ID: 1095327479

View in Genome Browser
Species Human (GRCh38)
Location 12:40913321-40913343
Sequence AAGCTGTAATATGTGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095327472_1095327479 22 Left 1095327472 12:40913276-40913298 CCCATCTTCTGTTATCAGCAGGA 0: 1
1: 0
2: 3
3: 16
4: 163
Right 1095327479 12:40913321-40913343 AAGCTGTAATATGTGGAAGAAGG 0: 1
1: 0
2: 3
3: 10
4: 221
1095327473_1095327479 21 Left 1095327473 12:40913277-40913299 CCATCTTCTGTTATCAGCAGGAA 0: 1
1: 0
2: 1
3: 25
4: 269
Right 1095327479 12:40913321-40913343 AAGCTGTAATATGTGGAAGAAGG 0: 1
1: 0
2: 3
3: 10
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095327479 Original CRISPR AAGCTGTAATATGTGGAAGA AGG Intronic
902382904 1:16060978-16061000 GAGCTGTTGTATGCGGAAGATGG + Intronic
904548613 1:31296830-31296852 AAGCTGGAAGTTGTGGAGGAAGG - Intergenic
904907137 1:33906139-33906161 AATCTGTAACATGAGCAAGAAGG + Intronic
904977567 1:34469794-34469816 AAGCTGAGAGATGTGGAAGAAGG - Intergenic
906849342 1:49231139-49231161 AAACAGTAAGATTTGGAAGAAGG + Intronic
907609986 1:55859475-55859497 AAGCTTTAAAATGTAGGAGAAGG + Intergenic
907696900 1:56740259-56740281 GAGCAGCAATATGTGGAAGGGGG - Intronic
907878998 1:58526018-58526040 AATATATAATATGAGGAAGAGGG - Intronic
909283331 1:73785270-73785292 AAGCTGTAAAATGTAGAACAGGG + Intergenic
910779007 1:90907244-90907266 ACACTGTAATTTGTGGAAAACGG - Intergenic
912113865 1:106379487-106379509 AAGTTGTAACATGTGGATAATGG - Intergenic
912188442 1:107308967-107308989 AACGTGTAATGTCTGGAAGACGG - Intronic
913044803 1:115064818-115064840 ACCCTGGAATATGTGAAAGAGGG + Intronic
918072128 1:181140985-181141007 AAGTTCTGATATGGGGAAGATGG + Intergenic
918707327 1:187682124-187682146 AATCTTTAATATGTGGAAGATGG - Intergenic
919395610 1:197043812-197043834 AAGATGTAATATATGTAATATGG + Intronic
919740686 1:200979689-200979711 AAGCTGCAAGATGTGGAACTTGG - Exonic
921731607 1:218585604-218585626 AACCTGCAATAGCTGGAAGATGG + Intergenic
921818228 1:219587924-219587946 AAACTGAGATATGTGGAAGAGGG - Intergenic
921859213 1:220023670-220023692 AAACTGTAAAATGTTGCAGAAGG + Intronic
922955132 1:229593190-229593212 AAGTTCTAATTTGTGGAAAAAGG - Exonic
1065090094 10:22223205-22223227 AAGATGTAATATCTAGAATACGG - Intergenic
1067323916 10:45248337-45248359 AATATGTAGTATGTAGAAGAAGG - Intergenic
1069169398 10:65206689-65206711 TTGCTGTAACATTTGGAAGAAGG + Intergenic
1070210213 10:74310482-74310504 GAAATGTAAGATGTGGAAGAGGG - Intronic
1070906107 10:80074739-80074761 AAGTTGAAATACCTGGAAGAAGG - Intergenic
1072751789 10:97986054-97986076 AAGCTGCAATGTGTGGGAAAAGG + Intronic
1073380486 10:103074318-103074340 TATCTGTAAAATGTGGATGATGG - Intronic
1075494786 10:122910702-122910724 AACCTGTAATCTGAGAAAGAGGG - Exonic
1078732187 11:13984932-13984954 AAGCTCTAAGAGGAGGAAGAAGG - Intronic
1079142519 11:17821905-17821927 GTGCTGAAATATGTGGAAGGAGG - Intronic
1080642967 11:34168568-34168590 CAGCTGTAAAATGGGGAGGATGG - Intronic
1081948969 11:47026178-47026200 GAGATGTAATATGTAGCAGAAGG + Intronic
1085607459 11:77915040-77915062 AAGTTGAAATATGTCAAAGATGG - Intronic
1086201242 11:84204392-84204414 AAACTGTAATAGGTTAAAGATGG + Intronic
1086389520 11:86348112-86348134 AAACTGTAATAAGCAGAAGAGGG + Intergenic
1087303748 11:96464823-96464845 AAGCTGTACTCTGCGGACGAAGG - Intronic
1087920238 11:103858590-103858612 AATCTGTAAAATGAGGAAGGAGG + Intergenic
1088033050 11:105275510-105275532 GAGCTGAATGATGTGGAAGATGG + Intergenic
1088603974 11:111511825-111511847 GAGCTGTAATAGGTCAAAGAAGG - Intronic
1091186868 11:133655198-133655220 AAGCTGGGGTCTGTGGAAGAGGG + Intergenic
1092092820 12:5817887-5817909 AACATCTAAAATGTGGAAGAAGG + Intronic
1092751308 12:11721978-11722000 GAGCTGTAATTTAAGGAAGAAGG + Intronic
1093097133 12:14984382-14984404 AGGCTGTAGGATGTGGCAGAGGG + Intergenic
1093697169 12:22173909-22173931 AAGCTATAGTATGTGTAAAATGG + Intronic
1094147051 12:27240170-27240192 AAGAGGGAATATGTGGAGGAAGG + Intergenic
1094280052 12:28726855-28726877 GAGCTTAAATATGTGGAAAAAGG - Intergenic
1095327479 12:40913321-40913343 AAGCTGTAATATGTGGAAGAAGG + Intronic
1098855220 12:75645178-75645200 CATCTCTAATAGGTGGAAGACGG - Intergenic
1101654328 12:106706499-106706521 AATCTGTAATATGTGGTAAAGGG + Intronic
1103815490 12:123651845-123651867 AAGCTGTAAAAACTGGAAGTGGG + Intronic
1107972985 13:45662014-45662036 AAGCCTGATTATGTGGAAGAAGG + Intergenic
1108062203 13:46544597-46544619 AATCTGTAGTATGGGGAAGCTGG + Intergenic
1108984239 13:56563030-56563052 AACCTGTAATATGAAGAAAAGGG - Intergenic
1110024490 13:70517932-70517954 AAGCTGTAATATGTGAATGGTGG + Intergenic
1112339716 13:98543121-98543143 AAGCTGTAAACTTTGGAGGATGG - Intronic
1114391946 14:22318857-22318879 GAGTTGTAATGTCTGGAAGAAGG + Intergenic
1116153986 14:41179834-41179856 ACCCTGTAATTTGTGTAAGATGG + Intergenic
1116811887 14:49547329-49547351 AGGCTTTAATATGTGGATGGTGG - Intergenic
1117984787 14:61376536-61376558 CAGCTGTAGTATCTGGAAGACGG - Intronic
1118384724 14:65246080-65246102 AAGGTTTTATATGTGTAAGAGGG - Intergenic
1119426556 14:74539184-74539206 AATCTGTAAAATGGGGATGACGG - Intronic
1121940305 14:98064131-98064153 AAACTGTAAAATTTAGAAGAGGG - Intergenic
1122014515 14:98782999-98783021 AAGCTGTGAGCTTTGGAAGAAGG - Intergenic
1125446986 15:39768549-39768571 AATTTGTAATATCTGGATGAAGG + Intronic
1125499057 15:40226397-40226419 AAGTTGTAATAGTAGGAAGATGG - Intergenic
1126665829 15:51075706-51075728 ATGCTGTAATTTTTGGAGGATGG + Intronic
1126857839 15:52856178-52856200 AAGCTTTAATTTGTGGCAGGGGG + Intergenic
1127111179 15:55672510-55672532 AAGCTGTACTACAAGGAAGAAGG - Exonic
1127137944 15:55944006-55944028 AAGATGTAATGATTGGAAGATGG + Intronic
1128111526 15:65079230-65079252 AACCTGTAGAATGTGGAGGAGGG - Intergenic
1128300002 15:66560719-66560741 AAGCTGTGACAGGAGGAAGAAGG - Intronic
1133195404 16:4166450-4166472 AAGCTTTAATATAAGGGAGAAGG + Intergenic
1135241280 16:20808577-20808599 AAGTTATAATATGTGAGAGAGGG + Intronic
1138045206 16:53715379-53715401 AATTTCTAATATGTGCAAGATGG - Intronic
1140806201 16:78534581-78534603 AAGGTGAAATATAGGGAAGATGG + Intronic
1141355101 16:83338313-83338335 CAGCTGTAATATGCCGGAGATGG + Intronic
1144184730 17:12786368-12786390 AGGCTGTGAGATGTTGAAGATGG - Intergenic
1145045490 17:19611666-19611688 AAGTTGTAAGATGAGGAACATGG + Intergenic
1149106810 17:52978382-52978404 AAGTTGGAATCTGTGTAAGAAGG - Intergenic
1149412627 17:56424484-56424506 AAGGAGAAAAATGTGGAAGAAGG + Intronic
1150699429 17:67434476-67434498 GAGCTGTAATCTTTGGTAGAGGG + Intronic
1151292880 17:73163204-73163226 AAGCTGAAAGAAGTGGATGATGG - Intergenic
1153019160 18:611155-611177 GAGCTGTAATAGGTGGCACAGGG - Intronic
1153114180 18:1634388-1634410 AAGCTGTAAAGTGTAGTAGAGGG - Intergenic
1155106688 18:22673948-22673970 AAGATGAAAAATGAGGAAGATGG + Intergenic
1156319122 18:36001746-36001768 AAGCTGTTAGCTCTGGAAGATGG - Intronic
1156931942 18:42655606-42655628 GAGCTATAATGTGTGTAAGATGG - Intergenic
1158385491 18:56985623-56985645 AAGCTTTAATCAGTGGAAAATGG + Intronic
1160228791 18:77030947-77030969 AACCTGGTATCTGTGGAAGAGGG + Intronic
926160343 2:10483518-10483540 AAGCTGCTGTATGTGGAAGTGGG - Intergenic
929310718 2:40421261-40421283 CACCTGTAAAATGAGGAAGATGG - Intronic
930665804 2:54097241-54097263 AAGTTATAATATGTAGAAGTGGG - Intronic
930832159 2:55756525-55756547 TACCTGTATTATCTGGAAGAAGG - Intergenic
932242039 2:70164681-70164703 AAGCTGTAGTTTGGGGAGGAGGG + Intronic
933522090 2:83386922-83386944 AAACTGAAATATGTGACAGAGGG - Intergenic
934880305 2:97971348-97971370 TAGCTGTGATAAGTGGAGGAAGG + Intronic
935484572 2:103637795-103637817 AAACTTTAATATGTGGCAAATGG - Intergenic
935656519 2:105428337-105428359 GAGCTGTAGTTTGGGGAAGATGG - Intronic
936172020 2:110185128-110185150 AAGAAGGAATATGAGGAAGACGG + Intronic
939179444 2:138786557-138786579 AAGTTGTAACATGTGGATGATGG + Intergenic
940854654 2:158720507-158720529 AGGCTGGAACATATGGAAGACGG - Intergenic
941009292 2:160280737-160280759 AAGATCTAGTTTGTGGAAGAAGG - Intronic
941280095 2:163539104-163539126 GAGCATTAACATGTGGAAGATGG - Intergenic
944020943 2:195103268-195103290 AACCAGGAATATGTTGAAGAGGG + Intergenic
944396525 2:199273936-199273958 AAGCTGTAAGGTGTGGGCGATGG - Intronic
944413058 2:199460312-199460334 AATCTGTAATATGTCGAAATGGG + Intronic
946354740 2:219177741-219177763 AAGCTCCGATATGTGGAAGTGGG + Exonic
947082004 2:226409494-226409516 CAGCTGAAATATGAGGGAGAAGG - Intergenic
947443411 2:230142942-230142964 ATGATGTAAGATTTGGAAGATGG - Intergenic
1169100004 20:2939375-2939397 CAGCTGTAACATGGAGAAGAGGG + Intronic
1169347081 20:4837086-4837108 CAGCTGTTACATTTGGAAGATGG - Intergenic
1171096428 20:22336516-22336538 AAGCTGTACTTTCTGGAATAAGG + Intergenic
1172693034 20:36803580-36803602 GAGCTGTGAGATCTGGAAGAGGG + Intronic
1178028946 21:28502792-28502814 AAGCTGTAATTTGTGAGTGATGG - Intergenic
1179188536 21:39104056-39104078 AAGCTGGAAAGTGAGGAAGAAGG + Intergenic
1181550188 22:23633804-23633826 ACGCTGTAAGATGTGTAAAATGG - Intergenic
1182138542 22:27931288-27931310 AATTGGTAATATGTGGAAGCAGG - Intergenic
950401525 3:12772731-12772753 CAGCAGAAAAATGTGGAAGAGGG + Intergenic
951287879 3:20837240-20837262 AAGCAGGAAAATGTGTAAGATGG - Intergenic
951802610 3:26612955-26612977 AAGCTATGATATTTGGAAGGTGG - Intergenic
955655220 3:61238523-61238545 AAGCTGTAAAAAGTATAAGAAGG + Intronic
956766438 3:72488150-72488172 AAGATGGAAAATGAGGAAGAGGG - Intergenic
957195242 3:77059295-77059317 AAGCAGTGAAAGGTGGAAGAAGG + Intronic
957886191 3:86290484-86290506 AAGCTTTTATTTGTGGCAGAAGG - Intergenic
958097580 3:88966484-88966506 AACCTAAAATATCTGGAAGAAGG + Intergenic
960240386 3:115334094-115334116 AAACTGGAAGATGTGTAAGATGG + Intergenic
960694123 3:120379225-120379247 AAGCTTTTATTTGTGGCAGAAGG + Intergenic
960815695 3:121669853-121669875 AAATTATAATATGTGGTAGAAGG + Intronic
961932136 3:130545953-130545975 AAGATATAATATGTGCAAAATGG - Intergenic
963690487 3:148494661-148494683 GAGCTGTAATCTCTGCAAGAAGG - Intergenic
963770887 3:149384980-149385002 CAGCTGTGATCTGTGGAAGGAGG - Intergenic
966396729 3:179511238-179511260 AACATATAATATGTGGAAAATGG - Intergenic
966841908 3:184096498-184096520 AGGCTCTTATAAGTGGAAGAAGG + Intergenic
969218126 4:5739454-5739476 CATCTGTAAAATGCGGAAGATGG + Intronic
969596811 4:8153831-8153853 CATCTGTAAGATGTGGGAGAAGG - Intronic
969848228 4:9936365-9936387 CAGCTGTGGTATGGGGAAGACGG + Intronic
970444466 4:16112583-16112605 AAGCAGGAAAATGGGGAAGAAGG + Intergenic
970862919 4:20723948-20723970 AGGCTGAAATGTATGGAAGATGG - Intronic
970883500 4:20959853-20959875 AATCTGTAAGATGAGGAAAATGG + Intronic
971525959 4:27619053-27619075 ACAATGTAATATGTGGAAGCAGG - Intergenic
971650185 4:29261760-29261782 AAGTTAAAATATGTGGAAAAAGG + Intergenic
971775964 4:30964796-30964818 CACCTGTAAAATGTGGAAAAGGG - Intronic
973831863 4:54769591-54769613 AAGCTAAAATATGTGGCAGTGGG - Intergenic
974731514 4:65872723-65872745 TATCTGGAATATGTGGAATACGG - Intergenic
974850113 4:67394280-67394302 AAGAAGTAAGATGTTGAAGAAGG + Intergenic
974932934 4:68380437-68380459 AATCTGAAATATGAGGAATAGGG + Intergenic
975925769 4:79450501-79450523 AGGCTCTAATATATGGAAGCTGG - Intergenic
976132956 4:81904416-81904438 CAGCTGTAAAATGGGGAGGATGG + Intronic
976877357 4:89870541-89870563 AAGCAGTAATAAGTTAAAGATGG + Intergenic
977476103 4:97511931-97511953 CAGCTGTTACATGTGGAAGGTGG + Intronic
978275290 4:106941974-106941996 AATTTTTATTATGTGGAAGAAGG + Intronic
978710314 4:111772620-111772642 AGTCGATAATATGTGGAAGATGG - Intergenic
980330880 4:131409385-131409407 ATGCTTTTAGATGTGGAAGATGG - Intergenic
980820808 4:138014138-138014160 AATCTGAAATATGTGGCAGGTGG - Intergenic
981441246 4:144784958-144784980 TAGCTGTCATATGTGGAGAAAGG + Intergenic
982636233 4:157900295-157900317 AATTTGTAAAATGTGGTAGATGG - Intergenic
983125133 4:163942128-163942150 AGGCTGTAACTTATGGAAGATGG - Intronic
983195622 4:164803223-164803245 ATGCAGTAATATATGTAAGATGG - Intergenic
984691243 4:182728240-182728262 AAGCTCTAAAATTTGGGAGAGGG - Intronic
985136316 4:186789342-186789364 AAGGTGTAATATGTGCATGGAGG - Intergenic
989207765 5:38828459-38828481 AAGAAATAATATGAGGAAGAAGG + Intergenic
992250438 5:74870638-74870660 TTGCTTTAATATGTGGTAGAAGG + Intergenic
992500101 5:77333773-77333795 AGGTTGTAAAATGTGTAAGAAGG - Intronic
994870421 5:105342084-105342106 TAAATGTAATATGGGGAAGAAGG + Intergenic
995260629 5:110100179-110100201 AACCTGTAATATGTGAACAATGG - Intergenic
995796569 5:115947333-115947355 AAGATGTAAGGTGAGGAAGAGGG - Intergenic
995801229 5:115997690-115997712 AAGCTGCAATATGTCAGAGAAGG - Intronic
996797696 5:127367721-127367743 TAGCTTTACTATGTTGAAGAAGG + Intronic
997803564 5:136890851-136890873 GATCTGGAATATGTGGAAAAGGG + Intergenic
997878245 5:137568161-137568183 AATCTGGAGTTTGTGGAAGACGG - Intronic
999126370 5:149249190-149249212 AAGGTGTAGTATGGGGAAGAGGG - Intronic
999841626 5:155433757-155433779 AAGCAGAAATAAGTGGAAGGAGG - Intergenic
1000408790 5:160916776-160916798 CAGCTGTAATCAGGGGAAGATGG - Intergenic
1000711734 5:164588123-164588145 AAGTTTTAATATGTGGTAAAGGG + Intergenic
1002656385 5:180751530-180751552 AAGGGCTACTATGTGGAAGATGG - Intergenic
1002660081 5:180785865-180785887 CAGCTGTAAGAAGAGGAAGATGG - Intergenic
1003436065 6:6089508-6089530 AAGTTCTTAAATGTGGAAGAGGG + Intergenic
1003497915 6:6680055-6680077 AAGGTGCAAGATGTGCAAGATGG + Intergenic
1003961459 6:11212983-11213005 AAGCTGATATATGAGAAAGATGG + Intronic
1004041516 6:11982652-11982674 AAGATGTAATTTGTGGAATATGG + Intergenic
1004174836 6:13330512-13330534 AAGCTCTAATTTGTGAGAGAAGG + Intergenic
1004574305 6:16879223-16879245 AAGATGTAATATTTTTAAGATGG - Intergenic
1006077720 6:31545142-31545164 AATTTGTAATATGGGGAAGTAGG - Exonic
1006626951 6:35404449-35404471 AGGCTGTACCATGTGGCAGATGG + Intronic
1011165032 6:84437263-84437285 AATCTGAAATATGTCAAAGATGG - Intergenic
1018006340 6:159625794-159625816 ACGATGAAATATGTGCAAGATGG - Intergenic
1019909065 7:4087710-4087732 AAGCTGTAATGTGAAGAATACGG + Intronic
1020406082 7:7836134-7836156 AAGCTGTTAAATATGGAAGTCGG - Intronic
1020680238 7:11227812-11227834 CAGCAGTATTATGTGAAAGATGG - Intergenic
1023689890 7:42774822-42774844 AAGCTGAAATATGGGCAAAAGGG - Intergenic
1024005901 7:45224753-45224775 AAGCTGTGCTCTGGGGAAGAGGG - Intergenic
1024188641 7:46982084-46982106 AAGCTTTAATATGCTGAAGGTGG + Intergenic
1025724902 7:64047526-64047548 AAGCTGTAATACTTGGAACCAGG - Intronic
1025845550 7:65193207-65193229 AAGTTGAAATATGTCAAAGATGG + Intergenic
1025895772 7:65698920-65698942 AAGTTGAAATATGTCAAAGATGG + Intergenic
1026056436 7:66988390-66988412 AATCTGAAAGATGTAGAAGAAGG - Exonic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1030296182 7:107930218-107930240 CAAATGTAAAATGTGGAAGATGG + Intronic
1030323157 7:108190923-108190945 ATTCTGTAAAATGTGGATGATGG + Intronic
1032271891 7:130416582-130416604 AAGATGAAATATCTTGAAGAAGG + Intronic
1032827882 7:135589994-135590016 AATTTGAAACATGTGGAAGAGGG + Intronic
1033510809 7:142058498-142058520 GAGCTGTCATCTCTGGAAGACGG - Intronic
1033539397 7:142342893-142342915 ATGGTGTCATATGTGGAAAAGGG + Intergenic
1034256079 7:149725266-149725288 AGGCTGGAATGTGTGGGAGATGG + Intronic
1036547626 8:9787413-9787435 AAACTGTACTATCTGCAAGAGGG - Intergenic
1037240416 8:16771042-16771064 AGGCTGAAATATGTGAAAGCTGG + Intergenic
1038904964 8:31890435-31890457 AAGTTATAATATGTGAAAAAGGG + Intronic
1041718521 8:60953941-60953963 AAGGATGAATATGTGGAAGAAGG - Intergenic
1043348378 8:79327339-79327361 AAGTTTTTATAAGTGGAAGAGGG + Intergenic
1043503543 8:80879846-80879868 AAGCTGTAAGAAAAGGAAGATGG - Intergenic
1043525402 8:81091207-81091229 AAGATGTAAGATGTGGAAGAGGG + Intronic
1043550662 8:81368687-81368709 AAGATGTATTATCTGGAACATGG - Intergenic
1044457489 8:92404760-92404782 AAGTTCTAATTTGTGGAAAAAGG + Intergenic
1045555439 8:103210183-103210205 AGGCTGTAATTGGTGGAGGAAGG + Intronic
1050422714 9:5483630-5483652 AAGCTGTGCCATGGGGAAGAGGG - Intergenic
1051041303 9:12815550-12815572 AAGCTGTAATATGAATTAGAAGG - Intronic
1051083336 9:13318320-13318342 CAGCTGTCATATATGGAAAAAGG - Intergenic
1051801976 9:20945045-20945067 GAGCTGCAATTTCTGGAAGAAGG + Intronic
1057774916 9:97999834-97999856 AGGCTGTGCTATTTGGAAGAGGG + Intronic
1059201662 9:112423296-112423318 AACCTGGAATTTGGGGAAGAGGG + Intronic
1059607112 9:115845441-115845463 AAGCTGTATAATGTAGAACATGG + Intergenic
1060373856 9:123100827-123100849 AAGATGTTATATGTGGAAAATGG - Intronic
1187611808 X:20951550-20951572 AAGCTGCCCCATGTGGAAGAGGG - Intergenic
1189634836 X:42995932-42995954 AAACTGAATTATTTGGAAGAAGG - Intergenic
1190603671 X:52118557-52118579 AAGCTTTAATATGTGAGAAAGGG + Intergenic
1190756080 X:53403276-53403298 AAGCTGCAATATCTGCAAAATGG - Intronic
1191178221 X:57529477-57529499 AAGCTGTAGCTTGTGGAAGTGGG - Intergenic
1192392413 X:70744194-70744216 AAGCTATGATATTGGGAAGATGG - Exonic
1194785912 X:98084134-98084156 GAGCTGTAATATTTGGAAGAGGG + Intergenic
1195703161 X:107720124-107720146 AAGCTGGAATAGGGGGAAAAAGG - Intronic
1197847937 X:130823592-130823614 AAGGTCTAATATGTGGATGTGGG - Intronic
1198560826 X:137848269-137848291 AAGCTGGAATATGGGGGAGGGGG + Intergenic
1199059897 X:143342869-143342891 CAGCTGATATATGGGGAAGAGGG - Intergenic
1199742433 X:150748178-150748200 AAGGTGTAGTATGAGGAAGTGGG - Intronic