ID: 1095327930

View in Genome Browser
Species Human (GRCh38)
Location 12:40920398-40920420
Sequence TAACCAGGCCAAACTCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095327930_1095327933 2 Left 1095327930 12:40920398-40920420 CCACTTTGAGTTTGGCCTGGTTA 0: 1
1: 0
2: 3
3: 13
4: 157
Right 1095327933 12:40920423-40920445 CATACACTAATAGACAGAACTGG 0: 1
1: 0
2: 0
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095327930 Original CRISPR TAACCAGGCCAAACTCAAAG TGG (reversed) Intronic
913703755 1:121397759-121397781 TCAACAGGCCAGACTCAAGGTGG - Intergenic
913980106 1:143499468-143499490 TCAACAGGCCAGACTCAAGGTGG - Intergenic
914074454 1:144324953-144324975 TCAACAGGCCAGACTCAAGGTGG - Intergenic
914104722 1:144641493-144641515 TCAACAGGCCAGACTCAAGGTGG + Intergenic
915360739 1:155285055-155285077 GACACAGGTCAAACTCAAAGGGG - Intronic
916376436 1:164158943-164158965 TAAAGAAGCCAAACTCAAAAAGG - Intergenic
917404476 1:174689726-174689748 CAACCAGGCCAAAGTCCAACAGG - Intronic
917730731 1:177872148-177872170 TATCCAGTCCAAGCTCACAGAGG + Intergenic
919101349 1:193100794-193100816 TTCCCAGGCCAAAATCAAATAGG + Intronic
919128100 1:193421245-193421267 TCACAAAGCCAAAATCAAAGTGG - Intergenic
919194696 1:194268138-194268160 TAAACAGGCCAAAGGCAGAGAGG + Intergenic
923865266 1:237932762-237932784 TAACGAGACCAAAGTCAATGAGG + Intergenic
924259180 1:242212168-242212190 TCACCAGGCCAAAATAAAAAAGG + Intronic
1063247978 10:4243025-4243047 TGACAAGCCTAAACTCAAAGGGG - Intergenic
1064952491 10:20869538-20869560 GAAACAGCCCAAACTCAAATTGG - Intronic
1066780873 10:38943271-38943293 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1066954000 10:42148846-42148868 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1066968221 10:42290282-42290304 TAACAAAACCAAACTCACAGTGG + Intergenic
1067137208 10:43620784-43620806 AAGCCTGTCCAAACTCAAAGGGG + Intergenic
1070529619 10:77325367-77325389 CAACCAGTCCAACCGCAAAGTGG + Intronic
1073890064 10:108091017-108091039 TAACCAGGCAGTACTCACAGTGG + Intergenic
1076002848 10:126925999-126926021 TAACTGGGCCAAAGTCAAACAGG - Intronic
1079390787 11:20020356-20020378 TAAACAGGCCAAATTCCAAAGGG - Intronic
1079918315 11:26399089-26399111 TTACCTGGCAAAACTCAAACTGG + Intronic
1081137641 11:39458895-39458917 TAACTTAGTCAAACTCAAAGGGG + Intergenic
1083878091 11:65535253-65535275 GAACGAGGCCAACCTCAATGTGG + Exonic
1084693862 11:70742494-70742516 TACCCAGGCCAAGCTCTGAGAGG + Intronic
1084761257 11:71272593-71272615 CAGCCAGGCCTAACTCAAGGAGG + Intergenic
1094674349 12:32604184-32604206 TAACCAGGACAAATACAAAAAGG - Intronic
1095327930 12:40920398-40920420 TAACCAGGCCAAACTCAAAGTGG - Intronic
1098081693 12:66792808-66792830 TAACAAAGCCAAGCTCAAACTGG + Intronic
1100786529 12:98084539-98084561 TCACGAGGCCAAAATCAAAGTGG + Intergenic
1101537995 12:105638080-105638102 TAACCAGGCCACAGACATAGAGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102509672 12:113405844-113405866 TAGCCAAGCCAAACTGAAAGAGG + Intronic
1102760182 12:115378029-115378051 AAACCAGGCAAAACTGGAAGGGG - Intergenic
1108758755 13:53536468-53536490 TCACCAGGCTAAAATCAAGGAGG - Intergenic
1112094282 13:96115246-96115268 TAACTAGGCCATATTAAAAGTGG + Intronic
1114209856 14:20605327-20605349 TACCCAAGCCAAAGTCACAGGGG - Intronic
1118896591 14:69950315-69950337 CACACTGGCCAAACTCAAAGAGG - Intronic
1202939707 14_KI270725v1_random:135883-135905 TAAACAGGCCAAACTCAAGGTGG + Intergenic
1123393426 15:19900009-19900031 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1129316537 15:74748785-74748807 CAACCAGGCCAATCTGATAGGGG + Intergenic
1132304154 15:100798057-100798079 CAACCAGGCAAAAAACAAAGAGG + Intergenic
1132802311 16:1760473-1760495 TAAGCAGGCCAAAGTCAAGCTGG + Exonic
1136699426 16:32117383-32117405 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1136715717 16:32279566-32279588 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1136752194 16:32650201-32650223 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1136768223 16:32810551-32810573 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1136771479 16:32845491-32845513 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1136799918 16:33060554-33060576 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1136822399 16:33330261-33330283 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1136828962 16:33386800-33386822 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1136834028 16:33485582-33485604 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1136899102 16:34015934-34015956 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1136957817 16:34804564-34804586 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1138878693 16:60984061-60984083 TAACCTACCCAAACTCACAGAGG + Intergenic
1139311133 16:66029148-66029170 TAACAAGTCCAAACTCTCAGTGG + Intergenic
1141563855 16:84888104-84888126 TCACCAGGCTAAAATCAAGGTGG + Intronic
1203010888 16_KI270728v1_random:238938-238960 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1203054337 16_KI270728v1_random:910185-910207 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1203070615 16_KI270728v1_random:1072567-1072589 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1203073903 16_KI270728v1_random:1107602-1107624 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1142503733 17:349458-349480 TTACCAGCTCAAACTCAAAACGG + Intronic
1142720729 17:1774065-1774087 AAAACAGGCCAAAGCCAAAGAGG - Intronic
1145690344 17:26732414-26732436 TTAACAGGCCAGACTCAAAGTGG - Intergenic
1145710119 17:26963568-26963590 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1145766843 17:27464084-27464106 TCAACAGGCCAGACTCAAGGTGG - Intronic
1146832828 17:36084557-36084579 CAAGCAAACCAAACTCAAAGAGG - Intergenic
1146847299 17:36190863-36190885 CAAGCAAACCAAACTCAAAGAGG - Intronic
1148790742 17:50171318-50171340 AAACCAGGCCAAAATAAGAGAGG - Intronic
1153756929 18:8293597-8293619 TAATCATGACAAACTCAAAGTGG + Intronic
1153774729 18:8442508-8442530 TCACAAGGCCAAAATCAAGGTGG + Intergenic
1154367886 18:13727430-13727452 AACCCAAACCAAACTCAAAGTGG - Intronic
1155318687 18:24597041-24597063 CAACCAGGCCCAGCTGAAAGTGG - Intergenic
1160371726 18:78377818-78377840 TCACGTGGCCAAACTCAGAGGGG + Intergenic
1162007464 19:7789367-7789389 GGACCAGGCCAAGGTCAAAGAGG - Intergenic
1163677402 19:18662256-18662278 AAACCAGACCAAAATCAAAATGG + Intronic
1166411048 19:42555600-42555622 TAACCAGGCCGAATTCACAGAGG + Intronic
1202669994 1_KI270709v1_random:41072-41094 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1202680039 1_KI270712v1_random:2002-2024 TCAACAGGCCAGACTCAAGGTGG + Intergenic
926802119 2:16667524-16667546 AAACCTGGCCAAACTCAAGGTGG - Intergenic
931908219 2:66866147-66866169 GAACCAGTTCAAACACAAAGAGG + Intergenic
938518055 2:132037315-132037337 TCAACAGGCCAGACTCAAGGTGG + Intergenic
940298657 2:152156939-152156961 AAAACAGGCCAAAATCAATGAGG + Intronic
940764758 2:157778292-157778314 TAATGAGGCCAACCTCCAAGTGG + Exonic
943647097 2:190418153-190418175 TAACCAGCCCAAAGTCACATAGG - Intronic
945277419 2:208001774-208001796 GGAGCAGGCCAAACCCAAAGTGG + Exonic
945397372 2:209336559-209336581 TAACCTGGCCAAAATCTCAGTGG - Intergenic
945960286 2:216126844-216126866 AAAGCAGGCCAAAATAAAAGAGG - Intronic
948332962 2:237184574-237184596 TTACCAAACCTAACTCAAAGAGG + Intergenic
1170817566 20:19727750-19727772 TAATCAGCCCAAAGGCAAAGAGG + Intergenic
1171154314 20:22858546-22858568 TAAACATGCCAAACACAGAGAGG - Intergenic
1171278394 20:23877504-23877526 TGACCAGCCAAAACTGAAAGAGG - Exonic
1176583483 21:8551202-8551224 TAAACAGGCCAGACTCAAGGTGG - Intergenic
1177375714 21:20268658-20268680 TAAACAAGAGAAACTCAAAGTGG - Intergenic
1178715137 21:34957552-34957574 AGCCCAGGCCAAACTCCAAGTGG - Intronic
1180266293 22:10528133-10528155 TAAACAGGCCAGACTCAAGGTGG - Intergenic
1184049547 22:41994303-41994325 GAAGCAGGGCAAACTCACAGTGG - Exonic
1184833851 22:47008722-47008744 TACCCAGGCCTCACTCCAAGGGG - Intronic
1203324842 22_KI270738v1_random:4218-4240 TCAACAGGCCAGACTCAAGGTGG + Intergenic
950552893 3:13677508-13677530 TAACTAGTCCAAACTGTAAGGGG - Intergenic
952140596 3:30474668-30474690 CTACAAGGCCAAACTCAAACAGG + Intergenic
954111132 3:48433787-48433809 TCACCAGGCCAAGCTGAAGGAGG - Exonic
954650319 3:52157529-52157551 TAACCAAGCCAAACTGAAAGAGG + Intergenic
955763544 3:62315943-62315965 TATCCAGAGAAAACTCAAAGTGG + Intergenic
956119855 3:65955376-65955398 CCACCAGGCCAAACTCTCAGTGG + Intronic
956152121 3:66254445-66254467 TTTCCAGAGCAAACTCAAAGTGG - Intronic
960053724 3:113261465-113261487 TAACCAGCCCTACCTCAGAGCGG + Intronic
960628187 3:119701964-119701986 TAACCAGGATAATCTCATAGAGG - Intergenic
961993384 3:131215854-131215876 AAATCTGGCCAAACTGAAAGCGG + Intronic
967859252 3:194139445-194139467 TAACAAGTCCTAACTCAAAGCGG + Intergenic
972706351 4:41547359-41547381 TAAAAAAGCCAAACTCATAGAGG - Intronic
972844935 4:42976062-42976084 ACAGCAGGCAAAACTCAAAGAGG - Intronic
973030855 4:45336512-45336534 AAACAATGCAAAACTCAAAGAGG - Intergenic
973312144 4:48721247-48721269 TAACCAGCCCAGAATCAGAGAGG + Intronic
977468514 4:97412580-97412602 AAACCTGGTCCAACTCAAAGAGG - Intronic
977583028 4:98745645-98745667 TAACCAGTCAAATCTCCAAGAGG + Intergenic
978170117 4:105659532-105659554 TATCCATGGGAAACTCAAAGAGG + Intronic
981537591 4:145815967-145815989 AAACCAGGCCAAGGCCAAAGTGG + Intronic
983257050 4:165411583-165411605 TCAACAGGCCATACTCAAAAAGG - Intronic
987088676 5:14491617-14491639 TACCCAGGCCACACACAGAGTGG - Intronic
987667787 5:20967076-20967098 TTACTAGGCCAAAATCAAAGCGG + Intergenic
991301690 5:65134678-65134700 TGGCCAGGCCAAAGTCAATGGGG + Intergenic
998113795 5:139521514-139521536 CAACTAGGCCAACCTCAGAGAGG + Intergenic
1000853125 5:166364444-166364466 GAAGCAGGCAAATCTCAAAGAGG + Intergenic
1001338171 5:170818509-170818531 TTGGCAGGCCAGACTCAAAGAGG - Intergenic
1002089423 5:176795745-176795767 AAACTAGCTCAAACTCAAAGGGG + Intergenic
1002994158 6:2267540-2267562 GAACTAGGTAAAACTCAAAGTGG + Intergenic
1004551367 6:16651246-16651268 TAAAGAGGCCAAACTCAGACTGG + Intronic
1006974548 6:38086957-38086979 TAACCAGAACAACCTCAAACTGG + Intronic
1007163879 6:39814389-39814411 AAACCAAGCCAAGGTCAAAGGGG - Intronic
1008352388 6:50507140-50507162 TAACCAGAGCAATCTGAAAGGGG + Intergenic
1011037755 6:82996525-82996547 AATCCAGCCCACACTCAAAGGGG - Intronic
1011902987 6:92324163-92324185 TAACAAGGCAAAACTCAAAGGGG - Intergenic
1012416817 6:99021422-99021444 TATCCATGCCAAAGTCACAGGGG + Intergenic
1016899572 6:149088326-149088348 TAACCAGAACAGACTCAAGGAGG - Intergenic
1019675827 7:2312040-2312062 TAACCAGGCAAGTCTGAAAGTGG - Intronic
1020263050 7:6541989-6542011 TATCTAGGCCAAAAACAAAGAGG + Intronic
1023075141 7:36474367-36474389 TACCCGTGCCAAAATCAAAGGGG + Intergenic
1024224817 7:47318405-47318427 TAACCAGTCCCAACTCAAACTGG - Intronic
1025320520 7:58088730-58088752 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1025478829 7:60957718-60957740 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1025482035 7:60993366-60993388 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1025553226 7:62274975-62274997 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1025840551 7:65141869-65141891 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1025878164 7:65508295-65508317 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1025882501 7:65554090-65554112 TCAACAGGCCAGACTCAAGGTGG + Intergenic
1025890942 7:65648513-65648535 TCAACAGGCCAGACTCAAGGTGG - Intergenic
1026443199 7:70461408-70461430 TAACTAAGCCAAGCTCACAGTGG - Intronic
1028427631 7:90707666-90707688 TAACCAAGCCATACTCACAGTGG - Intronic
1029885259 7:103863015-103863037 GAAACAGGCCAAACACCAAGAGG + Intronic
1032757665 7:134906330-134906352 TCACCCGGCCAACCCCAAAGTGG - Intronic
1034581808 7:152050259-152050281 TAACCAGGCCATACTCATCATGG - Intronic
1040379162 8:46855586-46855608 TAACAGGGCCAAACACACAGAGG + Intergenic
1041004683 8:53486806-53486828 TACCCATGCCAAACACACAGGGG - Intergenic
1041874440 8:62671747-62671769 AAACCAAGACAAATTCAAAGAGG - Intronic
1050176548 9:2875023-2875045 TATCAATGCCAAACTCAGAGAGG - Intergenic
1050689153 9:8205625-8205647 TAACCATTTCAAACTCAAATTGG - Intergenic
1050718681 9:8560339-8560361 TAACAAGGCCAAATGCAAAATGG + Intronic
1052193874 9:25688906-25688928 GAACAAGGACAAAGTCAAAGTGG + Intergenic
1057749073 9:97776187-97776209 TAACCATGCCCAAATCAGAGAGG + Intergenic
1060289149 9:122284326-122284348 TAAACAGGCCAAGATCATAGGGG - Intronic
1203613441 Un_KI270749v1:28973-28995 TAAACAGGCCAGACTCAAGGTGG - Intergenic
1185794093 X:2950049-2950071 TCTCCAGGCCACACTCAAATTGG + Intronic
1186226148 X:7400878-7400900 TAACCAGGTTCAGCTCAAAGTGG - Intergenic
1186706565 X:12146029-12146051 GAATCAGGCCAAACCCAAAAGGG - Intronic
1191670947 X:63748186-63748208 TAACAAGTCCCAACTCCAAGAGG + Intronic
1192451004 X:71244840-71244862 CTACCAGGCCACAATCAAAGAGG + Exonic
1193507439 X:82361985-82362007 TATCCATGCCAAAGTCACAGGGG + Intergenic
1193526613 X:82598399-82598421 TATCCTTGCCAAACTCAGAGTGG - Intergenic
1195036884 X:100978277-100978299 TAATCTGTCCAAACTGAAAGTGG + Intronic
1196583472 X:117402415-117402437 AAACCAGTACAAACTCAAAATGG - Intergenic
1199363623 X:146951700-146951722 TAACCAGTCCAAATTGGAAGAGG + Intergenic