ID: 1095345992

View in Genome Browser
Species Human (GRCh38)
Location 12:41149041-41149063
Sequence CAAAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095345992_1095345995 4 Left 1095345992 12:41149041-41149063 CCCATATCACTATCAGCATTTTG No data
Right 1095345995 12:41149068-41149090 AAACCTCTCAACAAGTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095345992 Original CRISPR CAAAATGCTGATAGTGATAT GGG (reversed) Intergenic