ID: 1095324848

View in Genome Browser
Species Human (GRCh38)
Location 12:40877052-40877074
Sequence GTTCATACTCACAATTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095324848_1095324850 9 Left 1095324848 12:40877052-40877074 CCAAAATAATTGTGAGTATGAAC 0: 1
1: 0
2: 3
3: 29
4: 270
Right 1095324850 12:40877084-40877106 TGTGAGCTTCTTGAACAAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095324848 Original CRISPR GTTCATACTCACAATTATTT TGG (reversed) Intronic
901155211 1:7132092-7132114 GTTCATTTTCACAATTATTTTGG + Intronic
901543563 1:9938155-9938177 GTTCATGCTCACAAGTAATTAGG - Intronic
906818169 1:48900430-48900452 GTTCTTTCTCAAAGTTATTTTGG - Intronic
906846941 1:49203278-49203300 GATCCTATTCTCAATTATTTCGG - Intronic
907529272 1:55077199-55077221 GTTCTGACTCACTTTTATTTAGG - Intronic
908303870 1:62790830-62790852 GTTCACAAACACAATTGTTTTGG - Intronic
908778980 1:67671040-67671062 ATTCATACACATAATGATTTGGG + Intergenic
908873654 1:68644968-68644990 GTTCAAACTTACAACTATTTTGG + Intergenic
909255656 1:73417457-73417479 GTTGTTACTCAAAATTATATTGG - Intergenic
909304311 1:74053308-74053330 TGTCATACTCAAAATTATATAGG - Intronic
910925580 1:92394870-92394892 CTTCATTTTCAGAATTATTTTGG - Exonic
911318881 1:96387900-96387922 CTTCTTACTCACAAGTCTTTAGG + Intergenic
912151422 1:106863412-106863434 GCTCAAACTCATAATTAGTTTGG - Intergenic
914736276 1:150420107-150420129 GTTCTTATTCACAATTATACTGG - Intronic
915704117 1:157827331-157827353 GTTGATACACACAATTATGGAGG + Intergenic
916150297 1:161782057-161782079 GGTCATACTCAAAATTAGGTGGG + Intronic
917695974 1:177524522-177524544 TTTCATAATCACAAATACTTGGG - Intergenic
918358385 1:183728678-183728700 GTTCTTTCTCAAAATTGTTTTGG - Intronic
918726638 1:187934121-187934143 GTTTATGCAGACAATTATTTAGG + Intergenic
918934350 1:190901014-190901036 GTTCAAATTCACATTTCTTTTGG - Intergenic
918940081 1:190982415-190982437 GTTCAGCCTCCCAAGTATTTGGG + Intergenic
919146214 1:193638870-193638892 GTTCTTTCTCAAGATTATTTTGG + Intergenic
919816146 1:201441102-201441124 GTTCTTTTTCACAATTGTTTTGG - Intergenic
920790188 1:209082717-209082739 ATCCATACACACACTTATTTAGG - Intergenic
922438902 1:225634875-225634897 GTTCTTTCTCAAGATTATTTTGG + Intronic
922854706 1:228764823-228764845 GTTAATCCACAAAATTATTTTGG - Intergenic
923446818 1:234079014-234079036 GTTCTTTCTCAAGATTATTTAGG - Intronic
1063783188 10:9350178-9350200 GCCCATACTCAGCATTATTTTGG - Intergenic
1063895538 10:10677463-10677485 GGTCACAATCAGAATTATTTAGG + Intergenic
1065300993 10:24321172-24321194 GTTCCTGCTTTCAATTATTTTGG - Intronic
1065470460 10:26075190-26075212 TTTCTTCCTCAGAATTATTTTGG + Intronic
1066692371 10:38043006-38043028 GTTCAAATCCACAATTATTGTGG - Intronic
1068191837 10:53662449-53662471 GTAAATAGTTACAATTATTTTGG + Intergenic
1068767763 10:60782934-60782956 GTTAATTCTGAAAATTATTTAGG + Intronic
1069059397 10:63878705-63878727 CTTCTTACTCAAGATTATTTTGG + Intergenic
1071387302 10:85134282-85134304 TTTCATACTCACAAGTATTTAGG + Intergenic
1074802247 10:117012306-117012328 GTTCTTATTCAGAATTGTTTTGG - Intronic
1074906637 10:117869911-117869933 GTTCATACTGGAAAGTATTTTGG + Intergenic
1075193609 10:120334462-120334484 AATCTGACTCACAATTATTTTGG + Intergenic
1075577865 10:123593117-123593139 GTTCATTTTCAGAATTGTTTTGG - Intergenic
1076261805 10:129072401-129072423 GTTTGAACTCAGAATTATTTGGG - Intergenic
1076703567 10:132287906-132287928 GTTCTTTCTCAAAATTATTTTGG - Intronic
1079611139 11:22433826-22433848 CTTCACACTCTCAATTATTGAGG + Intergenic
1079649813 11:22913178-22913200 GTTCTTTTTCAAAATTATTTTGG + Intergenic
1079701082 11:23549601-23549623 TTTCATACTTAAAAATATTTTGG + Intergenic
1081018241 11:37908852-37908874 TTTCATACTGACAATAATGTAGG - Intergenic
1081720034 11:45281951-45281973 TTTCTTACTCCCAATTCTTTAGG + Intronic
1083057899 11:59840670-59840692 GTTTATACTCAAAATGATTAAGG - Intronic
1083295490 11:61713143-61713165 CTTCAGACTCACAATCATGTGGG - Intronic
1085954464 11:81374515-81374537 GTTCTTGCTCAAAATTACTTTGG + Intergenic
1086435574 11:86776979-86777001 GTTCCTACTTTCAATTCTTTGGG + Intergenic
1087932367 11:103992796-103992818 GTTCATGCTCATAATGTTTTTGG - Intronic
1088155119 11:106793060-106793082 CTTCATTCTCAAGATTATTTTGG - Intronic
1088386206 11:109259493-109259515 GTTCTTACTCAAAATCACTTTGG + Intergenic
1088898613 11:114096954-114096976 GTTCCTGCTTTCAATTATTTAGG - Intronic
1090002992 11:122978080-122978102 GTTAATCCTCATCATTATTTTGG - Intronic
1090165258 11:124539965-124539987 GTTCATATTGAGAATTAGTTGGG + Intergenic
1091686856 12:2568472-2568494 GATCCTACTTTCAATTATTTTGG - Intronic
1092620943 12:10267787-10267809 GTTCATATTAACAATTACTCTGG - Intergenic
1093647465 12:21604008-21604030 TTTCATATTCACAATTAGCTTGG - Intronic
1094112353 12:26875064-26875086 ATGCAAACTCAAAATTATTTTGG + Intergenic
1095324848 12:40877052-40877074 GTTCATACTCACAATTATTTTGG - Intronic
1095801882 12:46277623-46277645 GTTCACATTCATAATTATTAAGG - Intergenic
1097751403 12:63358180-63358202 GTTTTTACTCAAAATAATTTTGG + Intergenic
1098110152 12:67113116-67113138 CTGCATCCTCACAATTCTTTAGG - Intergenic
1098299454 12:69039131-69039153 GTTCAAAATCACAGTTATGTTGG - Intergenic
1098485440 12:71016175-71016197 GTGCCTACTTACATTTATTTTGG - Intergenic
1098870061 12:75807253-75807275 TTTCTTTCTCAAAATTATTTTGG + Intergenic
1099001628 12:77184889-77184911 GTTCATAGTTTAAATTATTTAGG + Intergenic
1100879716 12:99003282-99003304 GTTCTTTCTCAAAATTATTCCGG + Intronic
1104325742 12:127795666-127795688 CTTCATCCTCAAAATTATGTTGG + Intergenic
1104615246 12:130262590-130262612 CTTCATACTGACATTTTTTTCGG - Intergenic
1105333832 13:19444734-19444756 CTTCTTTCTCACAATTGTTTGGG - Intronic
1105617685 13:22034651-22034673 GTTCTTCTTCACAATTGTTTTGG + Intergenic
1106905279 13:34401659-34401681 GTACATACTCAAAATTATAGTGG + Intergenic
1107226795 13:38059735-38059757 ATGTATACTCACAAATATTTTGG - Intergenic
1108134109 13:47336905-47336927 GTTCTTTCTCAAAATTGTTTTGG - Intergenic
1108302643 13:49094418-49094440 ATTAATACTTACAATGATTTAGG - Intronic
1108889724 13:55240696-55240718 TTTCTTGCTCAAAATTATTTGGG + Intergenic
1109648657 13:65294923-65294945 GTTTATGCTCAAAATTAATTTGG - Intergenic
1110166080 13:72445379-72445401 GTTCAGACTCACAATTCTCCTGG + Intergenic
1110886927 13:80651019-80651041 GTTTGTTTTCACAATTATTTTGG - Intergenic
1111166631 13:84465832-84465854 ATTCATATTCACAATTGTTGGGG - Intergenic
1111582622 13:90243920-90243942 GTTAATTCTCACAAGTATTTAGG - Intergenic
1111789478 13:92835922-92835944 GTTCAGACTCACTGTAATTTAGG - Intronic
1112526691 13:100155373-100155395 GTTAATACTCAAAACTAATTGGG - Intronic
1112891975 13:104247526-104247548 TTTCATACTCAAAATTATATAGG - Intergenic
1114883098 14:26811401-26811423 GCACATATTAACAATTATTTTGG - Intergenic
1116646689 14:47537869-47537891 GTTCATAGTAATAAATATTTAGG + Intronic
1117433282 14:55691922-55691944 GTTCACTCTCACAATGATCTAGG + Intronic
1118561006 14:67082580-67082602 GTTCTTTTTCACAATTGTTTTGG + Intronic
1119962685 14:78878166-78878188 TTTCATAATCACAAGTAATTGGG + Intronic
1123859771 15:24452772-24452794 CTTCTTTCTCAAAATTATTTAGG + Intergenic
1125129775 15:36270284-36270306 GTTCATATTTACAAAAATTTCGG - Intergenic
1126421422 15:48476985-48477007 GTTAATATTCACCAATATTTTGG - Intronic
1128101020 15:64999928-64999950 GTTGATTCTCAAAATTATTTTGG + Intergenic
1132116490 15:99140005-99140027 ATTCTTTCTCAAAATTATTTTGG - Intronic
1137066143 16:35845979-35846001 GTTCCTGCTCTCAATTCTTTTGG - Intergenic
1139056621 16:63193776-63193798 ATTCATACTTACAAATATTTAGG + Intergenic
1143613689 17:8036850-8036872 GTTCTTACTTTCAATTCTTTAGG - Intergenic
1145108659 17:20142325-20142347 GTTCCTGCTTTCAATTATTTTGG - Intronic
1147344859 17:39783669-39783691 GCCCATAATCACAATAATTTGGG + Intronic
1147352407 17:39860309-39860331 GTATATACTTACACTTATTTAGG - Intronic
1147730373 17:42596682-42596704 GTTGATACTCCCTTTTATTTAGG + Intronic
1151297456 17:73195852-73195874 GTAAATATACACAATTATTTTGG - Intronic
1156393711 18:36677696-36677718 GTTCTTACTCAAAATTGTCTTGG + Intronic
1156969482 18:43137799-43137821 GATCAGGCTCACATTTATTTGGG - Intergenic
1157029778 18:43891398-43891420 GTTCAAAGTTATAATTATTTAGG + Intergenic
1157859047 18:51124635-51124657 GTTCATTCTCAGCATTCTTTGGG + Intergenic
1158208970 18:55024670-55024692 GTCAATTCTCACAAATATTTTGG + Intergenic
1158651158 18:59287409-59287431 GTTCCTGCTTTCAATTATTTTGG - Intronic
1159725970 18:71959907-71959929 GTTCCTATTCATAATTATTTTGG - Intergenic
1160545085 18:79647961-79647983 GTTCTTTCTCAAAATTGTTTTGG - Intergenic
1161930172 19:7334169-7334191 GTTAATACATACAAATATTTTGG - Intergenic
1163684772 19:18705258-18705280 GTCCCTACTCATAATTTTTTTGG + Intronic
1166512911 19:43422016-43422038 GTACATAGTCACAGCTATTTGGG + Intergenic
1167762173 19:51456905-51456927 GATCAGACTCCCAATTTTTTTGG - Intronic
1168569518 19:57454326-57454348 GTTAGTACTCACATTTCTTTAGG + Intronic
1168581848 19:57561205-57561227 GTTTATACTCACAGTGATATAGG - Intergenic
926064539 2:9827134-9827156 GTTCCTCTTCACAATTGTTTTGG - Intergenic
926142950 2:10379298-10379320 GCTCATCCTCACAATTTTTCTGG - Intronic
926811063 2:16755768-16755790 CTTCATAATCACATTTTTTTCGG + Intergenic
927002284 2:18810706-18810728 GTTCATACACCCAAATATTCAGG + Intergenic
927148606 2:20182978-20183000 GTTCATTCACACAATTGTTTTGG + Intergenic
928634649 2:33231560-33231582 GTTCACACTCAGTATTTTTTTGG - Intronic
929786680 2:44998552-44998574 CTTAATATTCACAATTATATAGG - Intergenic
930355364 2:50311861-50311883 ATTTATACTAACATTTATTTAGG - Intronic
932016763 2:68036601-68036623 GTTCATACTCTTAATAGTTTGGG - Intergenic
932909877 2:75794758-75794780 ATTCATTCTCACAACTATTATGG - Intergenic
934068592 2:88363154-88363176 GTTCCTATTTTCAATTATTTTGG - Intergenic
936240938 2:110788144-110788166 GTCCCTACTTTCAATTATTTGGG - Intronic
936395781 2:112127867-112127889 GTTCTTATTCAACATTATTTTGG - Intergenic
938980187 2:136519009-136519031 GCTCATACTCACCTTGATTTAGG + Intergenic
940144341 2:150530032-150530054 GTTCACACTCATAATTTTATAGG - Intronic
940930007 2:159416898-159416920 GTTCTCACCCACAATTATTTTGG - Intronic
941966583 2:171306482-171306504 GTCCATGCTTTCAATTATTTTGG + Intergenic
941975667 2:171402278-171402300 ATTCATATCCAGAATTATTTAGG - Intronic
942384645 2:175429219-175429241 TTTCTTTCTCAAAATTATTTTGG - Intergenic
942550107 2:177106866-177106888 TTTCATACTTTAAATTATTTTGG - Intergenic
943625350 2:190192393-190192415 GTTCTTTCTCAAAATTGTTTTGG + Intronic
944402127 2:199339871-199339893 GCTCAGACTCCCAAATATTTTGG + Intronic
945576984 2:211543632-211543654 GATGATAATCAAAATTATTTTGG + Intronic
945900493 2:215532500-215532522 GTTCAAACTCACTAATCTTTAGG + Intergenic
946670055 2:222092936-222092958 ATTCATATTCAAAATAATTTAGG - Intergenic
946735443 2:222749968-222749990 GTTCTTTCTCAAAATTGTTTTGG + Intergenic
1170014002 20:11760202-11760224 GTTCTTTCTCAGAATTGTTTTGG + Intergenic
1172296792 20:33817699-33817721 CTTCTTGCTCAGAATTATTTTGG + Intronic
1174971347 20:55279339-55279361 GTACAGACTCATAATTATATTGG - Intergenic
1177855994 21:26400644-26400666 ATTCAAAGTCACAGTTATTTAGG - Intergenic
1178056420 21:28804029-28804051 ATTCATACTGACAATTGTTTTGG + Intergenic
1178202396 21:30422443-30422465 CTTCATACTTACAATTACATTGG - Intronic
949245391 3:1920975-1920997 CTTCAAATTCACATTTATTTAGG + Intergenic
949451417 3:4189433-4189455 GTTCATAGTCATATTCATTTTGG + Intronic
951770741 3:26254505-26254527 GTACAAACTCACAGTTATGTAGG - Intergenic
952799259 3:37273118-37273140 AATAATACTCAAAATTATTTGGG - Intronic
953649731 3:44791412-44791434 GTTCTTTTTAACAATTATTTTGG + Intronic
954287918 3:49631868-49631890 CTTCTTTTTCACAATTATTTTGG - Intronic
954928425 3:54258347-54258369 GTTCAGACTCTCATTTACTTGGG - Intronic
955460591 3:59178695-59178717 GTTCCTACTTTCAGTTATTTTGG + Intergenic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
955565227 3:60237224-60237246 GTTAATATTCACAATTTTTAAGG - Intronic
956228273 3:66984190-66984212 GATCATTCTCACCAGTATTTTGG - Intergenic
956315668 3:67933818-67933840 CTTCCTTCTCACAATTATTTTGG - Intergenic
957859024 3:85919346-85919368 CTTGATACTCAGAATTTTTTGGG - Intronic
957893316 3:86387729-86387751 GTGCATAAACACAATTAGTTTGG + Intergenic
958080932 3:88745275-88745297 GAAGAAACTCACAATTATTTTGG - Intergenic
958265040 3:91428296-91428318 GTTCATTTTCAAGATTATTTTGG + Intergenic
958712573 3:97735817-97735839 TTTCATGCTTACCATTATTTTGG + Intronic
958893689 3:99807233-99807255 GTTCATGCTTTCAATTCTTTTGG - Intergenic
958959839 3:100498707-100498729 GTTTATGCTTTCAATTATTTTGG + Intronic
961584704 3:127912730-127912752 ATACATACTTACAGTTATTTGGG - Intergenic
962898339 3:139735829-139735851 GTTCAGATTAACAAATATTTGGG - Intergenic
963829385 3:149990634-149990656 GTACATATTCACAAATATGTTGG + Intronic
964349576 3:155789657-155789679 CTTCTTTCTCAAAATTATTTTGG - Intronic
965315518 3:167184876-167184898 GATGATACTGACAATAATTTGGG - Intergenic
966090210 3:176125166-176125188 GTTCATATTCAAAATTGTTTTGG + Intergenic
967096378 3:186180731-186180753 ACTCGTGCTCACAATTATTTTGG + Intronic
967160001 3:186727456-186727478 ATTCATATTCACATTTACTTGGG + Intronic
967286137 3:187872427-187872449 GTTTATACTCAAAATTACCTTGG - Intergenic
967405057 3:189106138-189106160 GTCGATATTCACAATTGTTTTGG + Intronic
969178368 4:5417786-5417808 GTTATTTCTCACAATTCTTTTGG + Intronic
970830163 4:20328857-20328879 GTACATACACACATTTATTTTGG - Intronic
971845157 4:31909221-31909243 GATCATATTGACCATTATTTAGG + Intergenic
972057071 4:34816220-34816242 GTTCATACTTCCAATTGTTGGGG - Intergenic
972361292 4:38327952-38327974 TTTCCTAGTCACACTTATTTTGG - Intergenic
973065805 4:45790777-45790799 GTTTTTGCTCACAATTATTTTGG - Intergenic
974460659 4:62183559-62183581 GTTCATACTTGTAATTTTTTTGG - Intergenic
974694613 4:65349649-65349671 GGTCATACTAAAAATTATTTTGG + Intronic
974909821 4:68103609-68103631 TTTCATTCTCAGAATTATTTTGG + Intronic
975061412 4:70006856-70006878 GTTCATTCTCACTATTTTGTAGG + Intergenic
977842824 4:101729634-101729656 GTTTCTACTCATAAATATTTTGG - Intronic
978170468 4:105664125-105664147 GATCCTGCTCTCAATTATTTTGG + Intronic
979417335 4:120460086-120460108 GTTCATACTTTCACTTATTTTGG - Intergenic
979420521 4:120499652-120499674 GTAAATACACACGATTATTTTGG + Intergenic
979749459 4:124260105-124260127 GTTCATTTTCAAAATTCTTTTGG - Intergenic
980047663 4:128006823-128006845 GTCCATAATCACAGTTATTTGGG + Intronic
981540225 4:145838525-145838547 GTTTATATTAACAATTTTTTGGG + Intronic
983270935 4:165560755-165560777 GTTCATATTCTCAAGTTTTTTGG + Intergenic
984681630 4:182617163-182617185 ATACATACTGACAAATATTTTGG + Intronic
985151815 4:186955027-186955049 GTACATGCCCACAATTATTAAGG - Intergenic
986386251 5:7236922-7236944 GTTCTTTCTCAAAATTATTTTGG - Intergenic
986956825 5:13160921-13160943 GTTCATTTTCAGAATTGTTTTGG + Intergenic
988093821 5:26575997-26576019 CTTCAGAATCACAATTGTTTAGG - Intergenic
988350046 5:30091636-30091658 ATTCATACTCATATTCATTTAGG - Intergenic
989360214 5:40593455-40593477 GTGCATACTCACAACTGTTCAGG - Intergenic
990338431 5:54798215-54798237 GTTCATTTTCAAGATTATTTGGG - Intergenic
990428075 5:55708583-55708605 GTCCATAGTCACATTTATTTGGG - Intronic
990559441 5:56968937-56968959 GTTCTTTTTCAAAATTATTTTGG + Intronic
991985862 5:72286279-72286301 GTTCTTTTTCAAAATTATTTTGG - Intronic
992511113 5:77436018-77436040 GGTCTTAATCACCATTATTTAGG - Intronic
992864586 5:80944788-80944810 GTTCATTTTCAAAATTATTTTGG - Intergenic
993881569 5:93368470-93368492 GCTCTTTCTCAAAATTATTTTGG + Intergenic
994036290 5:95205027-95205049 GTTCTTTCTCAAAATTGTTTTGG - Intronic
994543648 5:101132853-101132875 GTTTATTCTCCCATTTATTTAGG + Intergenic
995181220 5:109232145-109232167 GTTCTTTTTCAAAATTATTTTGG - Intergenic
996150193 5:120024789-120024811 GTTCTTCCTCAATATTATTTTGG + Intergenic
996201541 5:120681740-120681762 GTTCATACTGAAAAATAATTGGG - Intronic
996264280 5:121516450-121516472 GTTTATACTCACTATTAATCTGG - Intergenic
996517707 5:124391607-124391629 GGCCATACTCTCAATTATTTTGG - Intergenic
999533190 5:152485388-152485410 GTTCATTCTCCCAATTATAAAGG + Intergenic
999946452 5:156601579-156601601 CTTCTTGCTCACAATTGTTTTGG + Intronic
1000267039 5:159647614-159647636 GTTCTTATTAATAATTATTTGGG - Intergenic
1000458075 5:161477465-161477487 GATCCTACTTTCAATTATTTTGG - Intronic
1000913991 5:167057863-167057885 GTTAAAACTCACAAATATGTTGG + Intergenic
1001900713 5:175426432-175426454 GTTCATTTCCAAAATTATTTTGG - Intergenic
1001976245 5:176001995-176002017 GTTCATACTCATGGATATTTTGG - Intronic
1002241177 5:177841776-177841798 GTTCATACTCATGGATATTTTGG + Intergenic
1003003427 6:2358743-2358765 GTCCCTACTTTCAATTATTTTGG + Intergenic
1005055371 6:21723676-21723698 GTTCACATTCATAATAATTTAGG - Intergenic
1008990341 6:57594356-57594378 GTTCATTTTCAAGATTATTTTGG - Intronic
1009178917 6:60492903-60492925 GTTCATTTTCAAGATTATTTTGG - Intergenic
1009370445 6:62894034-62894056 GTCTACACTCATAATTATTTTGG + Intergenic
1010539589 6:77074888-77074910 ATCCATACTTACAATTACTTAGG - Intergenic
1012276999 6:97286236-97286258 ATTCTTACTCAAAATTGTTTCGG - Intergenic
1012673194 6:102082628-102082650 GTACATACCCTCAAATATTTGGG + Intergenic
1012837345 6:104286316-104286338 TTTCACAATCACAATTATTTTGG + Intergenic
1012949209 6:105500108-105500130 GTTAATACTCACTGTTATGTGGG - Intergenic
1013450495 6:110275711-110275733 GATAATACTGAGAATTATTTAGG - Intronic
1013708233 6:112864934-112864956 TGTCATAGTCACAATTTTTTAGG + Intergenic
1014334298 6:120113105-120113127 GTTCCTCCTTTCAATTATTTTGG - Intergenic
1014966440 6:127759303-127759325 GTCCATATTCACAAATATGTAGG + Intronic
1020435242 7:8155293-8155315 GGACATACTTACAAATATTTTGG - Intronic
1020934753 7:14448555-14448577 GGTCATACTCAGGAATATTTAGG - Intronic
1021973981 7:25993706-25993728 GTTCTTTTTCACACTTATTTTGG - Intergenic
1022051085 7:26672959-26672981 ATTCATAATCACATTTGTTTGGG - Intronic
1027635916 7:80673950-80673972 GTTAATAATCAACATTATTTGGG - Intronic
1027746209 7:82077575-82077597 GTTAAAAATCACTATTATTTTGG + Intronic
1027993221 7:85390903-85390925 ATTCATACTCACAATCAAATTGG - Intergenic
1030383205 7:108837036-108837058 GTGCATACTCAAAAATATTGAGG - Intergenic
1030707343 7:112707635-112707657 GTTCATGTTCACAATTATTGTGG + Intergenic
1031219624 7:118948653-118948675 ATTCATACTTCCAAATATTTGGG + Intergenic
1031303443 7:120092976-120092998 GTTCATTCCCATAAATATTTTGG + Intergenic
1031560295 7:123230416-123230438 ATTCTTTCTGACAATTATTTTGG - Intergenic
1032282995 7:130520478-130520500 TTTCATATTAACAAGTATTTAGG - Intronic
1036573993 8:10007701-10007723 GATCATACTTTCAGTTATTTTGG + Intergenic
1037226029 8:16591041-16591063 GTTCGTCCTCACAATTCTTATGG - Intergenic
1037652879 8:20855683-20855705 GTCCCTACTTTCAATTATTTTGG + Intergenic
1040612786 8:49002127-49002149 GTTCAAACTCTCAATAAATTAGG + Intergenic
1041348154 8:56922891-56922913 ATTTATTCTCTCAATTATTTTGG + Intergenic
1044551235 8:93514777-93514799 GTGCCTCCTCACAATAATTTAGG + Intergenic
1044757864 8:95484953-95484975 GTTCTTTTTCAAAATTATTTTGG + Intergenic
1045816598 8:106283824-106283846 GTGAAACCTCACAATTATTTAGG + Intronic
1046697135 8:117354259-117354281 GTTATTTCTCAAAATTATTTTGG - Intergenic
1047245753 8:123142940-123142962 GTTCATAGTCACTGTAATTTGGG - Intronic
1048125231 8:131627383-131627405 CTTCTTATTCAAAATTATTTTGG - Intergenic
1048741542 8:137566301-137566323 GTTCATTCTGACATATATTTTGG - Intergenic
1050089577 9:2003918-2003940 GTTCCTGCTCTCAATTCTTTTGG - Intergenic
1050319352 9:4435253-4435275 TTTCATACTCAGAATTATAATGG + Intergenic
1051304128 9:15689738-15689760 GTTCTTTCTCAAGATTATTTTGG - Intronic
1051432137 9:16990300-16990322 GTTCCTACTTTCAATTCTTTTGG - Intergenic
1055398603 9:75899491-75899513 GTACAAACTCACAGTTATGTAGG - Intronic
1055459818 9:76508931-76508953 ATTTATACTCACATCTATTTCGG - Intergenic
1056878058 9:90356448-90356470 GTTCATTGTAAAAATTATTTTGG - Intergenic
1058609465 9:106759389-106759411 GTTCCTGCTTTCAATTATTTTGG - Intergenic
1059630276 9:116114399-116114421 GTTCCTTCTTTCAATTATTTTGG + Intergenic
1062677568 9:137756395-137756417 GTTCTTATTCACAGTGATTTTGG + Intronic
1187693817 X:21898223-21898245 GTCCTTACTCACAGTTAGTTAGG - Intergenic
1189411581 X:40777433-40777455 ATTCACACTTACAACTATTTTGG + Intergenic
1189733627 X:44047541-44047563 GGTCAAACTCAGAATCATTTCGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190822667 X:53988122-53988144 GTTCTTTTTCAAAATTATTTTGG - Intronic
1191920896 X:66255926-66255948 ATTCATTCTAACAATTATCTTGG - Intronic
1192192730 X:69002346-69002368 ATTCAACCTCACAATTAATTAGG - Intergenic
1192534357 X:71914539-71914561 GTTGCTTCTTACAATTATTTTGG + Intergenic
1193173590 X:78365602-78365624 GTTCTTAATCACAATTATTTTGG - Intergenic
1194079097 X:89435653-89435675 GGTCACACTCACTATTAATTTGG + Intergenic
1194081508 X:89472118-89472140 TTTCATACTCACATATATTTTGG - Intergenic
1194362572 X:92971660-92971682 GTTCATTCTCTTTATTATTTTGG + Intergenic
1194698142 X:97081076-97081098 GTTCATTTTCATAATTCTTTAGG + Intronic
1194795587 X:98208104-98208126 GTTTAAACTCAGAATTACTTTGG - Intergenic
1195874016 X:109519145-109519167 GTTCATACACACAATGGATTTGG + Intergenic
1195901893 X:109807729-109807751 GTCCATCCTCTCAATTATTAGGG + Intergenic
1195973926 X:110504828-110504850 GTTCTTATTCAAAATTATTTTGG - Intergenic
1196236750 X:113290661-113290683 GTTCATGCTTTCAATTATTTTGG + Intergenic
1196708059 X:118733377-118733399 GTTCATCATCACTAATATTTAGG - Intronic
1197882282 X:131179449-131179471 GTTTATACTTACAACTACTTGGG - Intergenic
1198667749 X:139043622-139043644 ATACCTACTCTCAATTATTTTGG - Intronic
1199137421 X:144269317-144269339 GTCCATACTCATCAATATTTTGG - Intergenic
1200431720 Y:3090970-3090992 GGTCACACTCACTATTAATTTGG + Intergenic
1200434179 Y:3128306-3128328 TTTCATACTCACATATATTTTGG - Intergenic
1200670826 Y:6087880-6087902 GTTCATTCTCTTTATTATTTCGG + Intergenic
1201851091 Y:18480710-18480732 TTGAATATTCACAATTATTTAGG + Intergenic
1201882228 Y:18839668-18839690 TTGAATATTCACAATTATTTAGG - Intergenic