ID: 1095334660

View in Genome Browser
Species Human (GRCh38)
Location 12:41010790-41010812
Sequence CATTTAATGCACATATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095334660_1095334670 26 Left 1095334660 12:41010790-41010812 CCCTCCAATATGTGCATTAAATG 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1095334670 12:41010839-41010861 CATCACCGGTGTTCCAACTAGGG 0: 1
1: 0
2: 0
3: 2
4: 35
1095334660_1095334667 12 Left 1095334660 12:41010790-41010812 CCCTCCAATATGTGCATTAAATG 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1095334667 12:41010825-41010847 CCATCCATCTGTGGCATCACCGG 0: 1
1: 0
2: 1
3: 22
4: 141
1095334660_1095334664 3 Left 1095334660 12:41010790-41010812 CCCTCCAATATGTGCATTAAATG 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1095334664 12:41010816-41010838 TTTCCTTTTCCATCCATCTGTGG 0: 1
1: 3
2: 11
3: 84
4: 511
1095334660_1095334669 25 Left 1095334660 12:41010790-41010812 CCCTCCAATATGTGCATTAAATG 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1095334669 12:41010838-41010860 GCATCACCGGTGTTCCAACTAGG 0: 1
1: 0
2: 0
3: 0
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095334660 Original CRISPR CATTTAATGCACATATTGGA GGG (reversed) Intronic
910358284 1:86388005-86388027 CATTTTATGGACACTTTGGAAGG - Intronic
911205261 1:95086178-95086200 CATATAGTGCACATCTTGGCTGG - Intergenic
912780068 1:112538190-112538212 CAGTTAATTCAGATATTTGATGG - Intronic
913809472 1:122858755-122858777 CATTCAATTCACAGATTTGAAGG + Intergenic
916116017 1:161485747-161485769 TTTTTAATGTGCATATTGGAGGG - Intergenic
918206733 1:182316059-182316081 TATTTAATGCACATTAAGGAGGG + Intergenic
920517198 1:206593979-206594001 TATGTAATACATATATTGGATGG - Intronic
920534602 1:206729429-206729451 GATTGAATGCAGATACTGGATGG - Exonic
923841748 1:237680040-237680062 CATTTAATACCCATAATGCAGGG + Intronic
923903796 1:238359871-238359893 CATTTACTGCACACTTTAGATGG - Intergenic
924694580 1:246385646-246385668 AATATAATGCACAGTTTGGAGGG - Intronic
924711259 1:246531755-246531777 TTTTTAATGTGCATATTGGAGGG + Intergenic
1062776011 10:148503-148525 GAGTGAATGCAAATATTGGACGG - Intronic
1062827902 10:585878-585900 CATTTAATCACCATATTAGAGGG + Intronic
1063708409 10:8453557-8453579 TATTTCAGGCACATATAGGAAGG - Intergenic
1063902565 10:10749409-10749431 CATTTAATCCACAATTTTGATGG - Intergenic
1063998860 10:11646159-11646181 CACTTTATTCACATAGTGGAAGG + Intergenic
1065227387 10:23558227-23558249 GATATAATGCACATATTGTCAGG + Intergenic
1068615838 10:59115412-59115434 CATTTAATGCACATAGACCATGG - Intergenic
1069460427 10:68589970-68589992 CATTTAATATAAAAATTGGAAGG - Intronic
1071460555 10:85889923-85889945 CACATAATGCACATATTCGGGGG + Intronic
1073858670 10:107709653-107709675 CATTTAATTCAAATATAGAAGGG + Intergenic
1073949092 10:108785843-108785865 TTTTTAATGTGCATATTGGAGGG + Intergenic
1074163890 10:110858112-110858134 CATTTTATGCAAATCTTGAACGG + Intergenic
1075299267 10:121306926-121306948 CAGTGACTGCACATCTTGGAAGG + Intergenic
1075403952 10:122181617-122181639 CAGTTGATGCTCATATTTGATGG + Intronic
1078236906 11:9493437-9493459 CATTTAATGAACATACAGTATGG + Intronic
1079639118 11:22782090-22782112 AAAATAATGCAAATATTGGAAGG + Intronic
1080097318 11:28424649-28424671 CATTTAAAGCACAGGTTGGCAGG - Intergenic
1080441552 11:32299276-32299298 TATTTAATGGACACATTTGAAGG - Intergenic
1080917253 11:36672671-36672693 CTTTTAATTGAAATATTGGACGG + Intergenic
1081461287 11:43274983-43275005 CAGTTAATGCAATTATTGCAGGG + Intergenic
1082231142 11:49767982-49768004 CATGTAATCCACATATTAAAGGG + Intergenic
1083115937 11:60459825-60459847 CACATAGTGCATATATTGGAAGG + Intronic
1084739862 11:71132661-71132683 CATTTAAAGCAAATATTGTAAGG - Intronic
1086313164 11:85559115-85559137 CATTTAGTTCACATATTATATGG + Intronic
1088355837 11:108942993-108943015 TATTGAATACACATATTGCAAGG + Intergenic
1092914914 12:13180910-13180932 CAGTTAATGCAAATATTACAGGG + Intergenic
1093231517 12:16549554-16549576 TCTGTAATGCATATATTGGAAGG + Intronic
1093297890 12:17414177-17414199 CATATAATGCACATTTTTAAGGG + Intergenic
1093476669 12:19563079-19563101 CATTTAAAGTACTTATTGGTAGG + Intronic
1094558941 12:31531516-31531538 CATTTAATTCACATATACTATGG + Intronic
1095334660 12:41010790-41010812 CATTTAATGCACATATTGGAGGG - Intronic
1097519329 12:60647707-60647729 TGTTTAATGTGCATATTGGAGGG - Intergenic
1103070246 12:117935418-117935440 CATGAAATGAACACATTGGAGGG - Intronic
1106843428 13:33711037-33711059 GGTTAAATGCACATCTTGGAGGG - Intergenic
1107583415 13:41817276-41817298 CATGTAAAACACATATTTGAGGG + Intronic
1107774569 13:43824011-43824033 CATTTAATACATTTTTTGGAAGG - Intronic
1108212101 13:48149558-48149580 AATTTAATGAATATATTGTAAGG - Intergenic
1108770785 13:53698473-53698495 CATTTTATTCATTTATTGGAAGG + Intergenic
1110214718 13:73012998-73013020 TATTTAATGAAAATATTAGAAGG + Intronic
1111225739 13:85268036-85268058 CATTTAAAAAACATATTTGAGGG + Intergenic
1111580179 13:90212191-90212213 CCTTTTAAGCACAGATTGGAAGG - Intergenic
1116905471 14:50399062-50399084 CATTAAATGCTTATATTAGAAGG - Intronic
1118201780 14:63680908-63680930 CTTTTCATGCAAATATTGAAGGG - Intergenic
1119578413 14:75751021-75751043 CATTTACTGCAAATAAGGGATGG - Intronic
1120562460 14:86012652-86012674 CATTTAACACTCATATTGGAAGG + Intergenic
1120926132 14:89799210-89799232 CATTTTATTCACATAATGAATGG + Intronic
1124476144 15:30036629-30036651 CATTTAATGTAGATATTTAATGG + Intergenic
1131908413 15:97169428-97169450 CATTGAAAGCACATATTTCAGGG - Intergenic
1132180692 15:99750632-99750654 CACTGAATCCACATGTTGGAGGG - Intergenic
1132180703 15:99750679-99750701 CACTGAATCCACATGTTGGAGGG - Intergenic
1132180714 15:99750726-99750748 CACTGAATCCACATGTTGGAGGG - Intergenic
1135465627 16:22682208-22682230 CAGTTAATGCACATACTGAGAGG + Intergenic
1138492890 16:57386865-57386887 CAATTAATGCACAGTTTGAATGG + Intergenic
1138858475 16:60725022-60725044 CATTTATTACACATGTTAGAGGG + Intergenic
1139108904 16:63864546-63864568 CATTTTAAGAACATTTTGGAAGG + Intergenic
1143854489 17:9838709-9838731 GATTTAATGCACAGAATGGCGGG - Intronic
1144691956 17:17272609-17272631 CATTGAATGAAAATATTGGCTGG + Intronic
1154426946 18:14279266-14279288 CTTTTAATGCAAATATCTGAAGG + Intergenic
1154431950 18:14315143-14315165 CTTTTAATGCAAATATCTGAAGG + Intergenic
1156929924 18:42629361-42629383 CATTTACTGCAAATAAGGGATGG - Intergenic
1157212778 18:45758284-45758306 CAGTTAATGCAATTATTGCAGGG + Intergenic
1158172516 18:54615394-54615416 CATTTCAGGGACATGTTGGATGG + Intergenic
1158723628 18:59948182-59948204 TTTTTAATGTACATATAGGATGG + Intergenic
1159223183 18:65492683-65492705 CATTTTATGCACATAATTTAAGG + Intergenic
1159512589 18:69415498-69415520 CATTTAAAATTCATATTGGAAGG - Intronic
1159837610 18:73357918-73357940 GATTAAATGCACACATAGGAAGG + Intergenic
1160140161 18:76314058-76314080 TATTTAAGGCACATATTTAAGGG + Intergenic
1162591692 19:11596510-11596532 CATTAAATGCAAATATTGGCCGG + Intronic
925069382 2:954632-954654 CATTTAATACAGAAATAGGAAGG - Intronic
925743199 2:7023310-7023332 CATTTAATGCTCATATTGACTGG + Intronic
926495616 2:13583068-13583090 GAATTAATGCACATTATGGAGGG - Intergenic
927407531 2:22788546-22788568 TATGTAATGCACATATTTGTAGG + Intergenic
927532906 2:23825717-23825739 CAGTTAATGAACATATTATATGG + Intronic
927683646 2:25156159-25156181 CATTTATTGCACATATTAATGGG - Exonic
928482085 2:31693161-31693183 TTTTTAATGTGCATATTGGAGGG - Intergenic
932951970 2:76304321-76304343 CATTCAATGTGCATATTTGATGG - Intergenic
933497839 2:83073009-83073031 CAGGTAAAGCAGATATTGGAGGG + Intergenic
934046073 2:88173351-88173373 CATTTAATTCATCTTTTGGAAGG - Exonic
938508690 2:131915947-131915969 CAATTAATACAAAGATTGGAAGG + Intergenic
938643701 2:133309629-133309651 CTTTTAATGCACATGTTTCAGGG + Intronic
942445762 2:176077343-176077365 CATATAATACACATATCAGATGG - Intergenic
944380372 2:199102444-199102466 CATTTAATGCATAGACTGAATGG - Intergenic
945871420 2:215230708-215230730 CATTTAAGACAAATTTTGGATGG - Intergenic
946510103 2:220346796-220346818 CATTTGATCCACATATGAGATGG - Intergenic
1169385012 20:5141338-5141360 CATTAGATGCACACATTGCATGG - Intronic
1173840753 20:46155316-46155338 CAGGTAATGCACATTTTGCAAGG - Intergenic
1176784801 21:13242592-13242614 CAATTAATACAAAGATTGGAAGG - Intergenic
1177832890 21:26159016-26159038 CATTTTATGGACATACTGCATGG - Intronic
1177982840 21:27936428-27936450 CAATTAATACAAAGATTGGAAGG - Intergenic
1182157918 22:28093124-28093146 AATTTAATGTCAATATTGGAAGG - Intronic
951037917 3:17953734-17953756 AATATAATTCACAAATTGGAAGG - Intronic
951066082 3:18267186-18267208 CATGAAATGCAAATATTGTAGGG - Intronic
955446290 3:59014705-59014727 CAATTAATGCAGATAATTGAGGG - Intronic
955664310 3:61334049-61334071 CATTAAACAAACATATTGGAAGG + Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956713405 3:72057892-72057914 CTTTTAATGCTCATATTTGTTGG + Intergenic
957320800 3:78627870-78627892 CTTTTAGAGAACATATTGGAGGG - Intronic
960317578 3:116196989-116197011 CATTTAATGGACCTTTTGGGAGG - Intronic
963655778 3:148048319-148048341 CATTTAATGCACTTATTTGTAGG + Intergenic
965238970 3:166168848-166168870 CATATAATGAACATAAAGGAAGG + Intergenic
965856684 3:173097672-173097694 CATTTACTGCACGTAAGGGATGG + Intronic
968558899 4:1265917-1265939 CATTTTATGCACACATGGAATGG + Intergenic
969595150 4:8144529-8144551 CATTTAATGCAGATTATGGAGGG + Intronic
973944464 4:55942933-55942955 CATATATTGGACTTATTGGAGGG + Intergenic
974403431 4:61433978-61434000 CATTTAAGACATATTTTGGAAGG - Intronic
975286732 4:72630056-72630078 CATGATCTGCACATATTGGAAGG - Intergenic
976066330 4:81191857-81191879 CATTTAATACACATATGTGTTGG + Intronic
976306817 4:83568392-83568414 CATTTTATGGACCTATTGTATGG + Intronic
979007798 4:115324219-115324241 CATTTGTTGTATATATTGGAGGG + Intergenic
979275276 4:118808496-118808518 AAATTAATTCACATCTTGGATGG + Intronic
979362487 4:119781290-119781312 AATTTACAGCACACATTGGATGG + Intergenic
980417802 4:132515516-132515538 TAATTAATGTACATATTTGATGG + Intergenic
980552916 4:134363542-134363564 CATTCAATGTACTAATTGGATGG + Intergenic
982404099 4:155001513-155001535 CATTTAATCCAAACATTGGAGGG - Intergenic
983371428 4:166864304-166864326 CATTAAATGCCCATATCAGAAGG + Intronic
984492551 4:180453628-180453650 CATGTTATTCAAATATTGGAAGG + Intergenic
986914566 5:12602693-12602715 CATTTATAGCAGATATTGAAGGG + Intergenic
987054317 5:14176909-14176931 TATTTTATGCACATATTACAGGG + Intronic
988114279 5:26864408-26864430 CATTTAAAGCCAATATTGAACGG + Intergenic
988206825 5:28147908-28147930 CAGTTTCTTCACATATTGGAAGG + Intergenic
988337360 5:29923508-29923530 TTTTTAATGTACATATTGGAGGG + Intergenic
988574067 5:32402205-32402227 CATTTAATGAACACATAGGCAGG + Intronic
989445269 5:41520895-41520917 CATTTAAAGCAAATATTAGCAGG + Intergenic
990924829 5:61008683-61008705 CATTTGTGGCACATATTGGCTGG + Intronic
991954452 5:71978630-71978652 CATAAATTGCACATATTTGAAGG + Intergenic
993436638 5:87903705-87903727 CATTTTATACAAATATTGCAGGG + Intergenic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
996532435 5:124540603-124540625 CATTTAATTGACAAATTGGGGGG + Intergenic
996619783 5:125486174-125486196 AATACAATGCACATATTTGATGG - Intergenic
996620249 5:125492479-125492501 CATTTTCTGCACATATGGGCAGG + Intergenic
997142955 5:131402157-131402179 CTTTTAATGTATATATTGGTTGG - Intergenic
997781591 5:136664787-136664809 CATTTCATGCACATTTTCCAAGG + Intergenic
1000024071 5:157343614-157343636 CATTTATTGCACATTTGAGACGG + Intronic
1000625333 5:163531761-163531783 CATTTACTGCACATGTAGGCAGG - Intergenic
1001155351 5:169268145-169268167 AATTTGATGCACATTTGGGAAGG + Intronic
1004669908 6:17785980-17786002 CATTTTAGGGACATAGTGGATGG - Intronic
1005163913 6:22897423-22897445 CATTTGATCCCCATATAGGAAGG + Intergenic
1005192181 6:23237381-23237403 CATATAATGGAAATACTGGAAGG - Intergenic
1005224674 6:23627853-23627875 CATTTAATAAACATTTTTGATGG - Intergenic
1005523013 6:26616642-26616664 CATTTAATGTTCATTTTGGGTGG - Intergenic
1009381962 6:63042673-63042695 CATTTAATGCAGTTTTTAGAGGG - Intergenic
1010305105 6:74310589-74310611 CATTAACTGCACAAATTGTACGG - Intergenic
1011513863 6:88130800-88130822 CATAAAATGCACAGATTGCAAGG - Intergenic
1011856119 6:91693608-91693630 TATTTAAGGGTCATATTGGAGGG - Intergenic
1013228407 6:108138406-108138428 CATTTAATTCCCATTTAGGAAGG + Intronic
1013488316 6:110619131-110619153 CATTTAATAGATATGTTGGAAGG + Intronic
1013723831 6:113067093-113067115 CATTTAATTCACTTAGTGTAAGG - Intergenic
1018195423 6:161352440-161352462 CATTTTCAGCACATATTGCATGG + Intronic
1018661330 6:166089855-166089877 CATTTCATGAACATTTGGGATGG - Intergenic
1021157832 7:17233969-17233991 AACTCAATGCACATATTGAAAGG + Intergenic
1021680342 7:23124495-23124517 AATTTAAGGCACATCTTGGGTGG + Intronic
1023463634 7:40428888-40428910 CATTTAAGGCAGATATTGAGAGG + Intronic
1024224314 7:47314122-47314144 CAATTAATCCACTTATTAGATGG + Intronic
1025316138 7:58032604-58032626 AATTTAATGCAATTATTGAATGG + Intergenic
1025571592 7:62578365-62578387 AGTTGAATGCACATATTAGAAGG + Intergenic
1026442290 7:70455164-70455186 AATGTAATGCCCATAATGGATGG + Intronic
1027401787 7:77816488-77816510 CACATAATGTACATATTTGAGGG + Intronic
1032359238 7:131239677-131239699 CATTTAATGTAAACATGGGATGG - Intronic
1035898618 8:3433374-3433396 CACTTAATGCCCATTTTGAAAGG - Intronic
1036029229 8:4947865-4947887 CATTTTGTGAACATATTGCAAGG + Intronic
1040003480 8:42598813-42598835 CATTTAAGGAACATAGAGGAAGG + Intergenic
1040799832 8:51328250-51328272 CTTTTAATACACATATCAGATGG + Intronic
1041446345 8:57954954-57954976 AATTTAAGAGACATATTGGAAGG + Intergenic
1043101239 8:76049126-76049148 TAATTAATCCACATTTTGGATGG - Intergenic
1045965710 8:108022099-108022121 CACCTAAAGCACATACTGGAGGG - Intronic
1046599011 8:116296191-116296213 CATTTAAAGCACATGTTGGCTGG - Intergenic
1047337701 8:123952402-123952424 CATTTAATGCTCTTATTGTTTGG + Intronic
1047866840 8:129033956-129033978 CATCTTCTGCACAAATTGGAAGG + Intergenic
1048175762 8:132150674-132150696 CTTTTAATGCACATATGAGAGGG + Intronic
1051416085 9:16842119-16842141 TATTTAATGCACATATTTTTTGG + Intronic
1052018808 9:23501139-23501161 CATTTAAAGACCAGATTGGAGGG - Intergenic
1052229257 9:26127828-26127850 CACTTAATCCAAACATTGGAGGG + Intergenic
1052439800 9:28481525-28481547 CATTTGATCTAGATATTGGAAGG - Intronic
1052838205 9:33267041-33267063 CATTTAATCCTCATACTGTAAGG - Intronic
1053630250 9:39930166-39930188 CCTTTAATGCACATATGTTAAGG + Intergenic
1054213637 9:62320536-62320558 CCTTTAATGCACATATGTTAAGG - Intergenic
1056602760 9:88059170-88059192 AATTTATTGAAGATATTGGAGGG - Intergenic
1057838086 9:98463183-98463205 GAATTATTGCACATATTGGCTGG - Intronic
1059882234 9:118704365-118704387 CATTGAAGGCAAATGTTGGAAGG - Intergenic
1060053775 9:120395742-120395764 CTTTTAATACACATATTTCATGG - Intronic
1060513786 9:124253040-124253062 CATTTAATTCACATAGAGGCTGG - Intergenic
1060617673 9:125033231-125033253 TGTTTAAGGTACATATTGGAAGG + Intronic
1061947501 9:133916932-133916954 CATTTAATCCTCACATTTGATGG - Intronic
1203340723 Un_KI270317v1:1250-1272 CATTCAATTCACAGATTTGAAGG - Intergenic
1187632780 X:21193500-21193522 CATTTAATTCACCTTTTGGAAGG + Intergenic
1187817643 X:23250081-23250103 CATTTAATTAACATATTGAATGG - Intergenic
1188150218 X:26664949-26664971 CATTTAATGCTCATATGGTGGGG + Intergenic
1189132406 X:38513893-38513915 CAATTAAAACACATTTTGGAGGG - Intronic
1190692018 X:52920193-52920215 CCTTTACTGCACATCGTGGAGGG + Intergenic
1192045319 X:67665833-67665855 CATTTTATGCATATATTCCATGG - Intronic
1193319455 X:80104407-80104429 CAATTAATACACATATTTGCAGG + Intergenic
1193540150 X:82761322-82761344 AATTTACAGCACATAGTGGAAGG + Intergenic
1193560730 X:83013227-83013249 TTTTTAATGAGCATATTGGAGGG - Intergenic
1195370931 X:104171792-104171814 CATTTAATCCTCATATTTTAGGG + Intronic
1197038360 X:121904909-121904931 TTTTTAATGCACATATGAGAGGG + Intergenic
1197403265 X:126020181-126020203 CATTTTAAACACATTTTGGAAGG + Intergenic
1198065218 X:133089654-133089676 TCCTGAATGCACATATTGGAGGG - Intronic
1198630915 X:138637600-138637622 CATTTAATACACATTTTCTAAGG + Intronic
1199820571 X:151441744-151441766 CACTAAATGCACATATTGGAAGG - Intergenic
1201144653 Y:11057501-11057523 CATTTAAAGCAAATATTGTAAGG - Intergenic
1201366011 Y:13206938-13206960 CTTTAACTGCTCATATTGGAAGG + Intergenic
1201608963 Y:15819120-15819142 CACTAAATGCCCATATTAGAAGG + Intergenic
1202265829 Y:23017859-23017881 CATTTACTTAACATCTTGGAGGG + Intergenic
1202418822 Y:24651602-24651624 CATTTACTTAACATCTTGGAGGG + Intergenic
1202451964 Y:25018484-25018506 CATTTACTTAACATCTTGGAGGG - Intergenic