ID: 1095319327

View in Genome Browser
Species Human (GRCh38)
Location 12:40806743-40806765
Sequence CACACATATTGTCCCTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095319326_1095319327 20 Left 1095319326 12:40806700-40806722 CCTCTGCAGATCTTTAAAATTTT 0: 1
1: 0
2: 3
3: 52
4: 567
Right 1095319327 12:40806743-40806765 CACACATATTGTCCCTAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 178
1095319325_1095319327 28 Left 1095319325 12:40806692-40806714 CCATATGGCCTCTGCAGATCTTT 0: 1
1: 0
2: 3
3: 20
4: 188
Right 1095319327 12:40806743-40806765 CACACATATTGTCCCTAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 178
1095319324_1095319327 29 Left 1095319324 12:40806691-40806713 CCCATATGGCCTCTGCAGATCTT 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1095319327 12:40806743-40806765 CACACATATTGTCCCTAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095319327 Original CRISPR CACACATATTGTCCCTAGTG TGG Intronic
907344000 1:53759140-53759162 CCCACACAGAGTCCCTAGTGGGG - Intergenic
907439279 1:54468865-54468887 CCCACACAGTGTCCCTACTGGGG + Intergenic
909806973 1:79884134-79884156 CCCACATAGAGTCCCTACTGGGG - Intergenic
912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG + Intronic
917290870 1:173471153-173471175 CCCACATAGAGTCCCTACTGGGG + Intergenic
918778158 1:188665235-188665257 CACACACAGAGTCCCTAATGGGG + Intergenic
919290502 1:195623862-195623884 CCCACATAGAGTCCCTAATGGGG + Intergenic
922258143 1:223911105-223911127 GACACATATTCTCACTAATGTGG - Intergenic
922890444 1:229057960-229057982 CAAACATATTGTCCCCAGGCTGG + Intergenic
923461236 1:234211291-234211313 CACACACACAGTCCCTACTGGGG + Intronic
1066972509 10:42325247-42325269 CACATATATTCTCCCTAGAAGGG - Intergenic
1067359922 10:45569643-45569665 CACACATTTTTTCCCAACTGAGG - Intronic
1067799591 10:49349869-49349891 GACACAGACTGTCCTTAGTGGGG + Intergenic
1068317473 10:55365242-55365264 TAAACATATTGTTCCTACTGTGG - Intronic
1068531661 10:58195379-58195401 CACACTAATTGTCCTTACTGGGG - Exonic
1068552913 10:58426324-58426346 CCCACATAGAGTCCCTACTGGGG - Intergenic
1069845375 10:71367364-71367386 CACACAGATGGTGCCTTGTGGGG - Intergenic
1069902661 10:71715005-71715027 CACAGATAGCATCCCTAGTGTGG + Exonic
1070329279 10:75406207-75406229 CACACACATAGTCACTACTGAGG - Intergenic
1070399388 10:76040081-76040103 CACATAGATTGTCAGTAGTGGGG + Intronic
1072294406 10:93995119-93995141 CTCAAAAATTCTCCCTAGTGGGG - Intronic
1074022356 10:109597037-109597059 CTCACATAGAGTCCCTACTGGGG - Intergenic
1074829029 10:117235786-117235808 CACTTACATCGTCCCTAGTGAGG + Intergenic
1076776444 10:132700512-132700534 CTAACATTCTGTCCCTAGTGTGG + Intronic
1078407907 11:11087179-11087201 CACACATATAGTGTGTAGTGGGG + Intergenic
1078450935 11:11440358-11440380 CACACAGAGTGTCCCTAACGTGG - Intronic
1080946711 11:36981960-36981982 CCCACATAGTGTCCCCACTGGGG - Intergenic
1081083815 11:38774903-38774925 CACACACAGAGTCCCTACTGGGG - Intergenic
1081184089 11:40020796-40020818 AACACAAATTGTCACTAGTTAGG + Intergenic
1083820553 11:65168941-65168963 AACAAATATTCTCCCCAGTGTGG + Intergenic
1085279561 11:75321013-75321035 CACACATACACTCACTAGTGGGG + Intronic
1087721870 11:101674936-101674958 CACACATTTTGTCTGTAATGGGG - Intronic
1088435215 11:109804770-109804792 CCCACATAGAGTCCCTACTGGGG - Intergenic
1091086321 11:132725090-132725112 CACACACAGAGTCCCTACTGGGG - Intronic
1092652251 12:10647085-10647107 CCCACACAATGTCCCTATTGGGG + Intronic
1094607874 12:31964847-31964869 CACATTTATGGTCCCTAGTAAGG - Intronic
1095319327 12:40806743-40806765 CACACATATTGTCCCTAGTGTGG + Intronic
1095544116 12:43344906-43344928 CCCACATAGAGTCCCCAGTGGGG - Intergenic
1098493829 12:71112193-71112215 CACACACAGAGTCCCTACTGGGG - Intronic
1099898783 12:88681724-88681746 CACACACAGAGTCCCTACTGGGG + Intergenic
1101302774 12:103498501-103498523 CATCCATATTGTCACAAGTGGGG - Intergenic
1105690695 13:22836320-22836342 CACACTAATTGTCCTTACTGGGG - Intergenic
1109576320 13:64263788-64263810 CACACATAGAGTTCCTACTGGGG + Intergenic
1110543164 13:76728167-76728189 CCCACACAGTGTCCCTACTGGGG + Intergenic
1114012433 14:18384218-18384240 CACATATATTCTCCCTAGAAGGG - Intergenic
1115854225 14:37611811-37611833 TACACACATCGACCCTAGTGGGG - Intronic
1115919412 14:38355699-38355721 CACACACAAAGTCCCTACTGGGG + Intergenic
1116642759 14:47485982-47486004 CCCACACAGAGTCCCTAGTGAGG + Intronic
1117181989 14:53200629-53200651 CTCACATAGAGTCCCTACTGGGG + Intergenic
1117256796 14:53986117-53986139 CCCACATGTAGTCCCTACTGGGG + Intergenic
1120132516 14:80823870-80823892 CCCGCACATTGTCCCTACTGGGG - Intronic
1126873204 15:53011237-53011259 CCCACACAGAGTCCCTAGTGGGG - Intergenic
1126921643 15:53533122-53533144 CACACACAGTGTTCCAAGTGTGG - Intronic
1127911849 15:63422772-63422794 CACACAGATTGTACCTTGGGCGG - Intergenic
1128116704 15:65112036-65112058 CTCTCATGTTGTACCTAGTGAGG - Intronic
1133375475 16:5283307-5283329 CCCACATAGAGTCCCTACTGTGG + Intergenic
1136117457 16:28103763-28103785 CACACATACTGACTCTTGTGTGG - Intronic
1136649264 16:31652394-31652416 CACATATATTCTCCCTAGAAGGG + Intergenic
1137818549 16:51422149-51422171 CCCACACAGAGTCCCTAGTGGGG - Intergenic
1148220867 17:45860852-45860874 GACACCAATTGTCCCTAGTCTGG - Intergenic
1149145778 17:53490960-53490982 CCCACATAGAGTCCCCAGTGGGG - Intergenic
1149366816 17:55953269-55953291 CCCACATAGAGTCCCTACTGGGG + Intergenic
1153062096 18:1005081-1005103 CCCATATATTTTCCCTACTGGGG + Intergenic
1158335838 18:56414393-56414415 CCCACATAGAGTCCCCAGTGGGG + Intergenic
1159273843 18:66189940-66189962 CACACATATCTTCCCATGTGTGG - Intergenic
1159328607 18:66957582-66957604 CAAACATATTCTCCCTTCTGTGG - Intergenic
1159962386 18:74565837-74565859 CCCACATGAAGTCCCTAGTGGGG - Intronic
1164216319 19:23153219-23153241 CACACATATTCTCCCTAGAAAGG + Intergenic
1164223244 19:23216643-23216665 CACATATATTCTCCCTAGAAAGG - Intergenic
1164870190 19:31636724-31636746 CACACTTATTTTGCCTTGTGAGG - Intergenic
930952533 2:57160702-57160724 CACTCAAATTATCCCCAGTGAGG - Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
935158049 2:100501404-100501426 CACACATCTTCTCCATAGGGAGG + Intergenic
935724088 2:106007871-106007893 CCCACATAGAGTCCCTACTGGGG + Intergenic
937673596 2:124564752-124564774 CACACTTATAGTCCGTAGTTGGG - Intronic
938868827 2:135452919-135452941 CCCACACAGTGTCCCTACTGGGG - Intronic
939050256 2:137298929-137298951 CCCACACAGAGTCCCTAGTGGGG + Intronic
939079209 2:137639481-137639503 CCCACACAGAGTCCCTAGTGGGG + Intronic
940935104 2:159484025-159484047 CACCCATATGTTCCCTGGTGGGG - Intronic
944044084 2:195388651-195388673 CCCACATAGAGTCCCTACTGGGG + Intergenic
946635840 2:221724651-221724673 CCCACATATAGTCCCCACTGGGG + Intergenic
948363214 2:237437243-237437265 CACAAATAGTGTCCTTAGAGAGG + Intergenic
1170079035 20:12450912-12450934 CCCACACAGTGTCCCTAGTGGGG + Intergenic
1171720932 20:28562739-28562761 CACACATATTCAGCCCAGTGGGG + Intergenic
1172298117 20:33828200-33828222 CACACATCTTGTCCATACAGAGG + Intronic
1173602545 20:44306348-44306370 CACTCCTTTTGTCCCTAGAGTGG - Exonic
1175195346 20:57239566-57239588 CCCACACAGAGTCCCTAGTGGGG - Intronic
1177017953 21:15815332-15815354 CACACAGAGAGTCCCTACTGGGG + Intronic
1177473113 21:21584227-21584249 CCCACATAGTGTCCCCACTGGGG + Intergenic
1178015820 21:28344974-28344996 CACACATATTGTTCCAAGGATGG - Intergenic
1180436926 22:15315027-15315049 CACATATATTCTCCCTAGAAGGG - Intergenic
1180519166 22:16179212-16179234 CACATATATTCTCCCTAGAAGGG - Intergenic
1182913358 22:34006009-34006031 CACACACAGAGTCCCTACTGGGG - Intergenic
951177121 3:19615155-19615177 CCCACATAGAGTCCCCAGTGGGG - Intergenic
953734225 3:45477534-45477556 CACAAAGATTGTCCCCAGGGAGG + Intronic
953972756 3:47359851-47359873 CACACACAGAGTCCCCAGTGGGG + Intergenic
954300675 3:49699324-49699346 CCCACTTATTCTCCCTAGGGAGG - Intronic
956022903 3:64951174-64951196 CATACATGCTGCCCCTAGTGAGG - Intergenic
957896300 3:86424782-86424804 CTCACACAGTGTCCCTACTGTGG - Intergenic
959788792 3:110332516-110332538 CACACACAGAGTCCCTACTGGGG - Intergenic
961609917 3:128128475-128128497 CACACACATTGTCTATCGTGTGG + Intronic
964461014 3:156928344-156928366 CCCACAGGGTGTCCCTAGTGGGG + Intronic
964589219 3:158341664-158341686 CCCACACAGAGTCCCTAGTGGGG + Intronic
965218379 3:165894434-165894456 CAAACATACTGCCCCTAGTGTGG + Intergenic
967513636 3:190341189-190341211 CCCACATAGAGTCCCTACTGGGG - Intronic
967560766 3:190916726-190916748 CTCAGATATTTTCCCTTGTGTGG + Intergenic
968014739 3:195319303-195319325 CCCACATATAGTCCCCACTGTGG + Intronic
969418275 4:7075012-7075034 CACTCCTACTGTCCCGAGTGTGG + Intergenic
971570432 4:28204746-28204768 CACACACAGAGTCCCTACTGGGG - Intergenic
971743651 4:30551643-30551665 CACACACAGAGTCCCTACTGGGG + Intergenic
975253951 4:72212906-72212928 CCCACATAGAGTCCCTAGTGGGG - Intergenic
976503104 4:85814797-85814819 CCCACATAGAGTCCCTACTGGGG - Intronic
978083380 4:104621233-104621255 CCCACATACAGTCCCTACTGGGG - Intergenic
980023362 4:127735576-127735598 CAGACATTTTGTGCCTACTGGGG - Intronic
982832917 4:160086259-160086281 CACACACAGAGTCCCTACTGGGG - Intergenic
983348657 4:166559428-166559450 CCCACACAGTGTCCCTACTGGGG + Intergenic
984096761 4:175444432-175444454 CACAAACATTGTACCTAGAGTGG - Intergenic
986048844 5:4068116-4068138 CACACATACTGTCCGTAGCTGGG + Intergenic
986105487 5:4655784-4655806 CCCACACAGTGTCCCTACTGGGG - Intergenic
986246517 5:6012068-6012090 CTCACACATAGTCCCTACTGGGG - Intergenic
986458196 5:7941566-7941588 CACATATTTTGTCTCTTGTGAGG - Intergenic
986780253 5:11058607-11058629 CACACACAGAGTCCCTACTGGGG + Intronic
987510343 5:18828942-18828964 CACACACAGAGTCCCTACTGGGG + Intergenic
988009245 5:25461929-25461951 CACACACAGAGTCCCTAATGGGG + Intergenic
988421512 5:31011332-31011354 AATACATTATGTCCCTAGTGAGG + Intergenic
988879622 5:35486892-35486914 CATACATGTTGTCTCCAGTGTGG + Intergenic
989742095 5:44785316-44785338 AACAAATATTGTACCTAGGGTGG - Intergenic
990193276 5:53286191-53286213 CCCACACAGTGTCCCTACTGGGG - Intergenic
992562176 5:77963633-77963655 CACATATATTGTCTCTACTTGGG - Intergenic
994132739 5:96249029-96249051 CATATATTTAGTCCCTAGTGAGG - Intergenic
994878160 5:105451392-105451414 CTCACATAGAGTCCCTACTGGGG + Intergenic
995148537 5:108814439-108814461 AACACGTATTGTACCTAGGGTGG - Intronic
995333804 5:110976148-110976170 CACACACAGAATCCCTAGTGGGG - Intergenic
996460214 5:123732799-123732821 CCCACACAGTGTCCCTACTGGGG + Intergenic
997267639 5:132505018-132505040 CACAAATATTTACCCTTGTGTGG + Intergenic
998743946 5:145235517-145235539 CACTCAAATCGTCCCTGGTGGGG + Intergenic
1003324521 6:5082504-5082526 CACACTTATGGCCCCAAGTGGGG - Intergenic
1004566722 6:16804901-16804923 AACTCATAATGGCCCTAGTGTGG + Intergenic
1005329124 6:24731984-24732006 CCCACATAGAGTCCCTACTGGGG + Intergenic
1006298602 6:33181181-33181203 CACACATGTAGCCCCCAGTGGGG + Intronic
1006344186 6:33466605-33466627 CCCACACAAAGTCCCTAGTGGGG + Intergenic
1008820942 6:55629986-55630008 CCCACACAGTGTCCCTATTGGGG + Intergenic
1008930189 6:56931444-56931466 CCCACATAGAGTCCCTACTGGGG + Intronic
1010263781 6:73845212-73845234 CCCACACAGAGTCCCTAGTGGGG + Intergenic
1010549290 6:77201321-77201343 CCCACATAGAGTCCCTACTGGGG + Intergenic
1010923104 6:81708742-81708764 CATACATATTGTTCCCAGTTTGG + Intronic
1011011156 6:82705445-82705467 CACACACAGAGTCCCTACTGGGG - Intergenic
1012005450 6:93707872-93707894 CCCACATAGAGTCCCTACTGGGG + Intergenic
1012179848 6:96139501-96139523 CACACAGAGTGTCCCCACTGGGG - Intronic
1015969583 6:138730693-138730715 CCCACATAGAGTCCCTACTGGGG - Intergenic
1023140838 7:37100760-37100782 CACACACACTGTCCTTCGTGTGG - Intronic
1025794088 7:64721421-64721443 CACATATATTCTCCCTAGAAGGG + Intergenic
1025821146 7:64965777-64965799 CACATATATTGTCTCTAGAAGGG - Intergenic
1028253135 7:88559110-88559132 CCCACATAGAGTCCCTACTGGGG + Intergenic
1031322701 7:120352645-120352667 CTAACATATTGTCCCTAGGTTGG - Intronic
1031478185 7:122247948-122247970 CCCACACATTGACCCTACTGGGG + Intergenic
1031608260 7:123794814-123794836 GTCACACATAGTCCCTAGTGTGG + Intergenic
1031669792 7:124528717-124528739 CCCACATAAAGTCCCCAGTGAGG - Intergenic
1036282054 8:7408748-7408770 CCCACACAGTGTCCCCAGTGGGG + Intergenic
1036339415 8:7902823-7902845 CCCACACAGTGTCCCCAGTGGGG - Intergenic
1041903219 8:63005664-63005686 AACAAATATTGAGCCTAGTGTGG + Intergenic
1043510543 8:80946232-80946254 CTCACACAGTGTCCCTACTGGGG + Intergenic
1044072949 8:87785052-87785074 CCCACATAGAGTCCCTAATGGGG - Intergenic
1044107811 8:88233774-88233796 GACACAACTTGTCCCTAATGTGG + Intronic
1047628086 8:126677400-126677422 CCCACATAGAGTCCCTACTGTGG + Intergenic
1049875250 8:145013714-145013736 CACACTTATAATCCCTTGTGTGG + Intergenic
1050638575 9:7640858-7640880 CAAACATATTGTCACTAGTATGG - Intergenic
1050695534 9:8275688-8275710 CTCACACAGTGTCCCTACTGGGG - Intergenic
1051810690 9:21046365-21046387 CACAAATTTTGTGCCAAGTGAGG + Intergenic
1051975402 9:22942136-22942158 CCCACACAGTGTCCCTACTGGGG - Intergenic
1052210150 9:25894060-25894082 CCCACACAGAGTCCCTAGTGGGG - Intergenic
1052831660 9:33221031-33221053 CACACATATGGTCCCTGCTGGGG + Intronic
1052984371 9:34475586-34475608 CACACATAAGGTGCATAGTGTGG - Intronic
1053703237 9:40722680-40722702 CACATATATTCTCCCTAGAAGGG + Intergenic
1054413294 9:64846145-64846167 CACATATATTCTCCCTAGAAGGG + Intergenic
1059503554 9:114777623-114777645 CAGACAAACTTTCCCTAGTGAGG - Intergenic
1059843301 9:118242856-118242878 CCCACATATAGTCCCCACTGGGG - Intergenic
1190946485 X:55099316-55099338 CACACATATTGTGCCTACGAAGG - Intronic
1191909406 X:66132062-66132084 CACACATATTCTCCATTCTGTGG + Intergenic
1193307998 X:79972386-79972408 CCCACATAGAGTCCCTACTGGGG + Intergenic
1194501780 X:94690533-94690555 CCCACACAGTGTCCCTATTGGGG + Intergenic
1194542361 X:95190251-95190273 CCCACACATAGTCCCTACTGGGG - Intergenic
1195591708 X:106636302-106636324 AACCCTTATTGTTCCTAGTGTGG + Intronic
1197567139 X:128101517-128101539 CACACACAGAGTCCCTACTGGGG - Intergenic
1199202383 X:145107676-145107698 CACATATATTGTCACTAAGGTGG + Intergenic