ID: 1095339818

View in Genome Browser
Species Human (GRCh38)
Location 12:41076183-41076205
Sequence CTGAACTCCCTCACATGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095339818 Original CRISPR CTGAACTCCCTCACATGTTC GGG Intergenic
900944061 1:5819775-5819797 CTGGCCTCTCTCACATGCTCTGG + Intergenic
902293776 1:15452203-15452225 CTGGACTCACTCATATGTTTAGG + Intergenic
903379879 1:22889290-22889312 CTCATCTCCCTCACATAATCAGG + Intronic
904753478 1:32755113-32755135 CTGAACTGCCGCACTTGTTGGGG - Intronic
904950891 1:34237757-34237779 CTGGACTCCCTCCCATGTCAGGG + Intergenic
905346434 1:37314161-37314183 CTTAACTGCTTCACATGTGCTGG + Intergenic
906917340 1:50024939-50024961 TTGAACTCTCTCACATTTCCTGG + Intergenic
912684116 1:111748693-111748715 CTGCTCTCCCTCATCTGTTCTGG + Intronic
915481142 1:156186279-156186301 CATAATTCCCTCACTTGTTCTGG - Intergenic
918927545 1:190807648-190807670 CTGGATTTCCTCACATGCTCAGG + Intergenic
920537687 1:206750007-206750029 CTGAACTCCTTTAAATATTCGGG + Intergenic
921454867 1:215358555-215358577 CAGACTTCCCCCACATGTTCTGG + Intergenic
1063568318 10:7192095-7192117 TTGAACACACTCACATGGTCTGG - Intronic
1064507981 10:16054773-16054795 CTGAAATCTCTCACATGCACTGG + Intergenic
1065566838 10:27019989-27020011 CTGAGCTTCCTCACAAGATCGGG + Intronic
1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG + Intronic
1070515224 10:77199037-77199059 CTGCATTCACTCCCATGTTCTGG - Intronic
1073337535 10:102721027-102721049 CTGAACCCCCTCTGAGGTTCTGG + Intronic
1075788420 10:125066104-125066126 GTGAACTCCCTCTAATGCTCAGG + Intronic
1077560369 11:3256693-3256715 CTGCACTCCTTGATATGTTCAGG - Intergenic
1077566266 11:3302510-3302532 CTGCACTCCTTGATATGTTCAGG - Intergenic
1078442535 11:11379285-11379307 CTGACCTCCCTCCCATGCTAAGG - Intronic
1079305961 11:19322279-19322301 CTCAAATCTCCCACATGTTCTGG + Intergenic
1079407615 11:20159944-20159966 CTGACCTCGCTTACCTGTTCTGG + Exonic
1080976688 11:37350683-37350705 CTGAACTGCCTCTCATGAACTGG + Intergenic
1088770786 11:113034143-113034165 CTTAACTCACTCACATGTCCTGG + Intronic
1089048370 11:115524094-115524116 CTGACCTGCATCACAAGTTCTGG + Intergenic
1089837761 11:121386344-121386366 CTGGGCTCTCTCACATGTCCAGG - Intergenic
1090952531 11:131486222-131486244 CTCAACTCCCTGCCAAGTTCTGG - Intronic
1092446346 12:8561013-8561035 CATAATTCCCTCACTTGTTCTGG - Intergenic
1093097243 12:14985481-14985503 CTGAGCTCTCTGACATCTTCTGG - Intergenic
1094102540 12:26779348-26779370 CTGAACTCCCTATCATGAACTGG + Intronic
1095339818 12:41076183-41076205 CTGAACTCCCTCACATGTTCGGG + Intergenic
1096105116 12:48992904-48992926 CTGAACACTCTCAGCTGTTCAGG - Intergenic
1098533161 12:71563745-71563767 GGGAACTCTCTCATATGTTCGGG - Intronic
1099857137 12:88181801-88181823 CATAATTCCCTCACTTGTTCTGG - Intronic
1101112712 12:101501693-101501715 CTGAACTCCTTCCTATGTTTGGG - Intergenic
1105072425 12:133242828-133242850 CTGGACACCCTCCCATGTGCAGG - Intergenic
1112758756 13:102670070-102670092 CACAATTCCCTCACTTGTTCTGG - Intronic
1113036174 13:106052388-106052410 CTTAACTCCCTCCCATGTTTTGG + Intergenic
1113462157 13:110490099-110490121 CTGCACGCCCTCAGGTGTTCCGG - Intronic
1114956519 14:27826881-27826903 CTGAGCTCCCACAAATGTTAGGG + Intergenic
1116393190 14:44417697-44417719 CATAATTCCCTCACTTGTTCTGG + Intergenic
1117519007 14:56531559-56531581 CTCAGGTCCCTCACAGGTTCCGG - Intronic
1118640302 14:67785955-67785977 CTGAACTGCTTCAGATGTGCTGG - Exonic
1122688099 14:103519411-103519433 CTGAATGCCCTCAGATGCTCAGG + Intergenic
1122966167 14:105127374-105127396 CTAAATTCCCTTACTTGTTCTGG - Intergenic
1125176391 15:36827101-36827123 CTGTTCTCCCTCACATTTTTAGG - Intergenic
1127536087 15:59891145-59891167 CAGCCCTCCCTCACATTTTCTGG + Intergenic
1130525574 15:84703231-84703253 CTGAACTCCCTGACATGCACCGG + Intronic
1132714527 16:1284143-1284165 CTGATCTCCCTCCCATGATGCGG - Intergenic
1133367095 16:5218629-5218651 CCCAACTCCCTCACTTCTTCAGG - Intergenic
1135921824 16:26657311-26657333 CTGAACTCCCATCCATGCTCAGG - Intergenic
1137881977 16:52058882-52058904 GTCAACTCCCTCATATTTTCAGG - Intronic
1139884500 16:70198738-70198760 CTGGACCCCCTCTCATGATCTGG - Intergenic
1140116253 16:72043974-72043996 CAAGACTCCCTCACATGTGCTGG - Intergenic
1140368019 16:74396754-74396776 CTGGACTCCCTCTCATGATCTGG + Intergenic
1140922876 16:79554970-79554992 CTGAACTCACTCACATTTCTGGG - Intergenic
1142704103 17:1683593-1683615 ATGATCTTCCTGACATGTTCTGG + Exonic
1146141199 17:30369373-30369395 CTGAACTCCCTCCCTTCATCCGG - Intergenic
1150481486 17:65514899-65514921 CTGAACTGTCTCTCATTTTCTGG + Intergenic
1150897748 17:69233982-69234004 ATGAACTACCTCACCTGTCCAGG - Intronic
1151107908 17:71639425-71639447 CTGCAAACCCTCACATGATCTGG - Intergenic
1152892811 17:82892038-82892060 CTCAACTTCCTCACCTGTGCAGG - Intronic
1156666171 18:39410077-39410099 CACAACTCTCTCACATGTGCGGG + Intergenic
1157205189 18:45691965-45691987 CTGTGCTCACTCACGTGTTCTGG - Intergenic
1163187302 19:15647779-15647801 CTGAGTTCTCTCACATGTTTGGG + Intronic
1163369256 19:16892943-16892965 CTGATCTTACTCACATGTTCTGG - Exonic
1163688698 19:18726520-18726542 ATGAGCTCACTCACAGGTTCTGG - Intronic
928295138 2:30076015-30076037 CTCATCTCCCTTAAATGTTCTGG - Intergenic
928738950 2:34326541-34326563 CTGAACTCCTACAAATGTTGAGG + Intergenic
929945572 2:46369278-46369300 CTGGACTCCCTCTCACGTGCTGG + Intronic
931811924 2:65862608-65862630 CTGAAAACCCTCAAAGGTTCAGG + Intergenic
934480760 2:94641118-94641140 CTGAACTTCCACAAATGTTAGGG - Intergenic
935894034 2:107714467-107714489 CTGAGCTCCCTCACAGGATGGGG + Intergenic
936672815 2:114678495-114678517 CTGGACTCCGGCACATGTGCTGG + Intronic
938695171 2:133828382-133828404 CTGGACTCCCTCTCTTTTTCTGG - Intergenic
945460235 2:210099623-210099645 CTGAAGTATCTCACATCTTCCGG + Intronic
948285884 2:236784828-236784850 CTGAACTCACTGACACCTTCAGG + Intergenic
1168849939 20:969607-969629 GAGAACTCCCTCACACGTGCCGG - Intronic
1169688130 20:8300056-8300078 CTGAGCTCACTCACATGTCTGGG + Intronic
1169980301 20:11377204-11377226 CTGGGCTCCCTCACATGTTTAGG - Intergenic
1170116006 20:12860359-12860381 CTGATCTTCCTTACCTGTTCAGG + Intergenic
1170140911 20:13124242-13124264 CTGGACTCCCACACATGTCTAGG + Intronic
1170373446 20:15674511-15674533 TTGACCTCCCTGACAGGTTCAGG + Intronic
1171878580 20:30599981-30600003 CTGCACTCTCTCCCAGGTTCTGG + Intergenic
1172425791 20:34855026-34855048 CTGAACTCCCTCACCAGATGGGG + Intronic
1174344347 20:49918892-49918914 CTGGACAGCCTCACATGTCCAGG - Intergenic
1174681482 20:52413017-52413039 CTGATCTTTCTCAAATGTTCTGG - Intergenic
1174752277 20:53123401-53123423 CTGGACTCACTGACATGTTTAGG + Intronic
1175456842 20:59121766-59121788 CTGAGCTCCATCACGTGTTTGGG - Intergenic
1178383240 21:32129096-32129118 CTGGGCTCTCTCACATGTTTGGG - Intergenic
1178727779 21:35070212-35070234 CTGGGCTCTCTCACATGTTGGGG + Intronic
1178745694 21:35248221-35248243 CTGGACTCCCTCACATGTCTGGG + Intronic
1183141103 22:35940278-35940300 CTGAATTCCTACACATTTTCTGG - Intronic
950613675 3:14141904-14141926 CTGCACTCCCTCTCCTCTTCAGG + Exonic
950824302 3:15800535-15800557 CTGAATTACCTCACTTGTACTGG - Intronic
951017338 3:17744888-17744910 CTGACCTTCCCCACAGGTTCGGG - Intronic
951297403 3:20955419-20955441 TTGAGCCCCCTCATATGTTCAGG - Intergenic
952055685 3:29442639-29442661 CTCAAGTCCCTCAAATTTTCAGG - Intronic
953275323 3:41490191-41490213 CTGATCTCCATCACATGATTGGG + Intronic
957636199 3:82789760-82789782 CTGAACACCTTCACTTTTTCCGG + Intergenic
957828574 3:85485153-85485175 CTGAATTCCATCACAAGTTTAGG + Intronic
959439519 3:106359265-106359287 CTGAACTCCCTATCATGAACTGG + Intergenic
961886826 3:130102244-130102266 CAGAACACCCTCACAGGTGCTGG + Intronic
963470857 3:145740150-145740172 CTGAGCTCCATCACATGTAATGG + Intergenic
965090469 3:164155811-164155833 CTGAACTATATCACATGCTCAGG + Intergenic
969118200 4:4887675-4887697 CAGAATTCCTCCACATGTTCTGG + Intergenic
969365414 4:6691246-6691268 CTGCACTCCCCCACCCGTTCAGG - Intergenic
970623852 4:17855753-17855775 CTGGGCTCCCTCATATGTCCTGG - Intronic
971993992 4:33940219-33940241 CTGGGCTACCTCACATGTTTTGG + Intergenic
973338623 4:48981971-48981993 CTGAAGTCCTTCACATGTTGGGG + Intergenic
975568178 4:75782943-75782965 CTGAAATCCATCAAATATTCTGG - Intronic
978208961 4:106112477-106112499 CGTAATTCCCTCACTTGTTCTGG + Intronic
980114958 4:128670439-128670461 CTCAACTCACTCACATGTCTGGG + Intergenic
981375050 4:144005604-144005626 CTTAACCCCTTCACATCTTCTGG + Intronic
982402043 4:154978808-154978830 CTGTCCTCCCTCACAGGTGCTGG + Intergenic
982907367 4:161091461-161091483 CTTCACACTCTCACATGTTCAGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
991295119 5:65072373-65072395 CTGAAGTCCCTCACATCTTCTGG + Intergenic
991370563 5:65915312-65915334 CTGAAATCCATTTCATGTTCTGG + Intergenic
993827550 5:92710282-92710304 GTGAACTCCCACACTTTTTCAGG - Intergenic
999794026 5:154971016-154971038 CTGGGCTCACTCACATGTTTAGG - Intergenic
1001481315 5:172091039-172091061 CTCAGCTTCCTCACCTGTTCAGG + Intronic
1003520448 6:6854169-6854191 CTGACCTCCCTCTCAGGTTTTGG + Intergenic
1007843227 6:44733700-44733722 CTTGACTTCCTCACATGCTCTGG + Intergenic
1008943519 6:57072553-57072575 CATAATTCCCTCACTTGTTCTGG + Intergenic
1011617298 6:89208850-89208872 CAGATCTCCCTCAGATGTGCAGG - Intronic
1012620979 6:101343685-101343707 CTGGACTCCCTCACCTGTAGAGG + Intergenic
1014649555 6:124018323-124018345 CAGAAGTCCCTGACATGCTCTGG + Intronic
1014880791 6:126721999-126722021 CTGCACTCCCAAACAAGTTCAGG - Intergenic
1014955215 6:127606774-127606796 ATAATCTCACTCACATGTTCAGG + Intergenic
1015484361 6:133751651-133751673 CTGGACTCTCTCACATGAGCAGG - Intergenic
1016701734 6:147062009-147062031 CATAACTTCCTCATATGTTCAGG - Intergenic
1017408513 6:154145283-154145305 CTGAACTCCCTTATTAGTTCTGG - Intronic
1020710357 7:11597710-11597732 CTGAACTGCCTATCATGTACTGG + Intronic
1022540768 7:31133621-31133643 CTGAGCTCTCTCAAATGTCCTGG + Intergenic
1023742400 7:43292573-43292595 CTGAGCTCCCTCTCAGGCTCTGG - Intronic
1024478254 7:49837427-49837449 CAAAAGTCCTTCACATGTTCTGG - Intronic
1024905604 7:54375510-54375532 CTGCACTCCCTCCCAAATTCCGG + Intergenic
1027685807 7:81278039-81278061 CTGAACTGCCTATCATGTACTGG + Intergenic
1027720244 7:81731912-81731934 CTGAACTCCCTTCCATTGTCAGG - Intronic
1029956891 7:104649598-104649620 CTGAAATCCATCAAATGTTATGG - Intronic
1030083678 7:105799273-105799295 GTGGTCTCCATCACATGTTCTGG - Intronic
1030208324 7:106972360-106972382 TTGAACTGCCTCCCAGGTTCAGG - Intergenic
1030931277 7:115525599-115525621 CTGAACTGCCTATCATGATCTGG - Intergenic
1034162149 7:149001717-149001739 CTGAGGTCCCTCACAGGTCCAGG + Intergenic
1035238858 7:157517324-157517346 CTGAACTTCCTCACCTGCTCAGG + Intergenic
1037207373 8:16339413-16339435 CTGAACTCCTATATATGTTCAGG + Intronic
1038676958 8:29631554-29631576 CTGTCCTCACCCACATGTTCTGG - Intergenic
1044139032 8:88625414-88625436 CTTAATTCCCTTATATGTTCTGG + Intergenic
1045388732 8:101694375-101694397 CAGAAGTTCCTAACATGTTCTGG + Intronic
1050665112 9:7927072-7927094 CAGAAAACCCTCACATGGTCAGG + Intergenic
1050685794 9:8167831-8167853 CCCAACTCCCTCACTTATTCAGG + Intergenic
1050908636 9:11038397-11038419 CTGAAATCCCTAAAATGTTAAGG - Intergenic
1053438168 9:38091445-38091467 CTGGGCTGCCTCTCATGTTCAGG - Intergenic
1053677076 9:40442848-40442870 CTGAACTTCCACAAATGTTAGGG + Intergenic
1053926841 9:43068948-43068970 CTGAACTTCCACAAATGTTAGGG + Intergenic
1054286640 9:63182057-63182079 CTGAACTTCCACAAATGTTAGGG - Intergenic
1054290148 9:63278377-63278399 CTGAACTTCCACAAATGTTAGGG + Intergenic
1054388177 9:64582917-64582939 CTGAACTTCCACAAATGTTAGGG + Intergenic
1054507547 9:65933451-65933473 CTGAACTTCCACAAATGTTAGGG - Intergenic
1055641414 9:78321368-78321390 CTGAACTCACTTAGATTTTCAGG + Intronic
1058425611 9:104873336-104873358 CTGAACCCCCTCACCCATTCAGG - Intronic
1061596710 9:131635229-131635251 CTGAATTTCCTCAAATCTTCAGG + Intronic
1186148512 X:6649587-6649609 CTGGACTCCTTCACTTATTCTGG + Intergenic
1189387331 X:40548124-40548146 CTGAACTTGCTCACATGTTTGGG + Intergenic
1189742491 X:44134275-44134297 TTAAACTCCCTCACACTTTCTGG - Intergenic
1193159787 X:78215455-78215477 CATAACTCCCTCACTTGATCTGG - Intergenic
1197845729 X:130799948-130799970 CTGTGCTTCCTTACATGTTCTGG - Intronic
1198189795 X:134291139-134291161 CTGATCTCCCTGACACATTCTGG - Intergenic