ID: 1095337670

View in Genome Browser
Species Human (GRCh38)
Location 12:41048220-41048242
Sequence TGGGCCCACTTGAAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095337670_1095337672 -10 Left 1095337670 12:41048220-41048242 CCACAAAACTTCAAGTGGGCCCA 0: 1
1: 1
2: 0
3: 16
4: 146
Right 1095337672 12:41048233-41048255 AGTGGGCCCATAGTGCTGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095337670 Original CRISPR TGGGCCCACTTGAAGTTTTG TGG (reversed) Intronic
900919038 1:5659144-5659166 TGGGCCCAAGTGAAGGGTTGTGG - Intergenic
901752888 1:11422427-11422449 AGGGCCCACTTGCTGTCTTGGGG - Intergenic
901988226 1:13092393-13092415 TGGGCCTTCTTGATGCTTTGGGG + Intergenic
901993586 1:13134374-13134396 TGGGCCTTCTTGATGCTTTGGGG - Intergenic
903113349 1:21157252-21157274 TGGGCTGACTTGAAGTTGAGGGG - Intronic
904106745 1:28090962-28090984 TGGGCCTACCTGTAGTTTTGAGG - Intergenic
905466441 1:38157658-38157680 TAGGCCTATTTGGAGTTTTGAGG + Intergenic
911626974 1:100134839-100134861 TGTTTCCACTTGATGTTTTGCGG - Intronic
911698936 1:100927570-100927592 AGGGCCCACTTTGAGGTTTGTGG + Intronic
914339422 1:146746293-146746315 TGAGCACACTGGAAGATTTGAGG + Intergenic
914434616 1:147648798-147648820 TGGGGAAGCTTGAAGTTTTGGGG + Intronic
916439187 1:164806145-164806167 TGGCCCTCCTTGAAGTTGTGTGG - Intronic
917289209 1:173454838-173454860 TGTGCCCATTTCAAGTTTTGGGG + Intergenic
918036130 1:180873921-180873943 TTGCCCCACTTGAGGTTTTCCGG + Exonic
920771759 1:208893063-208893085 TGGCACCACTTGAAATTCTGGGG - Intergenic
923928627 1:238665973-238665995 TGTGCTAACTTGAAGTGTTGGGG + Intergenic
924678376 1:246204166-246204188 TTGGCCCACTTACAGTTTTTGGG - Intronic
1067333095 10:45339926-45339948 TGGGCCTACTTGGATTTTGGAGG + Intergenic
1067438408 10:46294597-46294619 GGGCCCCACTTGCAGTTTCGAGG + Intronic
1067732659 10:48823265-48823287 TGGGACAACTTGAATTTTAGGGG - Intronic
1067763014 10:49063925-49063947 TGGGCTCACTTGAGGTTTTCAGG + Intronic
1069192355 10:65506661-65506683 TGGGCCTACTTGGATTTTGGAGG - Intergenic
1070333434 10:75433698-75433720 TGGGCTCATGGGAAGTTTTGCGG - Intronic
1070403003 10:76069970-76069992 TGGGCCCACTCCAAGTTTCAGGG + Intronic
1071836012 10:89417635-89417657 TGGGCACTCTTGAAATTTGGAGG + Exonic
1073557304 10:104465609-104465631 TGGGCCTACTTGGATTTTGGAGG + Intergenic
1079541874 11:21586381-21586403 TGGGACCAGTTGTAGATTTGGGG - Intergenic
1081065505 11:38535190-38535212 TGGGCCTATTTGGATTTTTGAGG - Intergenic
1084223299 11:67698162-67698184 TGGGGCTACTTGGATTTTTGAGG + Intergenic
1085243477 11:75077856-75077878 TGGCCCCCTTTGAATTTTTGAGG - Intergenic
1085552923 11:77391898-77391920 TGGTCCCACTTTCAGGTTTGGGG - Intronic
1087522471 11:99258298-99258320 GGGGCCCACTTGAAGGTGGGAGG - Intronic
1091051691 11:132378439-132378461 TGGGCCTATTTGGATTTTTGAGG + Intergenic
1092214304 12:6670000-6670022 TGAAGCCACTTGAAATTTTGAGG - Intronic
1094829839 12:34295042-34295064 TGGGCCTTCTTGACGCTTTGGGG + Intergenic
1094830176 12:34296546-34296568 TGGGCCTTCTTGACGCTTTGAGG - Intergenic
1094830718 12:34298914-34298936 TGGGCCTTCTTGCAGCTTTGGGG - Intergenic
1094830862 12:34299617-34299639 TGGGCCTTCTTGATGCTTTGGGG - Intergenic
1095337670 12:41048220-41048242 TGGGCCCACTTGAAGTTTTGTGG - Intronic
1096554408 12:52394665-52394687 TGTGCCCATTTGACCTTTTGGGG + Exonic
1097843406 12:64343074-64343096 TGGGCCTATTTGAATTTTGGAGG - Intronic
1099769672 12:87034798-87034820 TGGGCCAACATGATGTTCTGTGG + Intergenic
1100071829 12:90730224-90730246 TGAGCCCACTTGTAATTTTCAGG - Intergenic
1102442282 12:112972359-112972381 TGGCCCCACTGTAACTTTTGGGG + Exonic
1102547474 12:113667109-113667131 TGAGGCCACCTGAAGGTTTGGGG + Intergenic
1106246283 13:27953477-27953499 TGGGCCCACTTTAGGGTGTGTGG - Intergenic
1107128111 13:36866159-36866181 TGTGCCCACTTGAATCCTTGTGG + Intronic
1107497604 13:40943063-40943085 TGGGTCCACTTGATGTATTTAGG + Exonic
1115884841 14:37959486-37959508 TGGGCTCACTTGAGGAATTGAGG + Intronic
1115961492 14:38838685-38838707 GGGGCCCAGGTGCAGTTTTGTGG + Intergenic
1117895748 14:60485302-60485324 GGGCACGACTTGAAGTTTTGGGG + Intronic
1118567805 14:67161463-67161485 TCGGCCCAATTCAATTTTTGAGG - Intronic
1118916650 14:70113020-70113042 TGGGTGGACTTGAACTTTTGGGG + Intronic
1118956722 14:70489447-70489469 TGGACCCACCTGAGGTTTTGAGG + Intergenic
1118964487 14:70567319-70567341 TGGGCCCCCAGGAAGTTGTGAGG + Intergenic
1120556040 14:85930755-85930777 TGGGCCTATTTGAATTTTGGAGG - Intergenic
1121077183 14:91078678-91078700 TGTGCCACATTGAAGTTTTGGGG + Intronic
1123475595 15:20591088-20591110 TGGGCCCACCAGAAGATTTCAGG + Intergenic
1123642416 15:22409275-22409297 TGGGCCCACCAGAAGATTTCAGG - Intergenic
1124370607 15:29102953-29102975 TGGGTCCACTTGAAGTGCTTCGG + Intronic
1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG + Intergenic
1128674854 15:69600974-69600996 TGGGCTCATATGAAGCTTTGGGG + Intergenic
1129667243 15:77586159-77586181 GGGAGCCACTTGCAGTTTTGGGG + Intergenic
1135625958 16:23995184-23995206 TGGGCCTACTTGGATTTTGGAGG + Intronic
1138565153 16:57827706-57827728 TGTGCCCACTGGAGGGTTTGTGG - Intronic
1139994854 16:70971054-70971076 TGAGCACACTGGAAGATTTGAGG - Intronic
1141336975 16:83165195-83165217 TGTCCCCACTTGACGTTTGGAGG - Intronic
1146237935 17:31185634-31185656 TGGGCCTACTTGGATTTTGGAGG + Intronic
1151196002 17:72431435-72431457 TGGGCCCCCTAAAAGTATTGGGG - Intergenic
1151245055 17:72788054-72788076 TGTGCCTACTTGAGGTGTTGAGG - Intronic
1152710204 17:81867568-81867590 AGGGCCCCCTTGAAGTGCTGTGG - Intergenic
1155927884 18:31677460-31677482 TGGGCCCACTGGAAACTTTCAGG - Intronic
1156998540 18:43497409-43497431 TGGGCCTATTTGGATTTTTGAGG + Intergenic
1157368849 18:47091636-47091658 TGTGCCCACAAGCAGTTTTGAGG + Intronic
1159277104 18:66235207-66235229 TGGGCCTACTTGGATTTTGGAGG + Intergenic
1160708048 19:539029-539051 TTGGCCCACAGGGAGTTTTGAGG - Intronic
1163250717 19:16124962-16124984 TGGGGTCACTGGAAGTTGTGTGG + Intronic
1166381004 19:42355414-42355436 AGGGCCCAATTCACGTTTTGAGG + Intronic
925077918 2:1034137-1034159 TGGGCCCACTTGAAGGTGGAGGG - Intronic
926132216 2:10310764-10310786 TGGGCACACTTGCAGAATTGCGG + Intronic
927480674 2:23451559-23451581 TGGCCCCACTTGAGGCTCTGAGG + Intronic
930341727 2:50124596-50124618 AGGGCACAATGGAAGTTTTGGGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936660218 2:114534903-114534925 TGGGGCCCCTTGAGGATTTGAGG + Intronic
939069017 2:137517539-137517561 TGGGCCTATTTGAATTTTGGAGG + Intronic
945960463 2:216129030-216129052 TGGAGCCACTTACAGTTTTGAGG + Intronic
947340004 2:229128155-229128177 TGAGAGCACTTGAAGTTTGGGGG - Intronic
1170581866 20:17705358-17705380 TGGGCCCTCTGGAATTTATGAGG - Intronic
1172481429 20:35274146-35274168 TGGGCACACCTGGAGGTTTGGGG - Intronic
1173302518 20:41816768-41816790 TGGGCCCACTTCATGTTCTCAGG - Intergenic
1177940943 21:27410800-27410822 TGGGCCTACTTGGATTTTGGAGG - Intergenic
1181627992 22:24134296-24134318 CGGGCCCACTGGAGGTTCTGGGG - Exonic
949638736 3:6012198-6012220 TGGGCCTACTTGGATTTTGGAGG + Intergenic
952255927 3:31695693-31695715 GGGGGCCACTTAAGGTTTTGAGG - Intronic
953054843 3:39379891-39379913 AGGACCCACTTGTGGTTTTGTGG - Intergenic
955554655 3:60123737-60123759 AGTGCCCACTTTAAGTTTAGTGG + Intronic
970687180 4:18581746-18581768 TAGCCTCTCTTGAAGTTTTGTGG - Intergenic
971602899 4:28618292-28618314 TTCCCACACTTGAAGTTTTGGGG + Intergenic
973728844 4:53803891-53803913 TGGGTCCAGTTGAACTTATGTGG - Intronic
974003470 4:56533222-56533244 AGAGCCCACTTGAAGTTCAGGGG - Intronic
975345057 4:73283802-73283824 TGGTCTCACTTTAAGTTTTCAGG + Intergenic
978772202 4:112468099-112468121 TGGGCCTATTTGGATTTTTGAGG - Intergenic
978899119 4:113927136-113927158 TGGGCCTATTTGGATTTTTGAGG - Intronic
978939496 4:114419528-114419550 TGGGCCTCCTTGAAGAATTGTGG - Intergenic
979654998 4:123181688-123181710 TTGGCCCACTGGCTGTTTTGGGG + Intronic
980629487 4:135413968-135413990 TGGGCCTATTTGAATTTTGGGGG + Intergenic
980957684 4:139445601-139445623 TGGGCCCATTTGGATTTTGGAGG + Intergenic
981016503 4:139979537-139979559 TGGCAACACCTGAAGTTTTGAGG - Intronic
984615438 4:181891825-181891847 TGGCCACACTTGAATTTTGGAGG - Intergenic
987091282 5:14509784-14509806 TGGGCACCCTCGAAGTTTTCTGG + Exonic
988497320 5:31756486-31756508 TGGGCCCACAAGAAGTCCTGTGG + Intronic
989307537 5:39974875-39974897 TGGGCCTACTTGGATTTTGGAGG - Intergenic
990749653 5:59000573-59000595 TGGGACCACTTGCAATTCTGGGG + Intronic
992454160 5:76901324-76901346 TGGACCCACTTGAAGCTTGGGGG - Intronic
998010896 5:138694843-138694865 TGGGCCCACTTTATGTTGGGAGG - Intronic
999483072 5:151966642-151966664 TGGGACAACTTGAAGTGGTGGGG + Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001465187 5:171957859-171957881 AGGGCCCACTTGATGTTCTATGG + Intronic
1001529629 5:172453346-172453368 TGGGCCCACATGAGGCCTTGGGG - Intronic
1003856728 6:10283896-10283918 TGGGGCCACTTGAAGGGTAGAGG + Intergenic
1004347378 6:14861393-14861415 TGGTCCCACTTGAAGCTGGGTGG - Intergenic
1007727183 6:43923675-43923697 TGGGCTCTCTTGCAGGTTTGAGG + Intergenic
1008520441 6:52358052-52358074 TGGGCACATGTGAGGTTTTGAGG - Intergenic
1009313107 6:62181896-62181918 GGGGCCCACTTTCTGTTTTGTGG - Intronic
1013480713 6:110550511-110550533 TGGGCCCACTCTCAGGTTTGGGG - Intergenic
1013852755 6:114535256-114535278 TTGGCGCACTTACAGTTTTGCGG + Intergenic
1015466895 6:133558035-133558057 TGGGCCTATTTGGATTTTTGAGG - Intergenic
1018107386 6:160502115-160502137 TGGGCCTACTTGGATTTTGGAGG - Intergenic
1020974515 7:14988381-14988403 TGGGACAACTTGAAGTGGTGGGG + Intergenic
1021399287 7:20191293-20191315 TGGGCCTACTTGCACTTCTGAGG + Intronic
1023481443 7:40639038-40639060 TGGGATGACTTGAAGTTTAGAGG + Intronic
1025067341 7:55868635-55868657 TGAGACAACTTGAAGTTGTGTGG + Intergenic
1026474866 7:70726494-70726516 TTGGCCCTCTTAAAGTTCTGTGG + Intronic
1027513001 7:79107125-79107147 TGGGCCCACCTGGATATTTGAGG - Intronic
1036545985 8:9770509-9770531 TGGGCCCTCATGCCGTTTTGAGG + Intronic
1039162238 8:34635144-34635166 GGGGACAGCTTGAAGTTTTGAGG + Intergenic
1039730389 8:40269518-40269540 TGTGCACAGTGGAAGTTTTGGGG - Intergenic
1045068203 8:98471671-98471693 TGGTTCCACTTAAAGTTTTTTGG - Intronic
1048527227 8:135214267-135214289 TGGGTGCACCTGAATTTTTGTGG - Intergenic
1049149603 8:141026137-141026159 TGGGCCCACTAGATATTCTGGGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055188030 9:73480095-73480117 TGGGACAACTTGAAGTGGTGAGG + Intergenic
1055673595 9:78632240-78632262 TGGGCCCACTTGAACTTTTGCGG - Intergenic
1060268299 9:122125026-122125048 TGGGACCACTTGCAGATTGGTGG - Intergenic
1186322410 X:8443417-8443439 TGGTCCCAGTGGCAGTTTTGTGG + Intergenic
1186834381 X:13422836-13422858 TGTGCTCACTTGATGTTTTGGGG - Intergenic
1188467102 X:30494072-30494094 AGGGCCCACTTCCAGGTTTGCGG + Intergenic
1191596095 X:62945782-62945804 GGGACCCACATGAAGTATTGGGG - Intergenic
1191626190 X:63273998-63274020 TGGGTCCACTTCAATTTCTGTGG - Intergenic
1192603672 X:72491200-72491222 TGGCCCCAAGTGAAGTTTGGGGG + Intronic
1193357836 X:80542708-80542730 TGGTCCCCATTGGAGTTTTGTGG + Intergenic
1194843173 X:98770279-98770301 TGGGTAGACATGAAGTTTTGGGG + Intergenic
1195898855 X:109776431-109776453 TGAGACCACTTAAAGTTTTGCGG - Intergenic
1196773294 X:119317055-119317077 TGGGACAACTTGAAGTGGTGAGG - Intergenic
1198783090 X:140258112-140258134 TGAGCCCACTTGGATTTTGGAGG - Intergenic
1199082861 X:143595667-143595689 TGGGCCTTTCTGAAGTTTTGGGG - Intergenic
1199303345 X:146238485-146238507 TGTTCCAACTTGAATTTTTGGGG - Intergenic
1200270081 X:154674577-154674599 TGGGCCAACCTGCTGTTTTGTGG + Intergenic