ID: 1095349246

View in Genome Browser
Species Human (GRCh38)
Location 12:41189100-41189122
Sequence CAGGGTAAGCAAAGGGGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 362}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095349231_1095349246 13 Left 1095349231 12:41189064-41189086 CCGCAACTTCGTCGGCGACCTCG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG 0: 1
1: 0
2: 0
3: 22
4: 362
1095349236_1095349246 -5 Left 1095349236 12:41189082-41189104 CCTCGGTGGCGGCCACCGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 132
Right 1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG 0: 1
1: 0
2: 0
3: 22
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095349246 Original CRISPR CAGGGTAAGCAAAGGGGGGT GGG Exonic
900213761 1:1470082-1470104 GAGAGTCAGCAAAGGGTGGTGGG - Exonic
900266579 1:1760187-1760209 GAGGGAAAGCAAACAGGGGTCGG + Intronic
900299730 1:1970583-1970605 CAGGGAGAGCCAAGGGGGTTCGG - Intronic
900721397 1:4178134-4178156 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
900752195 1:4405580-4405602 CAGGGCAAGGAAAGGTGAGTGGG + Intergenic
901098271 1:6700293-6700315 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
901952253 1:12758477-12758499 CAGAGGAAGACAAGGGGGGTGGG - Intronic
903793487 1:25910630-25910652 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
905248574 1:36631428-36631450 CAGAGAAAGCAAAGGGATGTAGG - Intergenic
905709580 1:40089828-40089850 GAGGGGAAGGAAATGGGGGTGGG - Intronic
906049249 1:42857030-42857052 CAGAGTCAGCAAAGGGAGATAGG - Intergenic
906817761 1:48896647-48896669 CAGGGGATGCAATGGGGAGTAGG + Intronic
907897346 1:58704118-58704140 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
908655004 1:66379303-66379325 CACGTAAAGCAAAGGGGAGTTGG - Intergenic
910842496 1:91573833-91573855 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
910848509 1:91627542-91627564 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
911158566 1:94659803-94659825 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
913214138 1:116606200-116606222 CAGGCTAAGCGCAGGGCGGTGGG + Intronic
913244867 1:116862692-116862714 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
915784017 1:158587528-158587550 CAGGGTAAGCAAAAGAGAGTGGG + Intergenic
916205959 1:162316627-162316649 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
916791472 1:168129131-168129153 CAGGGTAAGCAGAGAGGGAATGG + Intronic
916966083 1:169944628-169944650 GAGGGTAAGCAAAGGGGAAGAGG + Intronic
917095889 1:171398498-171398520 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
917749382 1:178040554-178040576 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
917750190 1:178045811-178045833 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
917925369 1:179785165-179785187 CAGGGTGAGGAATGGGGGGTGGG - Intronic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
919624855 1:199901481-199901503 CAGGGGAAGGCAAGGGGGTTGGG + Intergenic
920191046 1:204194085-204194107 CTGGGTGAGGAATGGGGGGTGGG - Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920907750 1:210187901-210187923 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
920908878 1:210195559-210195581 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
922845724 1:228682450-228682472 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
924323587 1:242873320-242873342 CAGGTAAAGAAAAGGTGGGTAGG + Intergenic
924697884 1:246419240-246419262 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1063419032 10:5896384-5896406 GAGGGTTAGCAAAGAGAGGTGGG + Intronic
1064642741 10:17430947-17430969 CAGGGAAAGGAAAGGGGTTTGGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1066334847 10:34465315-34465337 CAGGGAAAAAAAAGGGGGTTGGG + Intronic
1066437617 10:35408391-35408413 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1067098947 10:43320908-43320930 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1067228075 10:44388180-44388202 CAGGCCAGGCAGAGGGGGGTAGG - Intergenic
1067755565 10:49001877-49001899 CAGGGTAAGCTGAGGTGGGGTGG - Intergenic
1067938520 10:50632224-50632246 CATGGGAAGCAAAGTGGGGGTGG - Intergenic
1068015403 10:51510093-51510115 CAGTGAAAGGAAAGGGAGGTTGG - Intronic
1070108492 10:73459787-73459809 TAGGGTTAGCAAGGGGGGTTAGG + Intronic
1070430938 10:76336940-76336962 CAGATTAAAAAAAGGGGGGTGGG - Intronic
1071550287 10:86561335-86561357 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1071915887 10:90295297-90295319 AAGAGTCAGCAAAGGGAGGTAGG - Intergenic
1072529845 10:96308687-96308709 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1072885014 10:99265265-99265287 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1073014656 10:100388279-100388301 GAGAGTCAGCAAAGGGTGGTAGG - Intergenic
1073020874 10:100442679-100442701 TATGGTAAGCAAAGAGGGGAGGG - Intergenic
1073416870 10:103390887-103390909 AAGGGTGGGCAAATGGGGGTTGG + Intronic
1073897191 10:108176171-108176193 CAGGGAAAGAAGAGGTGGGTTGG + Intergenic
1074493693 10:113960381-113960403 AAGGGAAAGCCACGGGGGGTGGG + Intergenic
1076768566 10:132650972-132650994 CAGGGTGAGCACAGGGGGAGTGG + Intronic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1079700670 11:23541993-23542015 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1079835330 11:25326892-25326914 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1080895835 11:36448273-36448295 CATGGAGAGCAAATGGGGGTGGG - Intronic
1081008213 11:37774502-37774524 CGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1082263554 11:50096392-50096414 CAGGGTAAGGTAAGTGGGGAGGG - Intergenic
1082579082 11:54844492-54844514 CAGAGTCAGCAAAGGGAGATAGG + Intergenic
1082791574 11:57349602-57349624 CAGGGAAAGGAAAGAGGGGAGGG + Intronic
1082872903 11:57960184-57960206 CTGAGGAAGCAAAGGGAGGTGGG - Intergenic
1083158523 11:60840592-60840614 CAGGGCAAGCCAAGGGGGACTGG + Intergenic
1083700872 11:64476985-64477007 CAGCCTCAGCAGAGGGGGGTAGG - Intergenic
1083815336 11:65129695-65129717 CAGGGGAAGCAGAGTGGGTTTGG - Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1085262935 11:75218698-75218720 CAGGCTAAGGAAAGGAGGCTTGG - Intergenic
1085338863 11:75718403-75718425 CAGGGAAAGAAAAGAAGGGTGGG + Intronic
1086566615 11:88234062-88234084 AAGTGTAAGAAAAGGAGGGTAGG - Intergenic
1087168169 11:95024696-95024718 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1087195548 11:95301061-95301083 CAGGGTAAGGCAAGGTGGGAAGG + Intergenic
1087384066 11:97447104-97447126 GAGAGTAAGCAAAGGGAGATGGG - Intergenic
1087732335 11:101793029-101793051 CAGGGTAAGCACAGTGCAGTGGG + Intronic
1088050572 11:105509501-105509523 CAGGGTAGGAAAAGAAGGGTGGG - Intergenic
1088253182 11:107879249-107879271 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1089881160 11:121775109-121775131 CAGAGTAAGCAAAGCGGAGCTGG + Intergenic
1089905810 11:122037093-122037115 CAGAGGAAGCAAAGGTTGGTGGG - Intergenic
1089970961 11:122692956-122692978 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1089989332 11:122843872-122843894 CAGTCTAAGCAAAGCTGGGTGGG + Intronic
1091358716 11:134957829-134957851 CAGGGGAAACAAAGTGGTGTCGG - Intergenic
1091797155 12:3304013-3304035 CAGGGAGAGCAAAGAGGGGTTGG - Intergenic
1092458300 12:8664551-8664573 CAGGGGAAGAAAAGGGTGTTGGG + Intergenic
1093639622 12:21511298-21511320 TAGGGCAAGGAAAGGGGGGAGGG + Intronic
1093925879 12:24907825-24907847 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1094606995 12:31957763-31957785 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1098638941 12:72817101-72817123 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1099961009 12:89396941-89396963 TCGGGTAGGCAAAGGGGGCTAGG + Intergenic
1101384499 12:104244824-104244846 CAGGGAAAAGAAAGGGGTGTAGG + Intronic
1101387534 12:104271143-104271165 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1102467077 12:113136042-113136064 CATGGTAGGCAAGGAGGGGTGGG - Intronic
1102636883 12:114332437-114332459 CGGGGAATGCAAAGGGGGCTGGG - Intergenic
1103514511 12:121498624-121498646 CAAAGAAAACAAAGGGGGGTGGG - Intronic
1104962221 12:132493702-132493724 CAGGGTACACAAAGGGGGCGGGG - Intronic
1105033083 12:132898383-132898405 GAGGGTCAGCAAAGGGGAGATGG - Intronic
1105217354 13:18296751-18296773 CAGGCTAAGCGCAGGGCGGTGGG + Intergenic
1105719026 13:23095661-23095683 AAGGGTAAGAAAAGTTGGGTGGG + Intergenic
1106077684 13:26475384-26475406 CTGGGGAAGCAAGGGGGGGAGGG + Intergenic
1107542947 13:41410210-41410232 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1108478025 13:50840671-50840693 GAGGGTCAGCAAAGAGGGGGCGG + Intronic
1108817606 13:54311125-54311147 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1109045473 13:57405683-57405705 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1109911487 13:68917906-68917928 CAGGGTTAGGAAAGAGGGTTAGG - Intergenic
1112606402 13:100910759-100910781 CATAGTAAACAAAGGTGGGTGGG + Intergenic
1115569717 14:34655081-34655103 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117000285 14:51364939-51364961 GAGGGTCAGCAAAAGGTGGTGGG + Intergenic
1117049594 14:51847009-51847031 CATGGTAACCAGAGGGGGGGAGG + Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119264312 14:73255015-73255037 CAGGGTAAGGACAGGAGGGCAGG + Exonic
1119433906 14:74585708-74585730 CAGGGAAAGCCAAGGAGGGTGGG + Intronic
1119770761 14:77219467-77219489 CAGGAAAAGCAATGTGGGGTGGG - Intronic
1121366493 14:93316880-93316902 CAGAGTAAGCAAAGTGGGTCAGG + Intronic
1122161844 14:99790819-99790841 CAGGGAAAGGAAATGGGGGGAGG - Intronic
1122301848 14:100735865-100735887 CTGGGTGGGCAAAGAGGGGTGGG - Exonic
1122507372 14:102240204-102240226 CAGAGTCAGCAAAGGGAGATAGG - Intronic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1123876523 15:24629196-24629218 CAGGGTAGGGAGTGGGGGGTGGG - Intergenic
1124028279 15:25987020-25987042 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1125628886 15:41131698-41131720 GAGAGTCAGCAAAGGGGGGTGGG - Intergenic
1125957287 15:43799291-43799313 CAGGGTAAGTGAGAGGGGGTCGG - Exonic
1127365370 15:58284428-58284450 CTGGGTGAGCAAAGGTGAGTTGG + Intronic
1128370074 15:67033923-67033945 CAGGGTGTGCACAGGTGGGTGGG - Intergenic
1128600040 15:68988442-68988464 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1131164598 15:90133367-90133389 AAGAGTTAGCAAAGGGTGGTGGG - Intergenic
1131721234 15:95170832-95170854 CAGGGCAGACAAAGTGGGGTGGG + Intergenic
1132626408 16:893735-893757 CAGGGAAAGCAGACGGGTGTGGG - Intronic
1133002018 16:2856571-2856593 CAGGGTAAGGAAAGAGGGGGAGG - Intronic
1136381723 16:29899214-29899236 GAGACTGAGCAAAGGGGGGTGGG - Exonic
1136529693 16:30859759-30859781 CAGAATCAGCAAAGGGTGGTGGG - Intronic
1138002464 16:53296045-53296067 CAGAGTAAGCAAAGAGGGAGTGG - Intronic
1138444416 16:57054669-57054691 GAGGGTAAGGAAAGGGAGGGTGG - Intronic
1138976803 16:62217519-62217541 AGGGGTCAGCAAAGGGTGGTGGG + Intergenic
1139510563 16:67426046-67426068 TAGGGTAATCAGAGGGGAGTCGG + Intergenic
1140535129 16:75702970-75702992 GAGAGTGAGCAAAGGGTGGTGGG + Intronic
1140535502 16:75705604-75705626 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1141631328 16:85289643-85289665 TAGGGTAAGCAACGGGGTGGTGG + Intergenic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1142488596 17:262855-262877 CGGGGAAAGCAAAGTGGGGTCGG - Intronic
1143096850 17:4482852-4482874 CAGTGTAAGCAAAGGTGTGGAGG + Intronic
1145032896 17:19518708-19518730 GAGAGTCAGCAAAGGGCGGTGGG + Intronic
1145877110 17:28327319-28327341 GAGGGTGGGCAAAGGGGTGTGGG + Exonic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1146673258 17:34756467-34756489 CAGGCTCAGCACTGGGGGGTGGG - Intergenic
1146726325 17:35159336-35159358 CGGGGTAAGTAGAGAGGGGTAGG - Intronic
1146955655 17:36935195-36935217 CGGAGTCAGCAAAGGGGCGTTGG + Intergenic
1147320440 17:39642714-39642736 CAGGGTAAGGGATGGAGGGTGGG + Intronic
1147632861 17:41943439-41943461 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1149422164 17:56521481-56521503 CAGGGTGAGAGCAGGGGGGTGGG + Intergenic
1149583572 17:57768701-57768723 CAGGGGAAGGAGAGTGGGGTGGG + Intergenic
1150070746 17:62147829-62147851 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1150811790 17:68362509-68362531 CAGGGGAACCAAATGGGGTTTGG - Intronic
1150860406 17:68795550-68795572 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1150860743 17:68797701-68797723 GAGTGTCAGCAAAGGGTGGTGGG + Intergenic
1151705931 17:75767314-75767336 AAGAGTAAGCAAAGGGTGGTGGG + Intergenic
1152494017 17:80658089-80658111 CATGCAAAGTAAAGGGGGGTGGG - Intronic
1153264964 18:3261499-3261521 GAGGGTAAGCAGAGAGGAGTAGG + Intergenic
1153419340 18:4886489-4886511 GAGGGCGAGCCAAGGGGGGTGGG - Intergenic
1154014885 18:10607514-10607536 AAGGGAAAGCAAAGGGGCTTGGG + Intergenic
1154190607 18:12228064-12228086 AAGGGAAAGCAAAGGGGCTTGGG - Intergenic
1155961689 18:32000827-32000849 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1156915564 18:42462108-42462130 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1156916609 18:42469630-42469652 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1158343795 18:56494184-56494206 CACAGTGAGCAAAGAGGGGTGGG - Intergenic
1158622386 18:59044280-59044302 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1159365101 18:67455620-67455642 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1160662356 19:307037-307059 CAGGCTGAGCAGAGGAGGGTGGG - Intronic
1161042434 19:2117203-2117225 AAGGGTAAGGATACGGGGGTGGG - Exonic
1161148469 19:2694127-2694149 CTGGGTAAGCACAGGGGATTTGG + Intronic
1161711721 19:5852410-5852432 GAGAGTTAGCAAAGGGTGGTGGG - Intergenic
1161712566 19:5857534-5857556 GAGAGTTAGCAAAGGGTGGTGGG - Intergenic
1161840809 19:6679291-6679313 CAGGGGATACCAAGGGGGGTAGG - Intronic
1162660677 19:12166390-12166412 CAGGGAAAAGAAATGGGGGTGGG + Intronic
1163837788 19:19585860-19585882 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1165645799 19:37434897-37434919 AAGAGTCAGCAAAGGGTGGTGGG - Intronic
1166116696 19:40660285-40660307 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1166214640 19:41327457-41327479 CCGGGTCAGCAAGGGGGAGTGGG - Intronic
1166584580 19:43934548-43934570 CAGGGGAAGGAAAGGAGGCTGGG + Exonic
1166905060 19:46102295-46102317 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1166906067 19:46109180-46109202 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1168143242 19:54403557-54403579 CAGAGTCAGTAAAGGGTGGTGGG + Intergenic
1168165701 19:54545951-54545973 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
927957201 2:27216010-27216032 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
929384305 2:41385597-41385619 GAGAGTCAGCAAAGGGAGGTAGG - Intergenic
929858404 2:45654471-45654493 CATGACAAGCAAAGGTGGGTTGG + Intronic
930884983 2:56315041-56315063 CAGATGAAGCAAAGGGGGATGGG - Intronic
931141414 2:59462511-59462533 CATGGTGAGCAAGGGGTGGTGGG - Intergenic
931536806 2:63286548-63286570 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
932821150 2:74902027-74902049 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
933556234 2:83834477-83834499 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
933758289 2:85657735-85657757 AAGAGTCAGCAAAGGGTGGTGGG + Intronic
934296967 2:91749932-91749954 CAGGCTAAGCGCAGGGCGGTGGG - Intergenic
935918533 2:107985431-107985453 CAGTGTAAGAAAAGGGGAGATGG + Intergenic
937505292 2:122529814-122529836 CAAGGAAGGCAAAGGGGGGGTGG + Intergenic
938008946 2:127812967-127812989 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
939460247 2:142489773-142489795 CAGAGTCAGCAAAGGGAGATGGG + Intergenic
940002909 2:148984689-148984711 CTGGGAAAGCAAAGGGGACTGGG + Intronic
940907343 2:159180927-159180949 CAGCGTAAGTAAAGGGGCCTGGG + Intronic
942328477 2:174796164-174796186 CAAGGTATGGAAAGAGGGGTTGG + Intergenic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
943554257 2:189382687-189382709 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
943737993 2:191378359-191378381 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
944202224 2:197119954-197119976 CAGCATGAGCAAAGAGGGGTGGG - Intronic
945064586 2:205938107-205938129 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947821319 2:233073070-233073092 CAGGGTGAGTGAAGGGGGGATGG - Intronic
948384897 2:237575212-237575234 CAGGGTAAACACAGGAGGGGCGG - Intronic
948463341 2:238140646-238140668 CAGGGTCAGCCAAGTGGGGATGG - Intronic
1171210101 20:23310368-23310390 CAGGGTGAGGAAGTGGGGGTGGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173651712 20:44670572-44670594 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1173652640 20:44676655-44676677 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1174030630 20:47622704-47622726 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1175550050 20:59811640-59811662 CAGGGCAAAGACAGGGGGGTTGG + Intronic
1177063170 21:16397830-16397852 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1181001712 22:19990825-19990847 CAGAGTAAGCTCAGTGGGGTGGG + Intronic
1181478557 22:23182996-23183018 GAGGGTCAGCAAATGGGGCTGGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182737969 22:32544676-32544698 CAGGATAATCAAAGGGGCATTGG - Intronic
1183707531 22:39483653-39483675 CTGGGTGAGCAAAAGGGGCTAGG - Intronic
1183808725 22:40236273-40236295 CAGAGGATACAAAGGGGGGTAGG - Intronic
1183861004 22:40669963-40669985 CAAGGGAAGCAGAGAGGGGTGGG - Intergenic
1184033155 22:41906421-41906443 CAGGGTAGGCCCAGGGGGCTGGG + Exonic
1184167823 22:42740919-42740941 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1184541813 22:45130888-45130910 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1185173691 22:49307383-49307405 CAGGCTCAGCAGAGGGGGCTGGG + Intergenic
950230319 3:11270578-11270600 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
950936623 3:16845766-16845788 CAGGGTAAGCAATTTGGGGCCGG + Intronic
951049250 3:18076273-18076295 AAGGGTATGCATAGAGGGGTGGG - Intronic
951895151 3:27603044-27603066 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
952055469 3:29439750-29439772 CTGGGTAAGAAAAAGGGGGGAGG - Intronic
952231826 3:31439345-31439367 CAAGGTTAGCAAAGGGAGCTTGG - Intergenic
952296564 3:32067809-32067831 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
952297789 3:32076385-32076407 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
952859386 3:37800233-37800255 CTGGGTTAGCACAGGGGGCTGGG + Intronic
952883480 3:37999199-37999221 CAGGATGAGGAAAGGGGCGTGGG + Intronic
953621000 3:44532718-44532740 CAGCGAGAGCAAATGGGGGTAGG + Intergenic
953992900 3:47497680-47497702 TTTGGGAAGCAAAGGGGGGTGGG + Intronic
954050929 3:47976466-47976488 CAGGGTAAGGAAAGGCTGGAGGG - Intronic
954624632 3:52015876-52015898 CAGGGCTAGGAAAGGGGGCTGGG + Intergenic
955279193 3:57578117-57578139 CAGAGTAATAAAAGGGGGGTGGG + Intronic
955401602 3:58595625-58595647 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
956788302 3:72660969-72660991 CAGGGTACACACAGTGGGGTGGG + Intergenic
959400270 3:105892513-105892535 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
959427761 3:106214030-106214052 AAGGGTAACCAAAGTAGGGTGGG + Intergenic
960006256 3:112784119-112784141 GAGAGTTAGCAAAGGGTGGTGGG + Intronic
960309644 3:116105454-116105476 CAGAGTCAGCGAAGGGAGGTAGG + Intronic
961713032 3:128841692-128841714 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
961731602 3:128969234-128969256 GAGAGTCAGCAAAGGGTGGTGGG - Exonic
962386943 3:134939362-134939384 CATGGTAATGAATGGGGGGTGGG + Intronic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
963814473 3:149813780-149813802 CAGGGAAAGAAAAAGGGGGTGGG - Intronic
964741463 3:159970579-159970601 GAGGGTAAATAAAGGGTGGTAGG - Intergenic
965616392 3:170597231-170597253 CAGGTTGAGCTAAGGGGAGTTGG - Intronic
966540091 3:181079447-181079469 GAGAGTAAGCAAAGGGTGGTGGG - Intergenic
966540266 3:181081651-181081673 GAGAGTAAGCAAAGGGTGGTGGG - Intergenic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
968993078 4:3927738-3927760 GAGGGTCAGCAAAGGGAGATGGG - Intergenic
969245188 4:5927359-5927381 CAGGGGAAACAAAGGGGCTTGGG - Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970551214 4:17182991-17183013 CAGATTAAGCGAAAGGGGGTTGG - Intergenic
970819889 4:20199150-20199172 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
971047338 4:22819745-22819767 CAGTGTAAGCAAAGGTGGGGTGG + Intergenic
973707626 4:53595709-53595731 CAGGGAAATCTAAGGGGGGAAGG + Intronic
975089039 4:70378680-70378702 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
975152624 4:71037195-71037217 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
975755434 4:77567252-77567274 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
975945169 4:79696832-79696854 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
976225054 4:82789323-82789345 GAGGGGAAGCAAAGGGGAGGAGG + Intronic
976828320 4:89284654-89284676 CAGGGTGAGAAAAGGGAGCTAGG - Intronic
977230598 4:94448010-94448032 CAGGGAAAGAAAAGCTGGGTTGG - Intergenic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
977993452 4:103473798-103473820 TAGGGGAAGGAAAGGGAGGTGGG - Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
982094057 4:151905018-151905040 CAGGCTAAGCGAAGGGGGTTGGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
984273899 4:177584110-177584132 CAGGGAAAGCAAAGGCGAGAAGG - Intergenic
985186751 4:187325798-187325820 CTAGGTAAGCAGAGGTGGGTAGG - Intergenic
985190666 4:187369328-187369350 GAGGGTAAGGAAAAGGGGGTGGG + Intergenic
987755463 5:22094945-22094967 GAGGGTCAGCAAAGGGAGATAGG - Intronic
990242897 5:53833631-53833653 CAGGGTGAGGCAAGGTGGGTGGG + Intergenic
994083175 5:95731021-95731043 CAGAGCCAGGAAAGGGGGGTGGG - Intronic
998231981 5:140366802-140366824 CAGGGTAGGCAACGTGGGGTGGG - Intronic
998374833 5:141683276-141683298 CAGGGGAAGAAGAGGGGAGTGGG + Intergenic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
1001069473 5:168572412-168572434 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1001213407 5:169832457-169832479 CAGGGTAAACAAGGCAGGGTGGG - Intronic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001389764 5:171369433-171369455 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1002428438 5:179189278-179189300 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1002467685 5:179415996-179416018 CAGGGTCTGCAAAGAGAGGTGGG + Intergenic
1003150852 6:3547829-3547851 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1003619484 6:7685383-7685405 CAGTGTAAACCAAGGGTGGTTGG - Intergenic
1004806967 6:19212890-19212912 CAGAGTCAGCAAAGTGTGGTGGG - Intergenic
1006303972 6:33208148-33208170 CAGGGTACGCAGAGTGGGGGAGG + Intergenic
1006325639 6:33351684-33351706 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1006514746 6:34539566-34539588 CAGGGCAAGGAGAGGGGGTTGGG + Intronic
1006639956 6:35484772-35484794 CAGGGCATGCAAAGGTGGCTGGG + Intronic
1007867518 6:44989188-44989210 CAGTGTAACCAAAGGGTGATGGG - Intronic
1008219429 6:48837626-48837648 AGGGGTCAGCAAAGGGTGGTGGG - Intergenic
1008552247 6:52644411-52644433 CAGGGTAAGTGAAGAGGGGCTGG - Intergenic
1009052890 6:58299395-58299417 CAGGCTAGGGAAAGGGTGGTAGG + Intergenic
1009238220 6:61151191-61151213 CAGGCTAGGGAAAGGGTGGTGGG - Intergenic
1009604504 6:65849455-65849477 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1011327673 6:86168199-86168221 CTGGGGAAGCCAAGGCGGGTGGG + Intergenic
1013300943 6:108804448-108804470 CAAGATAAGTAAAGGGGTGTTGG + Intergenic
1013807521 6:114011870-114011892 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1013808396 6:114017810-114017832 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1014114615 6:117657841-117657863 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1016255893 6:142104888-142104910 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1016650692 6:146456133-146456155 GAGGGTCAGCAAAGGGAGATAGG + Intergenic
1016750970 6:147630633-147630655 GAGGGTCAGCAAAGGGAGATAGG - Intronic
1017133666 6:151129692-151129714 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1017178300 6:151525648-151525670 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1017921931 6:158880475-158880497 GAGAGTTAGCAAAGGGTGGTGGG + Intronic
1020793925 7:12660101-12660123 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1023753830 7:43397508-43397530 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1026490647 7:70860393-70860415 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1029000994 7:97154022-97154044 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1029428238 7:100511133-100511155 CAGAGTAAGTAAAGGAGGGTGGG + Intergenic
1029574015 7:101391087-101391109 CAGCGGAAGGAAAGGGGGATGGG + Intronic
1030199597 7:106889181-106889203 GAGAGTAAGCAGAGAGGGGTTGG - Intronic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031483618 7:122304950-122304972 CAGAGGAAGCAAAAGGGGGGTGG - Intronic
1033258785 7:139824240-139824262 CAGGGTAAGCAAAGCTCTGTGGG + Intronic
1037387840 8:18362370-18362392 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1037839352 8:22232684-22232706 AGGGGTAAGAAAATGGGGGTGGG + Intergenic
1037941079 8:22951477-22951499 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1040852570 8:51916289-51916311 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1040892638 8:52333578-52333600 CAGGGAAAGAAAACTGGGGTGGG + Intronic
1041005344 8:53492569-53492591 CAAGGGAAGCAACGGGAGGTAGG + Intergenic
1041610258 8:59838339-59838361 TAGGTTAAGGAAAGGGGGTTTGG - Intergenic
1041726835 8:61026018-61026040 CAGGGGGAGGGAAGGGGGGTGGG - Intergenic
1042310856 8:67378322-67378344 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1043511254 8:80952518-80952540 GAGGGTGAGCAAAGGAAGGTGGG + Intergenic
1047130939 8:122018710-122018732 GAGAGTCAGCAAAGGGTGGTAGG + Intergenic
1049550837 8:143258543-143258565 CAGGGTAAGTAACGGTGGCTGGG - Intronic
1050311897 9:4361743-4361765 CAAGGTAAGGAAAGGTGGTTAGG - Intergenic
1051082264 9:13307387-13307409 CAGGGAAATCAAAGAGGGGAGGG - Intergenic
1051273786 9:15379900-15379922 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1051470991 9:17441867-17441889 AAGGGTAAGCAAAGGAGAGAAGG + Intronic
1053060230 9:35024768-35024790 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1056510599 9:87301405-87301427 AAGGGATAGCAAAGTGGGGTGGG - Intergenic
1056636070 9:88332347-88332369 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1059520193 9:114933658-114933680 CCGGGCAAGCAGAGGGGGTTGGG - Intergenic
1060691567 9:125665551-125665573 AAGAGTCAGCAAAGGGTGGTGGG - Intronic
1061119287 9:128633351-128633373 CAGGGCAAGCAGCGAGGGGTGGG - Exonic
1061314572 9:129786856-129786878 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1062019948 9:134314608-134314630 CAGGGTATGCCAAGACGGGTTGG - Intergenic
1062394526 9:136347412-136347434 AAGGGTGGGCATAGGGGGGTGGG + Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1203770113 EBV:45548-45570 GAGGGTAAGAAAAGTGGGGGTGG + Intergenic
1185529542 X:806614-806636 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1187278160 X:17834754-17834776 CAGGGTAAGAGAAGAGAGGTGGG + Intronic
1187619469 X:21034658-21034680 CAGGGTGAAAAAATGGGGGTGGG - Intergenic
1188085287 X:25895507-25895529 CAGGGAAAGGAAAGGGGAGAAGG + Intergenic
1189319435 X:40078821-40078843 CAGAGGAGGTAAAGGGGGGTGGG - Intronic
1189354243 X:40299159-40299181 CAGGGCTGGCAAAGTGGGGTGGG - Intergenic
1189870738 X:45380789-45380811 CAGGGGACGCAAAGGAGGGAGGG - Intergenic
1194180565 X:90706368-90706390 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1194470612 X:94290756-94290778 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1194535622 X:95103204-95103226 CAGGGTGAGCAATGGGGGCATGG + Intergenic
1195329593 X:103786229-103786251 CAGGGTAAGCAAGGTGTGGCGGG + Intronic
1198653910 X:138892946-138892968 GGGAGGAAGCAAAGGGGGGTGGG + Intronic
1199386737 X:147231823-147231845 AAGGGAAGGGAAAGGGGGGTTGG + Intergenic
1199739027 X:150715150-150715172 CAGGGTCACCAAAGGAGAGTGGG - Intronic
1200527227 Y:4288528-4288550 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1202162641 Y:21951708-21951730 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1202228715 Y:22634660-22634682 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1202314441 Y:23561507-23561529 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1202556361 Y:26109088-26109110 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic