ID: 1095342604

View in Genome Browser
Species Human (GRCh38)
Location 12:41109454-41109476
Sequence CTTAATGAGAAGTGGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095342604_1095342608 21 Left 1095342604 12:41109454-41109476 CCCTGCATCCACTTCTCATTAAG No data
Right 1095342608 12:41109498-41109520 CAGCTTTTGAGTATCACATTTGG No data
1095342604_1095342609 30 Left 1095342604 12:41109454-41109476 CCCTGCATCCACTTCTCATTAAG No data
Right 1095342609 12:41109507-41109529 AGTATCACATTTGGCACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095342604 Original CRISPR CTTAATGAGAAGTGGATGCA GGG (reversed) Intergenic
No off target data available for this crispr