1006275390 6:33001288-33001310 CTTTGACAGGCAAAGGGGGAAGG + Intergenic
1006321799 6:33323506-33323528 CCCTTGCAGGGGAAGGGGCTGGG - Intronic
1006401513 6:33820674-33820696 CTCTGGCAGGGGCAGGGACCTGG - Intergenic
1006537470 6:34711270-34711292 CTTTGGGAGGCCAAGGGGGATGG + Intergenic
1006940470 6:37748698-37748720 CTATGGCAGGTGCTGGGGGAAGG - Intergenic
1007001586 6:38318994-38319016 CTCTGGCTGGGGCAAGGGGTGGG - Intronic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1007241744 6:40431657-40431679 GTCTGGCTGGGGAAGGAGGAGGG - Intronic
1007362337 6:41367919-41367941 CTCAGGCAGGAGAAGGGGAGGGG + Intergenic
1007721587 6:43888417-43888439 TTCTGGCAGGAGTAGGGGCAAGG - Intergenic
1007729890 6:43939439-43939461 CTCTGGTGGGGCAAGGGGCAGGG - Intergenic
1007745203 6:44039343-44039365 CCCTGGCAGGGACAGGGGCAAGG + Intergenic
1007829607 6:44628371-44628393 CTCTGACAGGGGCTGGAGGAAGG + Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008518082 6:52337074-52337096 CTCAGGCTGGGGATGAGGGATGG - Intergenic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008646455 6:53519419-53519441 CTCTGGTGGGTGGAGGGGGAGGG - Intronic
1008958243 6:57239489-57239511 CTTTGGGAGGCAAAGGGGGATGG + Intergenic
1009375389 6:62961773-62961795 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009893841 6:69721968-69721990 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1009900991 6:69807747-69807769 CTCTGCTAGGGGAATGCGGAAGG - Intergenic
1010232669 6:73549059-73549081 CTTTGGCAGGCCAAGGTGGATGG + Intergenic
1010502252 6:76615318-76615340 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1010676716 6:78753950-78753972 CTCTGCCTGTGGAAAGGGGATGG + Intergenic
1011112672 6:83854980-83855002 ATCTGTCAGTGGTAGGGGGAAGG + Intronic
1011419416 6:87155780-87155802 CTCTAGCTGGGGAAAGGGGGAGG - Intronic
1011535853 6:88375284-88375306 CTCTGGCAGGGGAAGGGTCCTGG + Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1012224552 6:96689053-96689075 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1012336474 6:98065397-98065419 CGCTGGAAGTGGAAGTGGGATGG - Intergenic
1012449946 6:99344360-99344382 CTCAGGCAGGGCCAAGGGGAAGG - Intronic
1013087589 6:106869584-106869606 CTCTGATACGGGAAAGGGGAGGG + Intergenic
1013113792 6:107085404-107085426 TTCTGGCAGGGGGAGGGGAAAGG + Intronic
1013244752 6:108275791-108275813 GTCTGGGAGGCCAAGGGGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013536422 6:111066901-111066923 TTTAGGCAGGGAAAGGGGGAAGG + Intergenic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1013653874 6:112224964-112224986 TTTTGGCAGGGGACGGGGAAGGG + Intronic
1013656324 6:112250649-112250671 TTCTGACAGGGCAAGGTGGAAGG - Intronic
1014840919 6:126219064-126219086 CGCTGCCAGGGGATGGAGGAGGG + Intergenic
1015959499 6:138632130-138632152 CTCTGCCTTGGGAAAGGGGAGGG + Intronic
1016054856 6:139567581-139567603 CACTGCCAGGGGATGGAGGAAGG + Intergenic
1016554119 6:145316130-145316152 CTCTGGCAGGGATGAGGGGAGGG - Intergenic
1016798432 6:148143116-148143138 GACTGGCTGGGGAAGGAGGATGG + Intergenic
1016932899 6:149427306-149427328 TTTTGGCAGGGGATGGGGGTTGG + Intergenic
1017438254 6:154438267-154438289 CTCTGGCAGGGGGAGAGAGAGGG - Intronic
1017690166 6:156956155-156956177 CTCTAGCAGGGGAAGGAGGTGGG + Intronic
1018287298 6:162254671-162254693 CTCTGGCAGTGGATGAAGGATGG - Intronic
1018337564 6:162810294-162810316 CTCTGGCAAAGGTTGGGGGAAGG - Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1019021140 6:168918685-168918707 TTCGGGCAGGAGATGGGGGAGGG + Intergenic
1019290483 7:247769-247791 GTCTGACAGGTGGAGGGGGAGGG + Intronic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019394441 7:809681-809703 CTCTGGCAGGCCAAGGCGGGTGG + Intergenic
1019419856 7:945894-945916 CTGGGGCACGGGCAGGGGGAAGG + Intronic
1019440174 7:1041952-1041974 ATGCGGCAGGGGAAGGGGAAGGG + Intronic
1019619963 7:1987135-1987157 AGCTGGCAGGGGAGGGGTGAGGG - Intronic
1019851324 7:3561073-3561095 CTAGGGGTGGGGAAGGGGGAAGG - Intronic
1020070985 7:5226978-5227000 CTCTGGGAGGTGTCGGGGGAGGG - Intronic
1020812711 7:12865185-12865207 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1021214754 7:17901670-17901692 TTCTGCCAGGGGATGAGGGAGGG + Intronic
1021842724 7:24733687-24733709 CTCTGCCTGGGGAAAGGAGAGGG + Intronic
1021927358 7:25546244-25546266 CTATGCCAGGGCAAGGAGGAGGG + Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022366916 7:29730435-29730457 CTCTGCCTGGGGAAAGGGGAAGG - Intergenic
1022645433 7:32224927-32224949 CTCTGGAAGGGGATGGGAGAAGG + Intronic
1023342419 7:39235488-39235510 GACTGGCAGGAGAAGGGGCAGGG - Intronic
1023458567 7:40368438-40368460 CTTTGGGAGGGCAAGGAGGAGGG - Intronic
1023710642 7:42988728-42988750 CTCAGGCTGGGGCTGGGGGAAGG - Intergenic
1023844081 7:44111431-44111453 CCCTGGAAGTGGAAGGGGCATGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024524387 7:50336247-50336269 CCCCGGCGGGGGCAGGGGGAGGG + Intronic
1024594515 7:50920847-50920869 GGCAGGGAGGGGAAGGGGGAAGG - Intergenic
1024605630 7:51020371-51020393 CTCAGCCAGAGGAAGGGGGCAGG - Intronic
1025064594 7:55842361-55842383 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1025923055 7:65932339-65932361 CTCTGGGAGGCCAAGGTGGATGG - Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026295380 7:69047586-69047608 GTCTGGCTGGGGGAGTGGGAGGG - Intergenic
1026317348 7:69238691-69238713 CTTTGGCAGGGGACTGGGCATGG - Intergenic
1026325668 7:69307074-69307096 CAGTGGCAGAGGAAGAGGGAGGG + Intergenic
1026572975 7:71547982-71548004 CTCTGGGAGGGCAAGGCGGGTGG + Intronic
1026633997 7:72065373-72065395 CTGGGGCAGGGGCAGGGGGGCGG - Intronic
1026738063 7:72961318-72961340 CCCAGGCAGGGGCAGAGGGAAGG + Intronic
1026777156 7:73237684-73237706 CTCTGGGAGGCCAAGGTGGAAGG + Intergenic
1026789100 7:73320115-73320137 CCCAGGCAGGGGCAGAGGGAAGG + Intronic
1026807263 7:73436133-73436155 CTCTGGCTGGGAAGGGGGGAAGG + Intergenic
1026897468 7:74018534-74018556 CTCTGGGAGGGGCAGGGGGCAGG + Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027018002 7:74791056-74791078 CTCTGGGAGGCCAAGGTGGAAGG + Intergenic
1027070024 7:75154856-75154878 CTCTGGGAGGCCAAGGTGGAAGG - Intergenic
1027105671 7:75403750-75403772 CCCAGGCAGGGGCAGAGGGAAGG - Intronic
1027221518 7:76217105-76217127 CTCTGGCCTGGGTAGGGGTAGGG + Intronic
1027935005 7:84590590-84590612 GTGGGGTAGGGGAAGGGGGAGGG - Intergenic
1027996168 7:85427517-85427539 CTCTGTCTGTGGAAAGGGGAAGG + Intergenic
1029278007 7:99418987-99419009 CTCTGGTGGGGGAAGAGGGCAGG - Exonic
1029308586 7:99640399-99640421 CTTTGGGAGGGCAAGGCGGATGG - Intergenic
1029365618 7:100114267-100114289 CCCTGGCAGAGGAACGGGGCAGG + Exonic
1029461010 7:100693951-100693973 CTCGGGGAGGAGACGGGGGAGGG + Intergenic
1029825348 7:103187020-103187042 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1030345754 7:108431279-108431301 CTGTGGCAGTGGAAGTGGCACGG - Intronic
1030640715 7:112003135-112003157 CTCTGGAAGGTCAAGGTGGAAGG + Intronic
1030777743 7:113555902-113555924 CACTGGCAGGTGAAAGGGCAAGG + Intergenic
1031353406 7:120762794-120762816 ATCTGGCAGTGGTAGTGGGATGG + Intergenic
1031864399 7:127022483-127022505 CCCTGACAGGGGAAGAGAGATGG + Intronic
1032138732 7:129307341-129307363 CTCTGCCTGGGGAAAGGGTAGGG - Intronic
1032188746 7:129750383-129750405 CCCTGGCAAGGGAAAGGGGGAGG - Intronic
1032290779 7:130588645-130588667 GTGGGGCAGGGGGAGGGGGAAGG + Intronic
1032395106 7:131583764-131583786 CTCTGGGAGGCGAAAGTGGAAGG + Intergenic
1032398611 7:131608326-131608348 CTCTGTCTGTTGAAGGGGGATGG + Intergenic
1033030999 7:137826704-137826726 ATCTGGCAGGGGGAAGGGGGCGG + Intronic
1033065397 7:138148939-138148961 CTTTGGGAGGCCAAGGGGGATGG - Intergenic
1033195758 7:139325945-139325967 CTTTGGGAGGCCAAGGGGGATGG + Intergenic
1033297343 7:140152379-140152401 CTCTGGGAGGCCAAGGAGGATGG + Intronic
1033565522 7:142574899-142574921 CAGAGGCAGGGGGAGGGGGAGGG - Intergenic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034211627 7:149368683-149368705 CTGTTGTAGGGGGAGGGGGAGGG - Intergenic
1034267877 7:149789918-149789940 CTCTGGGATGGGAAGGAGCAGGG + Intergenic
1034397999 7:150842028-150842050 CACTGCCAGGGGATGGGGGAAGG - Intronic
1034453391 7:151149919-151149941 CCTTGGCTGGGGAAAGGGGAAGG - Intronic
1034567413 7:151926475-151926497 CCCTGGCAGGGACAGGTGGAAGG - Intergenic
1034614740 7:152406200-152406222 CTCTGGCAGGCCAAGGTGGGTGG + Intronic
1034657272 7:152739652-152739674 CTCTGGGAGGCCAAGGGAGAAGG - Intergenic
1035051130 7:155999566-155999588 CCCTGGGAGGGGAAGGTGGCTGG + Intergenic
1035163219 7:156966552-156966574 CACTGGGAGCGGAAGTGGGAGGG + Intronic
1035235677 7:157496408-157496430 TTCCAACAGGGGAAGGGGGAAGG + Intergenic
1035314894 7:157991550-157991572 CTCTGGCTGAGGGAGGGTGAGGG + Intronic
1036102604 8:5803173-5803195 CTCTGCCAGGGTCTGGGGGATGG - Intergenic
1036207895 8:6818795-6818817 GTCTGGCAGGGGCTGGGGGCTGG - Intronic
1036467552 8:9015078-9015100 CTCTGGGAGGCCAAGGGGGGTGG - Intronic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1036788547 8:11703400-11703422 CTCTTCCAGGGTATGGGGGAGGG - Intronic
1036830087 8:12014535-12014557 CCCTAGCAGGGGAAGGGGCGGGG - Intronic
1037607971 8:20453493-20453515 CTCTGGGAGGCCAAGGTGGAAGG - Intergenic
1037644998 8:20785097-20785119 ATCTGCCAGGGGAAGGGACAGGG + Intergenic
1037710124 8:21348680-21348702 CAATGGCAGGGGCAGGGGCAGGG + Intergenic
1037871750 8:22504539-22504561 CTCTGGGAGGCTAAGGCGGAAGG - Intronic
1037926908 8:22850814-22850836 CTCAGGGAGGGGTAGGAGGAAGG + Intronic
1038429765 8:27491012-27491034 CTCTGGCCGGGAAAGAGGCAGGG - Exonic
1038613968 8:29076229-29076251 GTCGGGTAGGGGGAGGGGGAGGG - Intronic
1038661214 8:29498734-29498756 CTTTGGGAGGCCAAGGGGGACGG - Intergenic
1038788987 8:30650444-30650466 CTTTGGGAGGCTAAGGGGGATGG + Intronic
1038990292 8:32860004-32860026 CTCCGGCAGGGGAAGGCTGCTGG - Intergenic
1039117963 8:34113342-34113364 CAGGGGCACGGGAAGGGGGAAGG + Intergenic
1039469402 8:37803928-37803950 CCCTGGCAGGGGAAGGGAGGAGG - Intronic
1039882373 8:41632939-41632961 GACTGGCAGGGGTAGGGGTAGGG - Intergenic
1040013676 8:42682967-42682989 CTTTGCCAGGGGAAGAGAGAAGG + Intergenic
1040851265 8:51902381-51902403 TTTTTGCAGGGGGAGGGGGATGG - Intergenic
1041153290 8:54958060-54958082 CTCTTGAAGGGAAAGGAGGATGG - Intergenic
1041170405 8:55136133-55136155 CTTTGGGAGGCGAAGGGGGGCGG - Intronic
1041174761 8:55183944-55183966 AGCTGGCAGGGGGAGGGGAAAGG - Intronic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1042300844 8:67279018-67279040 CTCTGGCAGGCCAAGGTGGGAGG + Intronic
1042538147 8:69879992-69880014 CTCTGGGAGGACAAGGTGGAAGG - Intergenic
1042785134 8:72537531-72537553 CTGTGGCGGCGGCAGGGGGATGG + Exonic
1042898431 8:73695778-73695800 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1043080140 8:75755890-75755912 CTCTGCCTGAGGAAAGGGGAGGG + Intergenic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043998067 8:86843454-86843476 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1045041258 8:98227001-98227023 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1045493365 8:102687574-102687596 CTCTGGGATGGGGAGGGGTATGG - Intergenic
1046021235 8:108667802-108667824 ATCTGGCAGGGGATGGGGCTGGG - Intronic
1046111921 8:109735817-109735839 CTCTGGCAGGTGGCAGGGGAGGG + Intergenic
1046195395 8:110857544-110857566 CTTTGGCAGGGCAAGGGGAGTGG + Intergenic
1046322989 8:112602320-112602342 CTTTGGCAGGGCAAGGAGGGTGG + Intronic
1047336025 8:123937148-123937170 CTCTGGGAGGGCGAGGTGGACGG - Intronic
1047528445 8:125654114-125654136 CTCTGGTAGGGGAGTGAGGAAGG + Intergenic
1047674772 8:127188720-127188742 CTCTGGCAGGCCAAGGCGGGTGG + Intergenic
1047751217 8:127882156-127882178 CTCATTCAGGGGAGGGGGGATGG - Intergenic
1048140061 8:131785604-131785626 CACGGACAGGGGAGGGGGGATGG + Intergenic
1048339287 8:133526290-133526312 CTCTGGCTGGGGAATGAGTATGG - Intronic
1048549590 8:135422078-135422100 CTCTTGCAGGTGAAGAGGGGTGG - Intergenic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049223057 8:141436601-141436623 CTTTGGCAGAGGAAGGGAGCTGG + Intergenic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1049346940 8:142144136-142144158 CTGTGGCCAGGGAAGGGGGTGGG + Intergenic
1049426756 8:142541192-142541214 CTCTGTCAGGGGCAGGCGGCTGG + Intronic
1049684481 8:143933876-143933898 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
1049686541 8:143941442-143941464 CTCAGGGAAGGGAAGGGGCACGG + Intronic
1049711963 8:144068849-144068871 CTGTGGCAGGTGTTGGGGGACGG - Intergenic
1049725522 8:144143889-144143911 CTCTGGACTGGGCAGGGGGAGGG + Intergenic
1049773354 8:144393795-144393817 GGCTGGCAGGGGTAGGGTGAGGG + Exonic
1050123221 9:2330033-2330055 ATCTGTCAGGGGCAGGGGGAGGG - Intergenic
1050248045 9:3712944-3712966 CACTGCCAGGGGATGGGGAAGGG - Intergenic
1050516085 9:6445805-6445827 CTTTGGGAGGCCAAGGGGGAAGG - Intronic
1050618563 9:7429117-7429139 CTCTGCTTGAGGAAGGGGGAGGG - Intergenic
1050910502 9:11063447-11063469 CTCTGGCAGGAGAAGGTGGTGGG + Intergenic
1050914308 9:11112030-11112052 CTTTGGCAGGCCAAGGAGGATGG - Intergenic
1051282955 9:15461403-15461425 CTCTGGGAGGCCAAGGCGGATGG - Exonic
1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051585930 9:18726889-18726911 CTGGGGCTGGGGCAGGGGGAGGG - Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1051718153 9:20007388-20007410 CCTTGGCAAGGGAAGGGGGTGGG + Intergenic
1051921814 9:22275329-22275351 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052863736 9:33452742-33452764 CTCTGGCTGGAGGAAGGGGAAGG + Intergenic
1052950108 9:34201988-34202010 GTCTGGCAAGGTAGGGGGGAAGG + Intronic
1053409668 9:37907392-37907414 CTGGGGCAGGGGAATGGGGCCGG - Intronic
1053410251 9:37911620-37911642 CTCTCACAGGGGCAGAGGGAGGG + Intronic
1053438039 9:38090278-38090300 CTCTGCCTGGGGGATGGGGACGG + Intergenic
1053462052 9:38278687-38278709 CACTGGGAGGGAAAGAGGGAGGG - Intergenic
1054163231 9:61694432-61694454 CTTTGGGAGGGCAAGGTGGATGG + Intergenic
1055161632 9:73136144-73136166 CTTTGGGAGGACAAGGGGGAAGG + Intergenic
1055460273 9:76513011-76513033 CTTTGGGAGGCCAAGGGGGATGG - Intergenic
1055692244 9:78845644-78845666 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1055757835 9:79573415-79573437 CTTTGGCCGGGGAGGGGAGACGG + Intronic
1056803740 9:89712444-89712466 CTCTGGCCGCGGAGGGAGGAGGG - Intergenic
1057203370 9:93155848-93155870 CTCCGGGAGGTGATGGGGGAAGG + Intergenic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1057523408 9:95778605-95778627 TTCCGGCTAGGGAAGGGGGAGGG - Intergenic
1057854671 9:98593428-98593450 CAATGGCAGGAGCAGGGGGAAGG + Intronic
1058699270 9:107587539-107587561 GTCTGCCTGGGGAAGGGAGAAGG - Intergenic
1059329715 9:113527176-113527198 CTATGGCAGGGAATGGTGGATGG - Intronic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1059582951 9:115572212-115572234 CTTGGGCAGGGGGAGGGGGCAGG - Intergenic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1060104978 9:120868027-120868049 ATCAGGCAGGGGTAGGGGGCCGG - Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060515439 9:124262831-124262853 TTTGGACAGGGGAAGGGGGAGGG + Intronic
1060587360 9:124795003-124795025 AGCTGCCCGGGGAAGGGGGATGG - Exonic
1060630835 9:125157121-125157143 CACTGGTAGGGGGAGGGGGGAGG - Intronic
1060724269 9:125996912-125996934 CTCGGGCAGGGGTAGGCAGAAGG - Intergenic
1060813148 9:126621221-126621243 CTCAGCCAGGGGAGGGAGGAAGG + Intronic
1060823987 9:126677137-126677159 CTCTGGCTGGGGACGGGCAAAGG - Intronic
1060887465 9:127165339-127165361 GCCTGGCTGGGGAAGGGGAAGGG - Intronic
1061119653 9:128635162-128635184 CTCTGGCAGGGCATCGGGGTAGG - Exonic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061516431 9:131092983-131093005 CCCTGACAGGGGCAGGGGTAGGG + Exonic
1061612042 9:131753470-131753492 CTCTGGGAGGCCAAGGTGGAAGG - Intergenic
1061706693 9:132458336-132458358 CCCTGGCGGGGGAGGGGGGGGGG + Intronic
1061749915 9:132770439-132770461 CGCTGGCTGGGGTAGGGGGTGGG + Intronic
1062179240 9:135181893-135181915 ATCAGGCAGAGGAAGGTGGAAGG + Intergenic
1062225268 9:135446675-135446697 GGCTGGCAGGGGTGGGGGGAGGG + Intergenic
1062225339 9:135446862-135446884 GGCTGGCAGGGGTGGGGGGAGGG + Intergenic
1062225376 9:135446956-135446978 GGCTGGCAGGGGTGGGGGGAGGG + Intergenic
1062225447 9:135447143-135447165 GGCTGGCAGGGGTGGGGGGAGGG + Intergenic
1062280722 9:135750552-135750574 CTCTGGCTGGGAACGGGGCAGGG - Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062361451 9:136190214-136190236 ATGAGGCAGGGGGAGGGGGAGGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062506986 9:136882609-136882631 CTCCAGCAGGGGCAGGGGGAGGG - Intronic
1062513635 9:136921405-136921427 CTCGGGCAGGGGTCGGGGTAGGG + Intronic
1062564165 9:137156551-137156573 CTCTAGGAGGGGATGGGGGCTGG + Intronic
1062574757 9:137200858-137200880 CTATGGCAGGGGAGGAGGGCGGG + Intronic
1185476664 X:419522-419544 CTCGGGCTGGGGCAGGGAGAGGG - Intergenic
1185547909 X:960622-960644 CTCTTGCAGGGAAGGGGGGGGGG + Intergenic
1185604361 X:1359338-1359360 CCCAGGCAGGGGCTGGGGGAGGG - Intronic
1185615737 X:1420656-1420678 TTCTGGGCGGGGAAAGGGGAAGG + Intronic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185836197 X:3347205-3347227 CTCTGGCAAGGGGAGGGAGGCGG - Intergenic
1186250140 X:7656828-7656850 ACATGGCAGGGGATGGGGGAAGG + Intergenic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186506593 X:10098312-10098334 CCCTGGCTGGGGAGGGGGGAGGG - Intronic
1187066426 X:15843310-15843332 CTTTGGGAGGCCAAGGGGGACGG + Intronic
1187348355 X:18488568-18488590 TTCTGGGAGGGGAAAAGGGAAGG + Intronic
1187473531 X:19589874-19589896 CTTTGGGAGGGCAAGGCGGAAGG + Intronic
1187579269 X:20591452-20591474 CTCTGCCAGTGGAAAGGGGAGGG - Intergenic
1187579437 X:20592567-20592589 CACTGCCAGGGAATGGGGGAGGG + Intergenic
1187639417 X:21272606-21272628 CCCTGCCAGGGGATGGGGTAGGG - Intergenic
1187805030 X:23110432-23110454 TTGTGGGAGGGAAAGGGGGAGGG - Intergenic
1187959953 X:24558979-24559001 CCCTGACAGGTGAAGAGGGAAGG - Intronic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1188186296 X:27119289-27119311 CTTTGGCAGGCCAAGGGGGGTGG - Intergenic
1188668251 X:32851689-32851711 CTCTGCCAGGGGATGGGGGAGGG - Intronic
1189304249 X:39974595-39974617 CTCAGGCAGGGGAAGGGCTGGGG + Intergenic
1189348251 X:40258671-40258693 CACTGGCTGGGGATGGGGCAGGG + Intergenic
1189425981 X:40900284-40900306 CATTGGCAAGGGAAGGGGGTGGG - Intergenic
1189593904 X:42543877-42543899 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1189599660 X:42609563-42609585 GCCTGTCAGGGGATGGGGGAAGG + Intergenic
1190015179 X:46820272-46820294 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1190057262 X:47188222-47188244 CTCTGGGGTGGGAAGAGGGAAGG - Intergenic
1190152025 X:47956985-47957007 CACTGGCAGGGGAAGGGGCTTGG + Intronic
1190374284 X:49774368-49774390 CTCTGCCTGTGGAAGGAGGAGGG - Intergenic
1190790147 X:53691646-53691668 CTCTGGCAAGGGTATGGGGGCGG - Intergenic
1191767347 X:64712674-64712696 GTGGGGCAGGGGGAGGGGGAAGG - Intergenic
1192210914 X:69127171-69127193 CCCTGGCAGTGGAGAGGGGAGGG - Intergenic
1192317944 X:70066700-70066722 CTCTGACAGCGGAAGGGGCTGGG + Intergenic
1192428384 X:71096623-71096645 CTCTGGTCGGGGAAGGGGCCAGG - Exonic
1192694511 X:73400028-73400050 CTCTGCCTGGAGAAAGGGGAGGG + Intergenic
1193052348 X:77115005-77115027 CTCTGCCTGGGAAAAGGGGAGGG - Intergenic
1193136653 X:77979073-77979095 CTTTGGAAGGTGAAGGGGGGCGG - Intronic
1193194965 X:78620441-78620463 CACTGGCAGGAGATGGGGAAGGG + Intergenic
1193219781 X:78910516-78910538 CACTGCCAGGGGATGGGGGAGGG + Intergenic
1193529688 X:82642009-82642031 CTCTTCCAGGGAAAGAGGGAGGG - Intergenic
1193596542 X:83452309-83452331 CACTGCCAGGGGATGGGGGAGGG + Intergenic
1193894895 X:87100876-87100898 CTCTGACTGTGGAAAGGGGAAGG + Intergenic
1194000654 X:88424719-88424741 CCCTGGCAGGGGCAGGGGGCAGG + Intergenic
1194255300 X:91627294-91627316 CTCAGGCAGCGGAAGGGGTCAGG + Intergenic
1194338652 X:92682049-92682071 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1194527204 X:94991207-94991229 CTCTGGGAGGGCAAGGCGGATGG + Intergenic
1195282329 X:103348318-103348340 CGCTGGAAGGGGAAGGGGCCGGG - Intergenic
1195318714 X:103703685-103703707 CTTTGGAAGGCCAAGGGGGAAGG + Intergenic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195501959 X:105612645-105612667 TGCTGTCAGGGGATGGGGGAGGG - Intronic
1195719341 X:107851521-107851543 CCAGGGCAGGGGATGGGGGAAGG - Intronic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1196157705 X:112449155-112449177 CTCTGACAGGGATATGGGGATGG + Intergenic
1196279192 X:113802923-113802945 CTCTGGCAGGAGCAGGAGGTCGG - Intergenic
1196624029 X:117857248-117857270 GTCAGGAAGGGAAAGGGGGAAGG + Intergenic
1197053967 X:122094533-122094555 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1197160545 X:123317875-123317897 CTCTGCCAGGGCAATGCGGAAGG - Intronic
1197376051 X:125682808-125682830 CTCTGCCTGGGAAAAGGGGAGGG + Intergenic
1197726784 X:129781802-129781824 CTCTGGCAGGGGTTGGGGTGGGG - Intronic
1197845818 X:130801260-130801282 TTATGGTGGGGGAAGGGGGAAGG + Intronic
1198115839 X:133543985-133544007 TTCTGGTAGGCCAAGGGGGATGG + Intronic
1198278145 X:135116949-135116971 CTCGGGACGGGGAAGGGGGTGGG - Intergenic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198292817 X:135255567-135255589 CTCGGGACGGGGAAGGGGGTGGG + Intronic
1198343105 X:135733818-135733840 CTCGGGCAGGAGGAGTGGGAGGG + Intergenic
1198344884 X:135749477-135749499 CTCGGGCAGGAGGAGTGGGAGGG - Intergenic
1199314826 X:146364171-146364193 CACTGTGAGGGGATGGGGGAGGG + Intergenic
1199316113 X:146379758-146379780 CTCTGACACTGGAAGGGGGCAGG + Intergenic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1199601992 X:149546532-149546554 CGCTGGGAGAGGCAGGGGGAGGG - Intronic
1199622922 X:149715198-149715220 CCCTGGCAGGAGAAAGGTGAGGG + Intronic
1199648396 X:149932952-149932974 CGCTGGGAGAGGCAGGGGGAGGG + Intronic
1199704370 X:150411257-150411279 CTTTGGCTGAGGAAGGGGAACGG - Intronic
1199833553 X:151566389-151566411 CTCTGGAAGGAGAAGGCAGAGGG + Intronic
1200155191 X:153971373-153971395 CGCTGGGCGGGGAAGCGGGACGG - Exonic
1200175610 X:154113862-154113884 TTCTGGCAGGGGGAGGGAAAAGG - Intergenic
1200315933 X:155132999-155133021 CTCTGCCTGTGGAAGGGGGAGGG + Intronic
1200370106 X:155715928-155715950 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1200647043 Y:5798831-5798853 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1200829151 Y:7673447-7673469 CTCTGGCAGGGGGAGGGCGGAGG - Intergenic
1201075622 Y:10185193-10185215 CTCTGGCAAGGGGTGGGAGAAGG - Intergenic
1201403017 Y:13623505-13623527 GTGTGGCTGGGGAAGGGGGGAGG - Intergenic
1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG + Intergenic
1202390892 Y:24369440-24369462 CCTTAGCAGGGGTAGGGGGACGG + Intergenic
1202479892 Y:25300676-25300698 CCTTAGCAGGGGTAGGGGGACGG - Intergenic