ID: 1095351584

View in Genome Browser
Species Human (GRCh38)
Location 12:41220274-41220296
Sequence CTGAAGACACAGCAAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1446
Summary {0: 1, 1: 0, 2: 56, 3: 332, 4: 1057}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095351584 Original CRISPR CTGAAGACACAGCAAGAGGG TGG (reversed) Intronic
900161437 1:1225907-1225929 CTGAAGACACGGCTGCAGGGCGG + Intronic
900434257 1:2620699-2620721 ATGAGGACACAGCAAGAAGGTGG + Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901218097 1:7565895-7565917 GTGAGGACACAGCGAGAAGGCGG - Intronic
901527914 1:9835685-9835707 CTGAAGGGGCAGCAGGAGGGAGG + Intergenic
902183186 1:14705148-14705170 GGGAAGAGGCAGCAAGAGGGAGG - Intronic
902381590 1:16055405-16055427 GTGGAGAGACAGCCAGAGGGAGG - Intronic
902637862 1:17746855-17746877 GTGAGGGCACAGCAAGAAGGTGG - Intergenic
902651233 1:17838933-17838955 CTAAGGACACAGCAAATGGGTGG + Intergenic
902660891 1:17902759-17902781 GTGAAGACACAGCAAGAAGGTGG + Intergenic
903067368 1:20708114-20708136 CTGAGGACAGATCAGGAGGGAGG - Intronic
903424581 1:23244424-23244446 GTGGAGTCACAGCAAGTGGGAGG + Intergenic
903479163 1:23640437-23640459 GTGAGGACCCAGCAAGAGGGTGG + Exonic
903553159 1:24172862-24172884 GTGAGGACACAGCAAGATGACGG - Intronic
903656009 1:24949236-24949258 CTGAAGAAACAGCAAAAAGGAGG + Intronic
903740442 1:25555652-25555674 TTAGAGACAAAGCAAGAGGGTGG - Intronic
903855239 1:26333622-26333644 ATGAGAACACAGCAAGAAGGTGG + Intronic
903882123 1:26517817-26517839 GTGAGCACACAGCAAGATGGTGG - Intergenic
904026432 1:27506599-27506621 CTGAAGTCACAGCAAGTTGGAGG + Intergenic
904051331 1:27641020-27641042 GTGAGCACACAGCAAGATGGTGG + Intergenic
904273979 1:29368423-29368445 GTGAGGACATAGCAAGAAGGCGG - Intergenic
904291749 1:29490666-29490688 CTGATCACACAGCAAGAAAGAGG + Intergenic
904378949 1:30098426-30098448 GTGAAGACACAGCAAGACGATGG - Intergenic
904432030 1:30470453-30470475 CAGAAGACACATCAGGAGAGGGG - Intergenic
904445490 1:30570342-30570364 CAGAAGCCACTGCAGGAGGGTGG + Intergenic
904544146 1:31255216-31255238 CTGATGTCCCAGGAAGAGGGAGG - Intergenic
904789267 1:33006344-33006366 CTGAGGGCACAGCACAAGGGAGG - Intergenic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905343999 1:37299167-37299189 CTGAAGACAGAACAGGAGGGAGG - Intergenic
905955017 1:41985463-41985485 GTGAAGACACAGCAAGAAGGTGG - Intronic
906012043 1:42536846-42536868 GTGAGGACACAGCAAGAAGGTGG - Intronic
906532928 1:46533653-46533675 GTGGGCACACAGCAAGAGGGCGG + Intergenic
906541664 1:46591540-46591562 CTGAAGAAAGAGCAAGCAGGAGG + Intronic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906674082 1:47680756-47680778 CTGAAGACACAGGGAGAAGACGG - Intergenic
906811802 1:48834591-48834613 CTGAGGACACAGCAAGAAGGAGG + Intronic
907026992 1:51129749-51129771 CTGAAAACACAGCAAGAAAAAGG - Intronic
907175517 1:52518415-52518437 GTGAACACACAGCAAGAAGGTGG - Intronic
907289590 1:53404667-53404689 GTGAGGACACAGCAAGAAGGTGG - Intergenic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
907634165 1:56116832-56116854 GTGAAGAAACAGCAGGAAGGGGG + Intergenic
907657302 1:56357294-56357316 GTGAGGACACAGTGAGAGGGTGG - Intergenic
907783859 1:57592830-57592852 GTGAGGACACAGCGAGAAGGTGG - Intronic
907867904 1:58416714-58416736 GTGAGAACACAGCAAGAAGGTGG - Intronic
907944922 1:59127115-59127137 CTGAAGACACAGAAAGGTGTGGG + Intergenic
908053879 1:60261847-60261869 GTGAAGACACAGCAAGAAGATGG - Intergenic
908125329 1:61024692-61024714 GTGAAGACATAGCAAGAAGAAGG - Intronic
908271752 1:62429272-62429294 GTGAGGACACAGCAAAAAGGTGG + Intergenic
908331726 1:63077397-63077419 GTGAAGACACAGCAAGAAGGTGG + Intergenic
908454660 1:64291452-64291474 GTGAGGATACAGCAAGAAGGTGG - Intergenic
908530596 1:65030162-65030184 GTGAGGGCACAGCAAGAAGGTGG + Intergenic
908595895 1:65688407-65688429 CTGCAGACACAGCAGGCAGGCGG + Intergenic
908632660 1:66126984-66127006 CGAAAGACAAAGAAAGAGGGGGG + Intronic
908838215 1:68249995-68250017 GTGAAGAGACAGCAAGAGGGTGG - Intergenic
909033926 1:70574855-70574877 CTGAAGAGACATCAAGAAGCTGG - Intergenic
909141889 1:71877443-71877465 GTGAAGACAGAGGAAGAAGGTGG - Intronic
909253562 1:73389463-73389485 GTGAAGACACACCAAGAAGGAGG - Intergenic
909583814 1:77266829-77266851 CAGAAGAAACAGCAAGTGAGAGG + Intergenic
909593372 1:77377416-77377438 CTGAAGAGACATCAAGAGGTTGG - Intronic
909714375 1:78690349-78690371 GTGACCACACAGCAAGAAGGAGG + Intergenic
909858436 1:80572281-80572303 GTGAGGACACAGCAAGAAAGTGG - Intergenic
910063613 1:83124500-83124522 GTGAAGTCACAACAAGAAGGTGG - Intergenic
910123525 1:83816055-83816077 TAGAAAACACAGCAACAGGGCGG - Intergenic
910286276 1:85557826-85557848 CTGAAGACACAAACAGAAGGTGG + Intronic
910793729 1:91076595-91076617 GTGAGCACACAGCAAGATGGTGG + Intergenic
911168052 1:94742695-94742717 GTGATGACACACCAAGAAGGTGG - Intergenic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
911730232 1:101284761-101284783 GTGAAGACACAGCAAGGAGGTGG + Intergenic
912112870 1:106364468-106364490 CTGAAGACAGAGGAAGACAGTGG - Intergenic
912131542 1:106608290-106608312 GTGAAGACACAGCAAGAAGGTGG - Intergenic
912405093 1:109430973-109430995 GTGAAGACACAACAAGAAGGTGG + Intergenic
913454300 1:119015380-119015402 GTGAGGACATGGCAAGAGGGTGG - Intergenic
914521459 1:148420424-148420446 CAGAAGACACAGGAAGGGAGAGG + Intergenic
915507007 1:156364171-156364193 GTGAGGACACAGCAAGAAGGTGG - Intronic
916204418 1:162301361-162301383 GGGAAGACACAGCTAGAAGGTGG + Intronic
916727542 1:167536120-167536142 GTGAGGAAACAGCAAGAAGGCGG + Intronic
917141157 1:171837569-171837591 GTGAGGACACAGCAGGAAGGTGG - Intergenic
917265342 1:173215163-173215185 GTGAGGACACAGCAAGAAGGTGG + Intergenic
917265908 1:173220680-173220702 GTGAGGATACAGCAAGAAGGTGG + Intergenic
917791697 1:178503231-178503253 CTGAAGTCACAGCTAAATGGGGG - Intergenic
917991581 1:180385677-180385699 GTGAGGACCCAGCAAGATGGTGG + Intronic
918074970 1:181163217-181163239 TTGAGGATACAGCAAGAAGGTGG - Intergenic
918130393 1:181622513-181622535 GGGAGGACACAGCAAGAAGGGGG - Intronic
918374795 1:183898179-183898201 CGGAAGAGACTGCAAGAGGGAGG - Intronic
918394046 1:184095712-184095734 ATGAGGACACAGCAAGAAGGTGG + Intergenic
918699303 1:187587631-187587653 ATGAAGACACAGTGAGAAGGTGG - Intergenic
918743339 1:188165498-188165520 ATGAAGACACAGCAAGAAGGTGG - Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919046350 1:192457519-192457541 CTGAGGACACAGCAAGAAGGTGG - Intergenic
919590022 1:199490157-199490179 GTGAAGACACAGCGAGAAGATGG - Intergenic
919657126 1:200208163-200208185 GTGAAGAAGCAGCAAGAAGGCGG + Intergenic
920156140 1:203953242-203953264 GTGAGGACACAGCAAGAAGTTGG - Intergenic
920164598 1:204026600-204026622 CTGGAGACAAAGGCAGAGGGAGG + Intergenic
921123291 1:212155239-212155261 GTGAAGACACAGCAAGAAGGTGG + Intergenic
921180153 1:212625677-212625699 CTGAGGAGCCAGCAACAGGGGGG + Exonic
921231315 1:213074972-213074994 CTGAAGTCCCAGCACTAGGGAGG - Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921686471 1:218094767-218094789 GTGAGGACACAACAAGAAGGTGG + Intergenic
921801464 1:219407873-219407895 GTGAGGACACAGCAAGAAGTTGG - Intergenic
921968576 1:221119898-221119920 CTGAAGACACAGGGAGAAGATGG + Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922433207 1:225576729-225576751 ATGAAGAGGCAGCAAGAGGGCGG + Intronic
922614168 1:226951351-226951373 CTGAAGCGACAGGAGGAGGGAGG + Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923606414 1:235447332-235447354 CTGGAGATACAGCAATAGTGTGG - Intronic
923899713 1:238312383-238312405 GTGAGGACACAGCGAGAAGGTGG - Intergenic
923929176 1:238674101-238674123 TTGAAGAGACAGCCAGAAGGTGG + Intergenic
924144154 1:241056681-241056703 CTGAACACAAAGCCAAAGGGAGG - Intronic
924797644 1:247303834-247303856 CTGGAGAGACACCAAGAGTGTGG + Intronic
924808174 1:247378358-247378380 GTGAGGACACAGCAAGAGGGTGG + Intergenic
924887967 1:248240566-248240588 CTGAAGGCAGAGCAAGATGATGG + Intergenic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1063252795 10:4292524-4292546 GTGAGGACACAGCTAGAAGGTGG - Intergenic
1063542586 10:6949427-6949449 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1063637648 10:7799039-7799061 CTGAGGACACACCAATAAGGAGG - Exonic
1063752047 10:8960793-8960815 GTGAGGACACAGTAAGAAGGTGG - Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1063860671 10:10304415-10304437 GTGAAGACAAAGCAAGCAGGTGG + Intergenic
1063998079 10:11640067-11640089 ATGAGGACAGAGCAAGAAGGCGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064074800 10:12260122-12260144 TCCAGGACACAGCAAGAGGGTGG + Intergenic
1064141394 10:12793627-12793649 GTGAGGACACAGCAAGAAGGTGG - Intronic
1064277742 10:13922070-13922092 CTGAGGACACAGCAAGAAGGTGG + Intronic
1064350421 10:14571114-14571136 GTGAGGACACAGCCAGAAGGTGG - Intronic
1064358484 10:14641574-14641596 GTGAGAACACAGCAAGAAGGTGG - Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064856458 10:19773746-19773768 ATGAGGACACAGCAAGAAGAAGG - Intronic
1065123872 10:22554530-22554552 GTGCAGAAACAGCCAGAGGGTGG + Intronic
1065171508 10:23035135-23035157 TTGAGGATACAGCAAGAAGGTGG - Intronic
1065516092 10:26525771-26525793 CTGAAGAAACAGGAAGAAGTGGG + Intronic
1065547560 10:26837282-26837304 GTGAGGACACAGCGAGAAGGTGG - Intronic
1066057493 10:31695573-31695595 GTGAGGACACAGCAAGAAGGCGG - Intergenic
1066214277 10:33270759-33270781 CTGAAGACACAACAGGAGGAGGG + Exonic
1066262592 10:33743807-33743829 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1066664956 10:37773659-37773681 GTGAAGAGACAGTAAGAGGATGG - Intergenic
1067089000 10:43257182-43257204 CAGAGGTCACAGCAAGAGGGAGG + Intronic
1067128135 10:43537709-43537731 GTGAGGACATAGCAAGAAGGTGG - Intergenic
1067200398 10:44166259-44166281 GTGAGGACACAGCAAGAAGTTGG + Intergenic
1067248120 10:44563432-44563454 GGGAAGACACAGCAAGAAGGTGG - Intergenic
1067554956 10:47262409-47262431 CTGAAGACCCAGTGAGAAGGCGG + Intergenic
1067769104 10:49110726-49110748 GTGAAGACACAGGGAGAAGGTGG + Intronic
1068033608 10:51732991-51733013 TTGAGGACACAGCCAAAGGGTGG - Intronic
1068390689 10:56392375-56392397 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1068399813 10:56513666-56513688 CTGCAGACACAGCATGTAGGTGG + Intergenic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068959040 10:62848107-62848129 GTGAGGACACAGCAAGAAGGTGG + Intronic
1069096645 10:64267386-64267408 GTGAGGACCCAGCAAGAAGGCGG + Intergenic
1069213004 10:65785149-65785171 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1069696926 10:70393419-70393441 GTGAGGACACAGAAAGAAGGTGG - Intergenic
1069837883 10:71320501-71320523 GTGAAGGCACAGCAAGAAGGAGG - Intronic
1069862119 10:71478294-71478316 CTCCAGGCACAGCAGGAGGGAGG - Intronic
1069938192 10:71934057-71934079 GTGAGAACACAGCAAGAAGGTGG - Intergenic
1069963365 10:72092495-72092517 ACGAAGACACAGCAAGAAGGCGG - Intergenic
1069970965 10:72168782-72168804 ATGAGGACACAGCAAGCAGGTGG + Intronic
1070516864 10:77215936-77215958 GTGAGGACACAGCAAGAAGGTGG + Intronic
1070643272 10:78184176-78184198 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1071096431 10:81980815-81980837 GTGAGGACACAGCAAGAAGGTGG - Intronic
1071159108 10:82726053-82726075 GTGAGGACTCAGCAAGAAGGTGG + Intronic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071293945 10:84205932-84205954 GGGAAGACAAAGCTAGAGGGAGG - Intronic
1071411294 10:85399545-85399567 GTGAGGACATAGCAAGAAGGTGG + Intergenic
1071415894 10:85441126-85441148 GTGAAGACACAGGGAGAAGGTGG + Intergenic
1071739393 10:88339850-88339872 GTACTGACACAGCAAGAGGGAGG + Intronic
1071884133 10:89931018-89931040 GTGAGGACACAGCAAGAAGATGG + Intergenic
1072027539 10:91476525-91476547 GGGCAGACAGAGCAAGAGGGAGG + Intronic
1072217294 10:93298119-93298141 GTTAAGACACAGCAAGAAGATGG - Intergenic
1072528350 10:96294872-96294894 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1072690489 10:97569722-97569744 GTGAGGACACAGCAAGAAGACGG - Intronic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1073703804 10:105959640-105959662 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1073713314 10:106071304-106071326 GTGAACACACAGCAAGACGGTGG - Intergenic
1073787752 10:106908884-106908906 CTGAAGAAACAGAAATTGGGTGG - Intronic
1074197139 10:111199432-111199454 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1074236864 10:111593501-111593523 GTGAAGACACAGTGAGAAGGTGG + Intergenic
1074717808 10:116235833-116235855 GTGAGCACACAGCAAGATGGTGG + Intronic
1074983457 10:118637911-118637933 GTGAACACAGAGCAAGAAGGTGG + Intergenic
1075241612 10:120784430-120784452 GTGAGGACACAGCAAAAAGGCGG + Intergenic
1075378882 10:122002129-122002151 ATGAGGATACAGCAAGAAGGTGG - Intronic
1075455689 10:122583403-122583425 AGGAAGAGAGAGCAAGAGGGAGG + Intronic
1075457812 10:122596106-122596128 AGGAAGAGAGAGCAAGAGGGAGG + Intronic
1075546199 10:123356709-123356731 ATGAAGACAAAGCAAGTGGGAGG - Intergenic
1075832956 10:125427148-125427170 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1075908804 10:126105857-126105879 CTGAAAACACATCAACAGGCAGG + Intronic
1076328137 10:129644441-129644463 AAGAGGACACAGCAAGAGGCTGG + Intronic
1076400454 10:130180714-130180736 CTGAAGAGACAGCAGCAGTGTGG - Exonic
1077025740 11:439115-439137 GTGCAGACACAGGAAGAAGGTGG + Intronic
1077446966 11:2599698-2599720 GTGATGACACAGGAAGAAGGCGG - Intronic
1077522811 11:3046332-3046354 TCCAAGACACAGCCAGAGGGGGG - Intronic
1077730588 11:4725080-4725102 CTGAAGAAGGAGCAAGGGGGAGG - Intronic
1078409727 11:11104380-11104402 ATGAGGACACAGCAAGAAGATGG + Intergenic
1078435770 11:11324065-11324087 GTGAGGACACAGCAAGAAGGTGG + Intronic
1078799306 11:14627024-14627046 ATGAAGACACAGCAAGAAGGGGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079301451 11:19282802-19282824 GTGAGGACACAGTAAGAAGGTGG - Intergenic
1079413607 11:20212403-20212425 GTGAGGACACAGCAAGAAGGCGG + Intergenic
1079458796 11:20661447-20661469 ATGAGGACACAGCAAGGGTGTGG - Intergenic
1079482428 11:20895438-20895460 TTGAATACACAGCTAGAGAGTGG - Intronic
1079506957 11:21163720-21163742 CTGAGGACACAGAAAAAGGCAGG - Intronic
1079592905 11:22202612-22202634 GTGAAGACACAGTAAGAAGATGG - Intronic
1079665631 11:23101830-23101852 GTGAGGACTCAGCAAGAAGGTGG - Intergenic
1080107058 11:28521801-28521823 CTAGAGAGACAGCAAGAGTGGGG - Intergenic
1080113837 11:28599712-28599734 CTGAAGCCACAGCATGTTGGTGG + Intergenic
1080252140 11:30245448-30245470 GTGAAGACACAGAGAGAAGGTGG - Intergenic
1080354433 11:31425546-31425568 ATGAAGGCACAGCAAGAAGGAGG - Intronic
1080797232 11:35576049-35576071 GTGAAGACACAGCGAGAAGATGG - Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1081907694 11:46679915-46679937 CTGATCACAGAGGAAGAGGGAGG - Intronic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1082820009 11:57538348-57538370 CAGAAGAAACAGGAAGAGAGAGG + Intergenic
1082874781 11:57977336-57977358 GTGAGGACACAGCAAGAAGCTGG + Intergenic
1083859492 11:65412258-65412280 CTGAAGACCCAGACACAGGGAGG - Exonic
1084510212 11:69598584-69598606 GCAAAGACACAGCAAGAAGGCGG + Intergenic
1084600513 11:70142803-70142825 CTGAGGACACAGGGAGAAGGTGG - Intronic
1084699728 11:70778610-70778632 GTGAGGACACAGCGAGAAGGCGG + Intronic
1084736861 11:71110988-71111010 GTGAAGACACAGCAAGACAATGG + Intronic
1084848249 11:71917820-71917842 CTGAAGACAAAGGAATACGGTGG + Intronic
1084909067 11:72373015-72373037 CTGAAGACACAGAGATGGGGAGG + Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1086648151 11:89250651-89250673 ATGAAGACATAGCAAGAAGATGG - Intronic
1087002874 11:93439041-93439063 GTGAAGATACATCAAGAAGGTGG - Intergenic
1087210720 11:95444060-95444082 GTGAGGACATAGCTAGAGGGGGG - Intergenic
1087612297 11:100448915-100448937 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1087889989 11:103527169-103527191 TTGAGGACACAGCAAGAAGATGG - Intergenic
1088839446 11:113611598-113611620 GTGAGGACACAGCAAGAGGGAGG - Intergenic
1089308958 11:117545298-117545320 GTGAGGACACAGCGAGAAGGTGG + Intronic
1089487478 11:118858254-118858276 ATGAAGACACAGCGAGAAGGTGG - Intergenic
1089576439 11:119447698-119447720 CTGAGGACCCAGCATGTGGGAGG - Intergenic
1090053359 11:123400590-123400612 ATGAGGACACAGCAAGAAGATGG - Intergenic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1090543097 11:127730630-127730652 GTGAAGACACAGCGAGAGGGTGG - Intergenic
1090593273 11:128294176-128294198 ATGAAGACAGAGCAAGGGGCAGG - Intergenic
1090601691 11:128379027-128379049 GTGAGGACATAGCAAGAAGGTGG - Intergenic
1090822891 11:130360790-130360812 CTGAAAACACAGTAAAAGGATGG - Intergenic
1091311004 11:134575140-134575162 CTGAGGACACAGCGAGAAGACGG + Intergenic
1091983680 12:4888530-4888552 GTGAGGATACAGCAAGAAGGGGG + Intergenic
1092043243 12:5404234-5404256 GTGAGGACACAGCGAGAAGGAGG - Intergenic
1092069265 12:5619519-5619541 CTGGATACACAGCTAGATGGGGG + Intronic
1092347505 12:7728096-7728118 GTGAAGACACAGCAAGAGTGTGG - Intergenic
1093052558 12:14519682-14519704 GTGAGGACACAGTGAGAGGGTGG + Intronic
1093105750 12:15084889-15084911 TTGAAGACACAGTAAGAAGGCGG - Intergenic
1093983564 12:25501944-25501966 CTGAAGATACCACCAGAGGGGGG + Intronic
1094080847 12:26533695-26533717 ATGAAGACACAAGGAGAGGGTGG + Intronic
1094320632 12:29179010-29179032 CTGAAGACACAGGAAAAAGATGG - Intronic
1094341591 12:29417943-29417965 TTGAAAAGACAGCAAAAGGGAGG + Intronic
1094399221 12:30043461-30043483 CTGAGGACACAGCAAGAAAGCGG + Intergenic
1094438218 12:30445288-30445310 GTGAAGAGGCAGCAAGAGGGTGG + Intergenic
1095049981 12:37546520-37546542 GGGCAGACAGAGCAAGAGGGAGG - Intergenic
1095350614 12:41206581-41206603 TTGAAGGCACAGCAAAAGGCAGG - Intronic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095670084 12:44848460-44848482 CAGAACACACAGCAACAGGTGGG + Intronic
1095797739 12:46238734-46238756 CTGAGGACACAGCTAGTGGCTGG + Intronic
1096407836 12:51356905-51356927 CTGAAAACAGAGCCAGAGTGGGG - Intronic
1096585051 12:52614540-52614562 CAGAAGACAGAGCCAGAGGTGGG + Intronic
1096735387 12:53649306-53649328 CAGAAGACTCAGCAAGAGGCTGG + Intronic
1096893384 12:54794834-54794856 GTGAAGACACAGGAAGAAGGTGG + Intergenic
1097247957 12:57616982-57617004 CTCCAGACACACCAAGAAGGAGG - Exonic
1097324405 12:58259593-58259615 GTGAGCACACAGCAAGATGGTGG - Intergenic
1097680561 12:62645269-62645291 CTGAGAACACAGTAAGAGGAGGG + Exonic
1097791186 12:63817385-63817407 GGGAAGGCACAGCAAGATGGTGG + Intergenic
1097958745 12:65512292-65512314 CAGAATACACAGGGAGAGGGAGG - Intergenic
1098008150 12:66021010-66021032 GGGAAAACACAGCGAGAGGGTGG + Intergenic
1098606104 12:72392056-72392078 GTGAGGACAAAGCAAGAGGATGG + Intronic
1098918292 12:76279481-76279503 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1099442128 12:82711938-82711960 CAGAAGAAACAACAAGAAGGAGG - Intronic
1099710247 12:86214595-86214617 GTGAGGACACAGCAAGAGGCTGG - Intronic
1099918354 12:88924677-88924699 GGGAGGACACAGCAAGAAGGTGG + Intergenic
1099987624 12:89685880-89685902 ATGAGGACACAGCAAGAAGAAGG + Intronic
1100095845 12:91035255-91035277 GTGAGGACACAGCAAGAAGATGG - Intergenic
1100114111 12:91281896-91281918 TTGAAGACACAGCGAGAAGGTGG - Intergenic
1100303408 12:93328330-93328352 GTGAGGACACAGCCAGATGGTGG + Intergenic
1100432484 12:94543049-94543071 GTGAGGCCACAGCAAGAAGGTGG + Intergenic
1100518187 12:95348345-95348367 GTGAGGACACAGCAATAAGGTGG + Intergenic
1100593616 12:96052641-96052663 GTGAAGATACAGCAAGAAGGTGG + Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1100959468 12:99946415-99946437 GTGAGGACACAGCGAGAAGGTGG - Intronic
1101012525 12:100465916-100465938 GTGAAGACACAGCAAGAAGTTGG - Intergenic
1101071491 12:101080591-101080613 CTGAAGACACAGGGAGAAGATGG - Intronic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101288425 12:103340815-103340837 CTGAAGACACAGCAATAGGCTGG + Intronic
1101296847 12:103432797-103432819 GTGAGGGCACAGCAAGAAGGTGG + Intronic
1101359498 12:104012899-104012921 GTGAGGACACAGCAAGAAGGCGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101579049 12:106025333-106025355 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1102193813 12:111009613-111009635 CTCAGGACAAAGCAAGATGGTGG - Intergenic
1103014222 12:117481471-117481493 ATGAGGACACAGTAAGAAGGTGG + Intronic
1103038738 12:117677408-117677430 GTAAGGACACAGCAAGAGGACGG + Intronic
1103064813 12:117888617-117888639 GTGAGGACACAGAAAGAAGGTGG + Intronic
1103074761 12:117973134-117973156 GTGAGGACACAACAAGAAGGTGG - Intergenic
1103185261 12:118951319-118951341 CAGTAGACAGAGCATGAGGGTGG - Intergenic
1103269858 12:119664322-119664344 GTGATGACAAAGCAAGAAGGCGG - Intergenic
1104022966 12:125006012-125006034 TCGAAGACACAGGGAGAGGGCGG - Intronic
1104027234 12:125036855-125036877 GTGAAGACACAACAAGAAGGTGG + Intergenic
1104285926 12:127424657-127424679 GTGAGGACACAGCAAGATGGCGG + Intergenic
1104364301 12:128163195-128163217 CAGTAGTCACAGGAAGAGGGGGG - Intergenic
1104574409 12:129953769-129953791 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1104918504 12:132278597-132278619 CTGGAGACACAACCAGACGGCGG - Intronic
1105031139 12:132884686-132884708 GTGAGGACACAGCAAGAAAGTGG + Intronic
1105264960 13:18807880-18807902 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1105386317 13:19932708-19932730 GTGAAGATCCAGCAAGAAGGTGG + Intergenic
1105443926 13:20436563-20436585 CTGAAGGCCCAGGAAGAGGCTGG - Intronic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1106047752 13:26160820-26160842 ATGAGGACAAAGCAAGAAGGAGG - Intronic
1106065370 13:26342949-26342971 CTGATGAGACAGGAAGAAGGAGG - Intronic
1106078536 13:26481796-26481818 GTGAGGACACAGCGAGAAGGCGG - Intergenic
1106309760 13:28543800-28543822 GTAAGGACACAGCAAGAAGGTGG + Intergenic
1106549851 13:30761730-30761752 GTGAAGACACAGGTAGAAGGTGG - Intronic
1106556828 13:30817008-30817030 ATTTAGACACACCAAGAGGGAGG + Intergenic
1106636430 13:31533578-31533600 CAGAGGGCACAGCAAGAAGGTGG - Intergenic
1106797882 13:33226056-33226078 GTGAGGGCACAGCAAGAAGGCGG + Intronic
1106820254 13:33456585-33456607 GTGAGGACACAGCAAAAAGGTGG - Intergenic
1107011071 13:35671789-35671811 TTGAAGACACAGCAGAAAGGGGG + Exonic
1107153495 13:37139776-37139798 GTGAGGACACAGCAAGACAGTGG - Intergenic
1107410549 13:40154079-40154101 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107557837 13:41533380-41533402 CTGAAGCCGCAGTGAGAGGGAGG + Intergenic
1107723720 13:43276481-43276503 CTGAAGACACAGTAAGCTGTGGG - Intronic
1107809441 13:44186203-44186225 GTGAAGACACAGCAAAAAGGTGG - Intergenic
1108494583 13:51011750-51011772 GTGAGGACACAGCAAAAAGGTGG - Intergenic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1108748450 13:53420448-53420470 GTGAAGACACAGCAAGAATGTGG - Intergenic
1108783223 13:53862833-53862855 GTAAAGACACAGCAAGAAGGTGG - Intergenic
1108922399 13:55692505-55692527 AAGAAGGCACAGCAAGATGGTGG + Intergenic
1109013450 13:56978551-56978573 GTGAGGACACAGCCAGAGGTTGG + Intergenic
1109071716 13:57777880-57777902 CTGAAGTCAAAGCAAAAGAGAGG - Intergenic
1109131154 13:58587401-58587423 TTGAAAACACAGAAAGATGGTGG + Intergenic
1109143018 13:58740016-58740038 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1109173555 13:59126521-59126543 GTGAGGACACGGCAAGAGGGTGG - Intergenic
1109202637 13:59448095-59448117 GTGAAGACACAGCAAGACGGTGG - Intergenic
1110231809 13:73174892-73174914 CTTAAGATACAGCAAGAAGGAGG - Intergenic
1110379588 13:74835127-74835149 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1110413624 13:75229142-75229164 ATGAGGACACAGCAAGAAGGTGG + Intergenic
1110616898 13:77551555-77551577 GTGAGGACACAGTAAGAAGGTGG - Intronic
1111758581 13:92432151-92432173 GTGAGGACACAGCAAGAAGGTGG + Intronic
1112050199 13:95637669-95637691 ATGAGGACATAGCAAGAAGGTGG + Intronic
1112123286 13:96436699-96436721 GTGAGGACATAGCAAGAAGGTGG + Intronic
1112169141 13:96951444-96951466 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1112423212 13:99272628-99272650 GTAAGGACACAGCAAGAGGGTGG - Intronic
1112753668 13:102607056-102607078 ATGAGGACACAGCAAGAAGGTGG + Intronic
1112766719 13:102753536-102753558 GTGAGGACACAGCAAGAAAGTGG + Intronic
1112792611 13:103019420-103019442 GTGAGCACACAGCAAGATGGTGG - Intergenic
1112998604 13:105604585-105604607 GTGAAGGCCCAGCAAGAGGAAGG - Intergenic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1113070037 13:106411428-106411450 ATGAAGAGGCTGCAAGAGGGTGG - Intergenic
1113077120 13:106477948-106477970 GTGAAGACACAGGGAGAGGACGG - Intergenic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113270795 13:108671774-108671796 GTGAGGACACAGCAAGAAGGTGG - Intronic
1113405037 13:110031199-110031221 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1113663814 13:112126661-112126683 GTGAGGACACAGCCAGAAGGTGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114942435 14:27630626-27630648 GTGAACACATAGCAAGAAGGTGG + Intergenic
1115190323 14:30741195-30741217 ATGAGGACCCAGCAAGAAGGTGG + Intergenic
1115196776 14:30809304-30809326 ATGAAGACTCTGCAAGAGGCTGG + Intergenic
1115375628 14:32672473-32672495 ATGAGAACACAGCAAGAAGGTGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115921627 14:38380667-38380689 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1116412912 14:44646812-44646834 GAGAGGACACAGCAAGAAGGTGG - Intergenic
1116647656 14:47549808-47549830 ATGAGCACACAGCAAGAAGGTGG + Intronic
1116865815 14:50030698-50030720 ATGAGGACACAGCAAGACGGTGG + Intergenic
1117070178 14:52049052-52049074 CTCAGGGCACAGCAGGAGGGTGG + Intronic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117257333 14:53991702-53991724 CTGAGGACACACCAATAAGGAGG + Intergenic
1117437678 14:55732512-55732534 ATGAGGACACAGCGAGAAGGTGG - Intergenic
1117460451 14:55939864-55939886 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1117671504 14:58111608-58111630 GTAAGGACACAGCAAGAAGGTGG - Intronic
1117704870 14:58454772-58454794 GTGAAGAGACAGCAAGAGGGAGG - Intronic
1117906627 14:60595730-60595752 GTGAGCACACAGCAAGATGGTGG - Intergenic
1117964268 14:61190653-61190675 GTGGAAACACAGCAAGAGGCAGG - Intronic
1118032105 14:61828095-61828117 GTGAAGACACAGGAAGAAGATGG + Intergenic
1118065822 14:62189187-62189209 GAGAAGACACAGCAAGAAGGCGG - Intergenic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1119169360 14:72522205-72522227 ATAAGGACACAGCAAGAAGGCGG - Intronic
1119391042 14:74291098-74291120 GTGAGGACACAGCAACAAGGTGG + Intronic
1119443857 14:74647746-74647768 ATGAAGACAGAGGGAGAGGGAGG - Intergenic
1119562164 14:75599211-75599233 CTGGAGGCACAGCATGGGGGAGG - Intronic
1119616382 14:76101612-76101634 GTGAGGACACAGCGAGAAGGCGG + Intergenic
1119687802 14:76646620-76646642 ATGAGGATACAGCAAGAGGGTGG - Intergenic
1119882551 14:78112524-78112546 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1120031785 14:79649980-79650002 GTAAAGATACAGCAAGAAGGTGG - Intronic
1120148553 14:81006368-81006390 GTGAGAACACAGCAAGAAGGAGG - Intronic
1120157552 14:81110411-81110433 GTGAGGCCACAGCAAGAAGGTGG + Intronic
1120415002 14:84208084-84208106 GTGAGTACACAGCAAGAAGGTGG - Intergenic
1120498905 14:85269676-85269698 GTGAAGACACAGCAAGAAATTGG - Intergenic
1120637567 14:86970748-86970770 ATGAGGACACAGCAAGAAGGTGG + Intergenic
1120667522 14:87324414-87324436 ATGAGGACACAGTAAGAAGGTGG - Intergenic
1120688750 14:87568887-87568909 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1121148791 14:91610932-91610954 ATGAGGACACAGCAAGAAGATGG + Intronic
1121154413 14:91669374-91669396 CTGAAGGAGCAGCCAGAGGGTGG + Intronic
1121227331 14:92330705-92330727 CTGAGCACACAGCAAGAAGGTGG - Intronic
1121240316 14:92425138-92425160 GTGAAGACACAGGCAGAAGGTGG + Intronic
1121338522 14:93091635-93091657 CTCAGGACACTGCCAGAGGGTGG + Intronic
1121426156 14:93853623-93853645 ATGAAGACACAGGGAGAAGGCGG + Intergenic
1121678066 14:95770491-95770513 GTGAGGACACAGCAAGAAGATGG + Intergenic
1121716153 14:96077517-96077539 GTGAAGACACAGGGAGAAGGTGG + Intronic
1121821737 14:96974181-96974203 GTGAACACACAGCAAGAAAGTGG + Intergenic
1121841017 14:97133895-97133917 GTGAGAACACAGCAAGAAGGTGG - Intergenic
1121881443 14:97503882-97503904 GTGAGGACAGAGCAAGAAGGTGG + Intergenic
1121883651 14:97523199-97523221 ATGAAGACACAGGGAGAAGGTGG - Intergenic
1122160381 14:99780065-99780087 GTGAGGACACAGCAAGAAGGTGG - Intronic
1122166349 14:99827253-99827275 CTGAAGACACAGGGAGAAGATGG + Intronic
1122401405 14:101469609-101469631 CAGAAGACACAGCGAGGGTGTGG - Intergenic
1122432729 14:101666203-101666225 GTGCAGACACAGCAAGAAGCTGG - Intergenic
1122622642 14:103068564-103068586 CTGAAGACACAGGGCAAGGGTGG + Intergenic
1122831205 14:104396963-104396985 GAGAGGACACAGCAAGAAGGAGG - Intergenic
1122951331 14:105046876-105046898 TGGAAGAGACAGCATGAGGGGGG - Intergenic
1123088766 14:105732107-105732129 CTGAAGAGACGGGCAGAGGGAGG - Intergenic
1202833504 14_GL000009v2_random:60234-60256 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1123629807 15:22253789-22253811 CTGAAGGAAAAGCAAGATGGCGG + Intergenic
1124070443 15:26388037-26388059 CTGAAAACAGAGCAGGAGGTTGG - Intergenic
1124154085 15:27209871-27209893 GTGAGGACACAGCAGGAAGGTGG - Intronic
1124680926 15:31730132-31730154 GTGAGGACACAGCAAGAAGGTGG + Intronic
1125092090 15:35805819-35805841 GTGAAGACCCAGCGAGAAGGTGG - Intergenic
1125613605 15:40990169-40990191 CTGAAATCACAGCAAGGGGCTGG + Intronic
1126176657 15:45742251-45742273 GTGAAGAGGCAGCGAGAGGGAGG + Intergenic
1126176991 15:45745044-45745066 CAGGAGAGACAGCAAGAGAGGGG - Intergenic
1126205017 15:46035609-46035631 ATGAGGACACAGCAAGAAGGTGG + Intergenic
1126957522 15:53950720-53950742 CTGAAGACACAGAAATAGCCAGG + Intergenic
1127006946 15:54581492-54581514 GTGAAGACACAGCAAGTAGAAGG - Intronic
1127321721 15:57853089-57853111 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1127363762 15:58267879-58267901 GTGAAGAGGCAGCAATAGGGCGG - Intronic
1127523596 15:59770379-59770401 GTGAGGACACATCAAGAAGGTGG + Intergenic
1128225622 15:65999351-65999373 CTGAAGACCCTACATGAGGGGGG + Intronic
1128317872 15:66672445-66672467 GTGAAGAGGCAGCAAGAGAGTGG - Intronic
1128551965 15:68603693-68603715 CAGAGGACACAGCAAGAAGACGG + Intronic
1128727660 15:69999792-69999814 GTGAGGACACGGCAAGAAGGTGG - Intergenic
1128787002 15:70405022-70405044 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1128904268 15:71453041-71453063 GTGAGGACACAGCGAGAAGGTGG + Intronic
1129238609 15:74238833-74238855 CAGCAGAGACAGCAAGAGTGTGG + Intronic
1129278975 15:74468885-74468907 ATGAGGACAGAGCAAGAAGGTGG - Intergenic
1129703370 15:77780790-77780812 GTGAGGACACAGCAAGAAGGTGG + Intronic
1130567476 15:85008864-85008886 CTCGAGACACAGGGAGAGGGAGG - Intronic
1131284332 15:91044602-91044624 CTGAAGACAGAGGCAGAGGTGGG - Intergenic
1131630890 15:94175869-94175891 GTGAGAACACAGCAAGAAGGCGG + Intergenic
1132149357 15:99448397-99448419 GTGAGGACACAGGAAGAAGGTGG - Intergenic
1132249624 15:100325446-100325468 GTGAAGACACAGGGAGAGGACGG + Intronic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132344880 15:101102159-101102181 CCGAGGACCCAGCTAGAGGGAGG + Intergenic
1132867638 16:2101688-2101710 CTGAAGAAACAGCCACGGGGAGG + Intronic
1133246907 16:4455149-4455171 AAGAAGACACAGCCAGAGGCTGG - Intronic
1133451619 16:5908904-5908926 GTGAGGACACAGCAAGAAGCTGG + Intergenic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1133567963 16:7012959-7012981 CTGAAGACACATTGAGAAGGTGG - Intronic
1133836646 16:9373513-9373535 GTGAGGACACAGCAAGAAGGCGG + Intergenic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1133922090 16:10162547-10162569 GTGAAGACACAGGGAGAGGATGG - Intronic
1134294966 16:12937625-12937647 GTGAGGACACAGCAAGAAGGTGG - Intronic
1134855087 16:17511849-17511871 CCAAAGACACAGCAAGAAGGTGG - Intergenic
1135129765 16:19843724-19843746 GTGATGACCCAGCAAGAAGGTGG - Intronic
1135173688 16:20209402-20209424 GTGAAGACACAGCGAGAAGGTGG + Intergenic
1135348620 16:21710312-21710334 GTGAGCACACAGCAAGATGGCGG - Intronic
1135488579 16:22887375-22887397 GTGAGGACACAGCAAGAAGATGG - Intronic
1135835804 16:25824152-25824174 GGGAAGACACAGAAACAGGGAGG + Intronic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1135890004 16:26348562-26348584 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1135890906 16:26356351-26356373 GAGAAGACACAGCAGGAAGGTGG - Intergenic
1135962853 16:27012227-27012249 CTAAAGCCACACCAAGAAGGTGG - Intergenic
1135974469 16:27098718-27098740 GTGAGGACATAGCAAGAAGGTGG - Intergenic
1136932647 16:34432887-34432909 TGGCAGACAGAGCAAGAGGGAGG - Intergenic
1136971925 16:34978927-34978949 TGGCAGACAGAGCAAGAGGGAGG + Intergenic
1137626090 16:49909709-49909731 GTGAGGACACAGCGAGAAGGTGG - Intergenic
1137863855 16:51873460-51873482 GTGAAGACACCTCAAGAGGAAGG + Intergenic
1137927781 16:52557749-52557771 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1138118896 16:54382344-54382366 CTGAAGAAACACTAAGGGGGTGG - Intergenic
1138203396 16:55106623-55106645 GTGGAGACACAGCGAGAAGGTGG + Intergenic
1138310280 16:56017680-56017702 GTGAGGACACACCAAGAAGGTGG + Intergenic
1138630335 16:58289174-58289196 GTGAGGACACAGTGAGAGGGTGG + Intronic
1138640201 16:58379742-58379764 GTGAGGACAGAGCAAGAAGGTGG + Intronic
1138877197 16:60966379-60966401 GTGAGAACACAGCAAGATGGTGG + Intergenic
1138903589 16:61303368-61303390 GTGAGAACACAGCAAGAAGGAGG + Intergenic
1139054740 16:63168832-63168854 AAGAAGACACAGCAAAAGGATGG + Intergenic
1140373354 16:74425401-74425423 GTGAAGACACAGGGAGAAGGCGG + Intergenic
1140515740 16:75539960-75539982 CTGAAGACTCAGCAGGACCGTGG - Exonic
1140585855 16:76290918-76290940 CATAAGACACAGCAAGGAGGTGG - Intronic
1140654381 16:77124451-77124473 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1140736692 16:77904481-77904503 GTGAGGACACAGTGAGAGGGTGG - Intronic
1140807419 16:78545806-78545828 GTGAGGACAGAGCAAGAAGGCGG - Intronic
1140932409 16:79640045-79640067 CTGAACACACAGAAAGTGGTAGG + Intergenic
1140963623 16:79942304-79942326 ATGAAGAGGCAGCAAGGGGGTGG - Intergenic
1141065650 16:80911642-80911664 GTAAAGATACAGCAAGAAGGTGG + Intergenic
1141398853 16:83728950-83728972 ATGAGGACACAGCAAGAAGGTGG - Intronic
1141469379 16:84228362-84228384 GTGAACTCACAGCAGGAGGGAGG - Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141973333 16:87496967-87496989 CTGAAGGAAAAGCAAGATGGTGG - Intergenic
1142066439 16:88065606-88065628 CTGAAGACACAACAGGAACGGGG + Intronic
1142901898 17:3017409-3017431 CTGAAGCCCCTGCAAGTGGGAGG + Intronic
1142907770 17:3056974-3056996 GTGAGCACACAGCAAGATGGTGG + Intergenic
1142926795 17:3247285-3247307 GTGAGCACACAGCAAGATGGTGG - Intergenic
1142985736 17:3694565-3694587 GTGAGGACACAGCGAGAGGGTGG + Intronic
1143033953 17:3983822-3983844 CTGAAGTCACTGCAGGAGGTCGG + Intergenic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1143395231 17:6589283-6589305 TTGAGGACACAGCAAGAAGGTGG + Intronic
1143466317 17:7139173-7139195 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1143626186 17:8111354-8111376 CTGCAGACAGAGCTAGAGGTGGG - Exonic
1143644071 17:8218322-8218344 GTGAGGACACTGCAAGAAGGCGG + Intergenic
1143992093 17:10974480-10974502 CTGAAGACACAGGAACACAGAGG + Intergenic
1144003378 17:11076282-11076304 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1144078480 17:11740441-11740463 GTGAGGATACAGCAAGAAGGTGG - Intronic
1144263108 17:13542453-13542475 GTGAAGACACAGAGAGAAGGTGG + Intronic
1144382704 17:14718611-14718633 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1144422993 17:15114879-15114901 GTGAGGAGAGAGCAAGAGGGTGG + Intergenic
1144444114 17:15310525-15310547 GTGAAGACACAGGGAGAAGGTGG + Intronic
1144516063 17:15918131-15918153 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1145306070 17:21675884-21675906 GGGCAGACAGAGCAAGAGGGAGG + Intergenic
1145306406 17:21677711-21677733 GGGGAGACAGAGCAAGAGGGAGG + Intergenic
1145306412 17:21677744-21677766 GGGAGGACAGAGCAAGAGGGAGG + Intergenic
1145370322 17:22301990-22302012 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1145375444 17:22343421-22343443 CTGAAGAAACAGGGTGAGGGGGG - Intergenic
1145385728 17:22410393-22410415 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1145386100 17:22412561-22412583 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1145859205 17:28193320-28193342 TGGAACACACAGCACGAGGGTGG + Intronic
1146461316 17:33048130-33048152 TTGAGGACACAGCAAGAAGGTGG + Intronic
1146625538 17:34432283-34432305 GTGAGGACACAGCAAGACGATGG + Intergenic
1146716552 17:35090915-35090937 CTGTAGACCCAGCTATAGGGTGG - Intronic
1147465695 17:40609053-40609075 ATGAGGACATAGCAAGAAGGTGG - Intergenic
1147708708 17:42447456-42447478 GGGAGGACACAGCAAGAAGGTGG - Intergenic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148584707 17:48769157-48769179 CTGAGGACTCTGCAAGAGGAGGG + Exonic
1148965231 17:51429411-51429433 GTGAGGACACAGCAAGAAGGCGG - Intergenic
1149144356 17:53472177-53472199 GTGAAGACACAGCAAGAAGATGG - Intergenic
1149284776 17:55150311-55150333 ATGAGGACACAGCCAGAGGTAGG - Intronic
1149436037 17:56634205-56634227 GTGTAGACACAGCAAGAAGGTGG - Intergenic
1149707460 17:58707869-58707891 ATGAGGACACAGCAAGAAGGTGG - Intronic
1150345996 17:64405175-64405197 CTGAAGACAAAGGAAAAGGAAGG + Intronic
1150484688 17:65535722-65535744 CTGAGGACACAGCCAGGGCGAGG + Intronic
1150803275 17:68298752-68298774 GTGAGGACACAGCAAGAAGGTGG - Intronic
1150951671 17:69808994-69809016 TTGAAGACACAGCAAAAAGGCGG + Intergenic
1151307732 17:73274121-73274143 GTAAAGACACAGCAAGAAGGTGG - Intergenic
1151393886 17:73806991-73807013 ATGAAGACACAGCTAGAAGATGG - Intergenic
1151410575 17:73924816-73924838 ATGAAGACACAGCAAGAGGTCGG + Intergenic
1151412100 17:73937739-73937761 GGGAGGACACAGCAAGAAGGTGG + Intergenic
1151512251 17:74567998-74568020 CTGAGGTCAGAGCAAGAGTGAGG - Intergenic
1151817958 17:76480790-76480812 CAGAAGACACAGCAGCAGGCAGG - Intronic
1151870605 17:76833991-76834013 GTGAGGACACAGCAAGGAGGTGG + Intergenic
1152004672 17:77672618-77672640 GTGAAGACACAGGCAGAGGGTGG + Intergenic
1152040785 17:77901274-77901296 GTGAGCACACAGCAAGAAGGCGG + Intergenic
1152246835 17:79189009-79189031 CAGAAGCCAAAGGAAGAGGGGGG + Intronic
1152256273 17:79241785-79241807 GTGAAGACACAGTGAGAAGGCGG - Intronic
1203171916 17_GL000205v2_random:156433-156455 CACAGGACAGAGCAAGAGGGAGG - Intergenic
1153082080 18:1238928-1238950 GTGAAGACACAGTGAGAAGGTGG - Intergenic
1153655734 18:7280560-7280582 GTGAGGACACAGTAAGAAGGCGG - Intergenic
1154087187 18:11318845-11318867 CTGAAGACAAAGTCTGAGGGTGG + Intergenic
1154394546 18:13975012-13975034 ATGAGGAGACAGCAAGAGGATGG + Intergenic
1154423433 18:14253663-14253685 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1154468286 18:14670963-14670985 ATGAAGACACAGGAATATGGAGG - Intergenic
1154973097 18:21429995-21430017 GTGAGGACACAGCAAGAAGACGG - Intronic
1155083273 18:22431208-22431230 GTGAGGACGCAGCAAGAAGGTGG - Intergenic
1155222464 18:23697930-23697952 GTGAAGACACAGGCAGAAGGTGG - Intronic
1155445052 18:25902158-25902180 ATGAGAACACAGCAAGAAGGTGG + Intergenic
1155483728 18:26317723-26317745 ATGAAAACACAGCAAGAAGATGG - Intronic
1155518134 18:26643165-26643187 GTGAGCACACAGCAAGAAGGTGG - Intronic
1155760143 18:29554915-29554937 GTGAAAACACAGCAAGAAAGTGG + Intergenic
1156399755 18:36729590-36729612 TTGAAGACACAGCAAGAAGGTGG - Intronic
1156511949 18:37644397-37644419 ATGAAGCCACAGCCAGATGGGGG + Intergenic
1156950684 18:42893410-42893432 TTGAGGACACAGCAAGAAGGTGG - Intronic
1157036127 18:43976725-43976747 CTGAAAACACAGCATGCGGAGGG - Intergenic
1157216691 18:45789611-45789633 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1157237917 18:45981471-45981493 GTGAAGAGGCAGCAAGAGAGTGG - Intergenic
1157650395 18:49323598-49323620 GTGAGGACACAGCAAGAAGGTGG + Intronic
1157884093 18:51349679-51349701 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1157957131 18:52111030-52111052 GTGAAGATACAGCAAGAAGGAGG + Intergenic
1158041289 18:53097765-53097787 GCGAAGACACAGTAAGAAGGTGG - Intronic
1158454167 18:57592016-57592038 GTGCAGAGACAGCAAGAAGGTGG + Intergenic
1158500508 18:57996549-57996571 GTGAGGACACAGCAAGAAAGTGG - Intergenic
1158741606 18:60148890-60148912 GTGCAGACACAGCAAGAAGGTGG - Intergenic
1158751293 18:60264267-60264289 GTGAGGAGGCAGCAAGAGGGCGG - Intergenic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158808396 18:61002596-61002618 CTGAGGACACAGCAAGAAGAAGG + Intergenic
1158948070 18:62464961-62464983 GTGAAGTCACAGCAAGAAGATGG - Intergenic
1159030708 18:63228040-63228062 GTGAGGACACAGCAAGAAGGCGG - Intronic
1159202964 18:65211405-65211427 GTGAAGACACAGTAAGAAGATGG + Intergenic
1159232683 18:65629476-65629498 GTGAGGACACACCAAGAAGGTGG + Intergenic
1159236428 18:65679982-65680004 CTGTAGACATAGCAAGAGTGAGG - Intergenic
1159305838 18:66640939-66640961 ATGAAGACATAGTGAGAGGGTGG - Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1159639250 18:70844270-70844292 GTAAAGACACAGAAAGAAGGTGG + Intergenic
1159684478 18:71401237-71401259 GTGAGAACACAGCAAGAAGGAGG - Intergenic
1159820267 18:73132232-73132254 CTGAAGACACAGGGAGAAGATGG + Intergenic
1159913418 18:74167267-74167289 GTGAGGACACTGCAAGAAGGTGG + Intergenic
1159950214 18:74477651-74477673 GTGAAGATACAACAAGAAGGCGG - Intergenic
1160675662 19:389974-389996 CGGAGGACAGAGAAAGAGGGAGG - Intergenic
1160907933 19:1460530-1460552 CTGCAGAGGCAGCAACAGGGTGG - Intronic
1161654403 19:5505031-5505053 ATGAGAACACAGCAAGAAGGTGG + Intergenic
1161792389 19:6368262-6368284 GTGAAGACACAGCGAGAAGGCGG - Intronic
1162057937 19:8076087-8076109 GTGAGGACACAGCAAAAAGGTGG + Intronic
1162306942 19:9880664-9880686 GTGAAGATACAGTAAGAAGGTGG + Intronic
1162616398 19:11804282-11804304 GTGAGGACACAGCAAGAGGATGG - Intronic
1162834078 19:13304723-13304745 ATGAGGACACAGCAAGAAGGTGG + Intronic
1162956765 19:14103067-14103089 CTGAGGACACAGCATCAGGGAGG + Intronic
1162994466 19:14325390-14325412 GTGAGGACACAGCAAGAAGGCGG - Intergenic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1163242727 19:16074403-16074425 GTGAGGACACAGCAAGAAGGTGG - Intronic
1164620227 19:29691090-29691112 GTGATGACTCAGCAAGAAGGTGG - Intergenic
1164961487 19:32434817-32434839 GTAAGGACACAGCAAGAAGGTGG - Intronic
1165171745 19:33897193-33897215 ATGAGGACACAGCAAGGAGGTGG + Intergenic
1165172521 19:33904122-33904144 CTGAAATCAAAGCAAGACGGTGG + Intergenic
1165334845 19:35162507-35162529 GTGAAGACAGAGCAAGAGAATGG - Intronic
1165341778 19:35217692-35217714 GTGAGGACACAGCAAGAAGATGG - Intergenic
1165509172 19:36256361-36256383 GGGCAGACAGAGCAAGAGGGAGG - Intergenic
1165511758 19:36270267-36270289 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165512308 19:36272768-36272790 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165512855 19:36275309-36275331 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165513411 19:36277864-36277886 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165513960 19:36280398-36280420 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165514513 19:36282935-36282957 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165515064 19:36285468-36285490 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165515615 19:36288004-36288026 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165516166 19:36290541-36290563 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165516716 19:36293067-36293089 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165517269 19:36295590-36295612 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165517821 19:36298125-36298147 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165518374 19:36300660-36300682 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165518924 19:36303192-36303214 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165519473 19:36305707-36305729 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165520021 19:36308235-36308257 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1165595894 19:37011097-37011119 GGGCAGACAGAGCAAGAGGGAGG - Intronic
1165624046 19:37270346-37270368 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165624592 19:37272887-37272909 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165625135 19:37275414-37275436 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165625669 19:37277952-37277974 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165626209 19:37280477-37280499 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165626750 19:37283004-37283026 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165627290 19:37285525-37285547 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165627831 19:37288053-37288075 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165628368 19:37290577-37290599 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165628908 19:37293102-37293124 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165629451 19:37295628-37295650 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165629992 19:37298153-37298175 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165630535 19:37300681-37300703 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165631071 19:37303219-37303241 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165631530 19:37305670-37305692 GGGCAGACAGAGCAAGAGGGAGG + Intergenic
1165855683 19:38878330-38878352 CTGAGGCCCCAGAAAGAGGGAGG - Intergenic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166967766 19:46540527-46540549 GTGAAGACACAGGGAGAAGGCGG - Intronic
1167177965 19:47878948-47878970 ATGAAGACACAGCGGGATGGAGG + Intronic
1167304419 19:48698908-48698930 CAGAAGACACAGAGAGAGGCAGG - Intronic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167521751 19:49959624-49959646 CTGAAGACAGGGAAAGAGAGAGG + Intronic
1167523632 19:49971098-49971120 CTGAAGACAGGGAAAGAGAGAGG - Intergenic
1167651453 19:50732114-50732136 ATGAGGGCACAGCAAGAAGGCGG - Intergenic
1168084190 19:54033319-54033341 GTGGAGACACAGCAAGAAGGCGG - Intergenic
1168103656 19:54153975-54153997 CTGAGCAGACAGCCAGAGGGAGG - Intronic
1168521605 19:57055585-57055607 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1168684166 19:58337929-58337951 CTGGAGACAGAGAGAGAGGGAGG - Intronic
1202639166 1_KI270706v1_random:67461-67483 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
925221392 2:2144217-2144239 CTGAGGGCAGAGCAGGAGGGAGG - Intronic
925316190 2:2926074-2926096 GTGAAGACACAGGAAGAAGATGG + Intergenic
925368294 2:3325842-3325864 CTGAAGCCACAGGATAAGGGTGG - Intronic
925594500 2:5542056-5542078 ATGATGATACAGCAAGAAGGTGG + Intergenic
925642463 2:5999135-5999157 CTGGAAACACAGCCAGAAGGTGG - Intergenic
925797785 2:7565543-7565565 GTGAGGACACAGCAAGAAGGTGG - Intergenic
925840447 2:7986986-7987008 GTGAGGACACAGCAAGAAGGCGG + Intergenic
926111779 2:10188392-10188414 GTGAGGACACAGCAAGAAGGCGG - Intronic
926332758 2:11838647-11838669 ATGAAGCCACAGGAACAGGGAGG + Intergenic
926352142 2:12005540-12005562 GTGAAGACACAGCAATAAGATGG - Intergenic
926724993 2:15990738-15990760 ATCAGGACACAGCAAGAAGGTGG + Intergenic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
927444183 2:23143216-23143238 GTGAAGACATAGCAAGAAGGTGG - Intergenic
927517975 2:23682972-23682994 CTGAAGACCAAGGAAGACGGTGG - Intronic
927618352 2:24623737-24623759 GTGAGGACACAGGAAGATGGCGG - Intronic
927631369 2:24777027-24777049 ATGCAGACACACCAAGAGTGAGG + Intergenic
928035548 2:27819242-27819264 GTGAGCACACAGCAAGATGGTGG - Intronic
928063665 2:28140975-28140997 GTGAGGATACAGCAAGAAGGTGG - Intronic
928320434 2:30278957-30278979 CAGAGGACACAGCAAGAGGTTGG - Intronic
928380521 2:30813958-30813980 CTGAAGACACAAAAAGAGACTGG + Intronic
929218678 2:39441217-39441239 CTGAAGACAGAGGGAGATGGTGG + Intergenic
929323390 2:40574831-40574853 GTGAAGATACAGTAAGAAGGAGG + Intronic
929700882 2:44161961-44161983 CTGAGGACACATCAAGAGGATGG + Intergenic
929720965 2:44367019-44367041 TTTAAGACACAGCAACAGGCCGG - Intronic
929904054 2:46030556-46030578 CAGAAGTAACAGCAAGAGGGAGG - Intronic
930246887 2:48992678-48992700 ATAGAGACAGAGCAAGAGGGTGG - Intronic
930337794 2:50071530-50071552 GTGAAAACCCAGCAAGAAGGTGG + Intronic
930493704 2:52110210-52110232 GTGAGGACATAGCAAGAGGGTGG + Intergenic
930566660 2:53029004-53029026 GTGAAGATACATCAAGAAGGTGG + Intergenic
931108532 2:59084515-59084537 GTGAAAACGCAGCAAGAAGGTGG - Intergenic
931382569 2:61767113-61767135 GTGAAGACACAGTGAGAAGGTGG - Intergenic
931536850 2:63287054-63287076 GTGAGGACACAGCAAGAAGGTGG - Intronic
932254099 2:70268840-70268862 GTGAGGACACAGCAAGAAGGTGG + Intronic
932314761 2:70772560-70772582 ATGAGGACACAGCAAGAAGGTGG + Intergenic
932464816 2:71912261-71912283 GTGAAGGCACAGCAAGAAGGTGG + Intergenic
933364959 2:81340884-81340906 ATGAAGACACAGTCAGAAGGTGG - Intergenic
934509027 2:94922064-94922086 ATGAAGACACAGGAACATGGGGG + Intergenic
934578378 2:95417719-95417741 GTGATGACACAGCAAGAAGATGG - Intergenic
934601057 2:95658984-95659006 GTGATGACACAGCAAGAAGATGG + Intergenic
935040077 2:99417584-99417606 GTGAAGACACAGGGAGAGGAGGG + Intronic
935270523 2:101430523-101430545 GTGAAGACACAGCGAGAAGGCGG + Intronic
935409916 2:102750975-102750997 ATGAGGCCACAGCAAGAAGGCGG - Intronic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935744582 2:106179260-106179282 TTGAAGTCAGAGCAAGAGCGGGG - Intronic
935796373 2:106645184-106645206 GTGAGGACACAGCAAGAAGGTGG - Intergenic
936119479 2:109729085-109729107 CTGCTGACATTGCAAGAGGGAGG + Intergenic
936255487 2:110907181-110907203 GTGAGGACACAGCAAGGTGGCGG - Intronic
936339187 2:111616476-111616498 GTGAAAAGACAGCGAGAGGGCGG - Intergenic
936534432 2:113301150-113301172 GTGATGACACAGCAAGAAGATGG + Intergenic
936892905 2:117392965-117392987 GTGAAGACACAGAGAGAAGGTGG - Intergenic
937154989 2:119712543-119712565 ATGAAGGCACGGCAAGAAGGGGG + Intergenic
937219013 2:120330809-120330831 GTGAAGACACAGGGAGAGGACGG + Intergenic
937457773 2:122057870-122057892 ATGCAGGCACAGCAACAGGGTGG - Intergenic
937683732 2:124672158-124672180 GTGAAGACACCAGAAGAGGGTGG - Intronic
937795368 2:126011654-126011676 GTGAAGACACAGTAAGAAGATGG + Intergenic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
938646630 2:133337655-133337677 GTGAACACACAGCAAGAAGGTGG + Intronic
938694836 2:133825932-133825954 GTGAGGACACAGCAAGAAGGAGG + Intergenic
938786241 2:134632610-134632632 TTGAGGACACAGCAACAAGGTGG - Intronic
938930173 2:136079864-136079886 GTGAAGACACAGCAGGAAGGTGG - Intergenic
939029847 2:137059135-137059157 GTGAGGACACAGCAAGAAGATGG - Intronic
939446922 2:142322022-142322044 ATGAGGACACATCAAGAAGGTGG - Intergenic
939821386 2:146960918-146960940 GTGAGGACACAGCAAGAAGGTGG - Intergenic
939862281 2:147434648-147434670 ATGAGGACACAGCAAGAAGATGG - Intergenic
939956326 2:148530446-148530468 CAGAGGACACAGCAAGAAGGTGG + Intergenic
940084624 2:149845072-149845094 GTGAGCACACAGCAAGATGGTGG - Intergenic
940096879 2:149986987-149987009 GTGAGGACACAGCAAGAAGGCGG + Intergenic
940467271 2:154046791-154046813 CTGAGGATACAGGAAGAAGGTGG + Intronic
940906045 2:159170962-159170984 CTGAATACACATCATGATGGAGG - Intronic
940991253 2:160098898-160098920 GTGAAGATACAGGGAGAGGGTGG - Intergenic
941151047 2:161916004-161916026 GTGAGGACACAGCAAGGGAGTGG + Intronic
941567149 2:167123637-167123659 GTGAAGAGGCAGCAAGAGGGAGG - Intronic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942747504 2:179251783-179251805 ATGAAGACACAGCAAGAAGATGG + Intronic
943025734 2:182625123-182625145 GTGAAGATACTGCAAGAAGGTGG + Intergenic
943324636 2:186483652-186483674 TTGAAGACATAGCTAGAAGGTGG - Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
943983939 2:194594962-194594984 GTGAGGACACAGCAAGAAGGCGG - Intergenic
944306043 2:198181080-198181102 GTGAGGACACAGCAAGAAGGTGG - Intronic
944901394 2:204220196-204220218 ATGAAGACACGGCAAGAAGGTGG - Intergenic
945029202 2:205648148-205648170 GTGAGGACACCGCAAGAAGGTGG - Intergenic
945034128 2:205689677-205689699 CTGAAAACAGAGGAAGAAGGAGG - Intronic
945126452 2:206516542-206516564 ATGAAGACACAGCAAGAAGGTGG - Intronic
945179095 2:207073800-207073822 CTGAAGACACAGGGAGTAGGAGG + Intergenic
945734878 2:213586940-213586962 CTGAAGACACTACAAGGGTGGGG - Intronic
946079256 2:217103117-217103139 ATGAGGACACAGTAAGAAGGTGG - Intergenic
946699336 2:222395900-222395922 ATGAAGAGGTAGCAAGAGGGTGG - Intergenic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946804254 2:223454275-223454297 GTGAAGACACAGCAAGAAGGCGG + Intergenic
946808582 2:223497631-223497653 GTGAAGACACAGCAAGAAGTTGG + Intergenic
946918627 2:224553720-224553742 GTGAAGACACAGCAAGGAGGTGG + Intronic
946965749 2:225035829-225035851 GTGAGGACACAACAAGAAGGCGG - Intronic
947015274 2:225612652-225612674 GTGAGGATACAGCAAGAAGGTGG - Intronic
947140210 2:227013550-227013572 GTGAGGACACAGGAAGATGGTGG + Intronic
947164178 2:227244928-227244950 CTGAAGACATAGGAAAAAGGAGG - Intronic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
947654327 2:231813371-231813393 GTGAGGACACAGCAAGAAGATGG - Intergenic
948307857 2:236963095-236963117 ATGAAGCCACAGGAAGAAGGTGG - Intergenic
948511019 2:238465384-238465406 CTGAAAACACTGGAAGAAGGAGG - Intergenic
1168942690 20:1726935-1726957 CTGAAGAGAAAAGAAGAGGGAGG + Intergenic
1169458759 20:5776368-5776390 ATGAGGACACAGGAAGACGGTGG - Intronic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169679550 20:8195437-8195459 GTGAAGACACAGCAAAAAGATGG + Intronic
1169938770 20:10914398-10914420 GTGAAGACACAGCAAGAGAGTGG + Intergenic
1170328275 20:15179996-15180018 ATGAAGAGTAAGCAAGAGGGTGG - Intronic
1170474105 20:16697765-16697787 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1170595139 20:17799702-17799724 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1170600909 20:17840927-17840949 CTGAGGCCATAGCAAGAGTGTGG + Intergenic
1170796930 20:19556034-19556056 GTGAGGACACAGCAAAAAGGTGG - Intronic
1170882900 20:20313214-20313236 GTGAGGACACAGCAGGAAGGTGG + Intronic
1170962781 20:21040057-21040079 GTGAGGACACAGCAAGAAGGGGG + Intergenic
1171071649 20:22074522-22074544 GTGAGGACACAGCAAGAAGGCGG + Intergenic
1171073324 20:22097197-22097219 CTGTAGACCCAGCTATAGGGAGG + Intergenic
1171369723 20:24653814-24653836 GTGAAGTCGCAGCAAGAAGGCGG - Intronic
1171391568 20:24804747-24804769 CTGAAGCCCCAGCAAGCAGGAGG + Intergenic
1171531654 20:25857231-25857253 GGGAGGACAGAGCAAGAGGGAGG + Intronic
1171533055 20:25864670-25864692 GGGGAGACAGAGCAAGAGGGAGG + Intronic
1171544233 20:25988418-25988440 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1171544505 20:25990034-25990056 GAGCAGACAGAGCAAGAGGGAGG - Intergenic
1171573759 20:26277958-26277980 GGGGAGGCACAGCAAGAGGGAGG - Intergenic
1171793211 20:29547303-29547325 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1171806852 20:29688482-29688504 GGGGAGGCACAGCAAGAGGGAGG - Intergenic
1171855243 20:30337076-30337098 GGGGAGACAGAGCAAGAGGGAGG + Intergenic
1171885758 20:30651576-30651598 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1172305917 20:33880621-33880643 GTGAGGACACAGCAAGGAGGTGG + Intergenic
1172998250 20:39086688-39086710 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1173543002 20:43868686-43868708 GTGAGGACACATCAAGAAGGTGG + Intergenic
1173889669 20:46496503-46496525 CTGAAGGGAAAGCAGGAGGGTGG + Intergenic
1174558352 20:51412561-51412583 CTGTAACCACAGCAGGAGGGAGG + Intronic
1174694133 20:52540480-52540502 CTTAAGACACAGTAAGACTGTGG - Intergenic
1174954887 20:55086600-55086622 CTGAGGCCACAGCCAGATGGTGG - Intergenic
1175039442 20:56033127-56033149 GTGAAGGCACAGCAAGAAGATGG - Intergenic
1175287738 20:57849045-57849067 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1175344915 20:58265916-58265938 CAGAAGTCAGAGCAAGATGGAGG + Intergenic
1175351357 20:58322035-58322057 GTGAAGCCACAGCAGGAGGATGG - Intronic
1175680988 20:60988726-60988748 GTGAGGACACAGCAAGAGAATGG + Intergenic
1175701897 20:61145261-61145283 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1176155351 20:63617335-63617357 ATGAGGACACAGCAAGAAGTCGG + Intronic
1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG + Intergenic
1176647489 21:9365070-9365092 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1176806231 21:13486686-13486708 ATGAAGACACAGGAATATGGAGG + Intergenic
1176850036 21:13906346-13906368 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1177361709 21:20081412-20081434 GTGAAGACACAGCGAGAAAGTGG - Intergenic
1177461121 21:21412200-21412222 GTGAGGACACAGCAAGAAGGCGG - Intronic
1177735763 21:25086703-25086725 CTGAGGACACAGGAAGAAGAGGG + Intergenic
1177864798 21:26500084-26500106 GTGAAGACACAGCAAGATGGTGG - Intronic
1178085567 21:29108287-29108309 GTGAGGACATAGCAAGAAGGTGG + Intronic
1178135864 21:29626487-29626509 GGGAGGACACAGCAAGAAGGTGG + Intronic
1178165038 21:29964127-29964149 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1178304621 21:31481158-31481180 GTGAGGACACAGAAAGAAGGTGG - Intronic
1178389680 21:32188046-32188068 GCGAAGACACAGCAAGAAGGTGG + Intergenic
1178604210 21:34021221-34021243 GTGAGGACACAGCGAGAAGGCGG - Intergenic
1178756789 21:35357673-35357695 ATGAGGACACAGCAAGAAGGTGG + Intronic
1178914870 21:36700570-36700592 CAGAAGAGACAAAAAGAGGGAGG - Intronic
1178954322 21:37008814-37008836 CAGAAGAAACCGCAACAGGGAGG - Intronic
1179020659 21:37637846-37637868 GTGAGGACACAGCAAGAAGGTGG + Intronic
1179062202 21:37989447-37989469 GTGAGGACACAGCAAGAAGGTGG + Intronic
1179121562 21:38550538-38550560 GTGAAGACCCAGCAAGAAGATGG + Intronic
1179182413 21:39057169-39057191 CTGAAGACTCAGTAAGATGAAGG + Intergenic
1179241398 21:39596292-39596314 GTGAAGACACAGCAAGAATGTGG + Intronic
1179267283 21:39814910-39814932 ATGAGTACACAGCAAGAAGGTGG + Intergenic
1179279418 21:39921702-39921724 GTGAGGACACAGCAAAAAGGTGG + Intronic
1179280909 21:39933584-39933606 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1179642687 21:42757731-42757753 ATGAGGACCCAGCAAGAAGGCGG - Intronic
1179762371 21:43540861-43540883 ATGAAGAGGCAGCAAGAGGGTGG - Intronic
1179937409 21:44614133-44614155 CTGTGGACAGAGCAAGATGGGGG - Intronic
1180034441 21:45236518-45236540 CTGAAGACCAAGCAAGGGGTGGG - Intergenic
1180256032 21:46628221-46628243 TTGAGGACACAGCAAGAAGGTGG + Intergenic
1180362784 22:11914403-11914425 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180900883 22:19371253-19371275 CTGAAGACAGGGCAATAGAGAGG - Intronic
1180985802 22:19903381-19903403 CTACAGACACAGCAAGAGGGAGG + Intronic
1182023270 22:27098604-27098626 CTGAGGACAAAACAAGGGGGAGG + Intergenic
1182052213 22:27322094-27322116 GTGAGGACCCAGCAAGAAGGTGG - Intergenic
1182056246 22:27357489-27357511 GTGAATACACAGCAAGAACGTGG + Intergenic
1182110903 22:27722622-27722644 ATGAGGACACAGTAAGAAGGTGG + Intergenic
1182308980 22:29391309-29391331 GTGAGGACATAGCAAGAGGGCGG - Intronic
1182400465 22:30072429-30072451 GTGAAGACACAGCAAGGAGGAGG + Intergenic
1182509516 22:30809001-30809023 GTGAAGACACAGACAGAGAGGGG + Intronic
1182820766 22:33214254-33214276 CTGAAGACACAGGGAGAAGATGG - Intronic
1182867372 22:33615530-33615552 GTGAAGACACAGCAAGAAGGTGG + Intronic
1182920927 22:34077964-34077986 ATGAGGATACAGCAAGAAGGTGG + Intergenic
1182940030 22:34267988-34268010 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1182942043 22:34286215-34286237 CTGAAGACACAGCCAAAAGCAGG - Intergenic
1183212644 22:36460335-36460357 GTGAGGACCCAGCAAGAAGGTGG + Intergenic
1184541236 22:45126689-45126711 GTGGAGACACAGCAAGAATGTGG - Intergenic
1184717869 22:46292104-46292126 GTGAGGACACAGCAAGAAAGTGG - Intronic
1184920736 22:47603929-47603951 GTGAAGACTCAGGAAGAAGGTGG - Intergenic
1184973996 22:48047894-48047916 CTAAAGACAAAGCCAGAGGCTGG + Intergenic
1185151970 22:49168987-49169009 ATGAAAACACAGCAAGGAGGTGG + Intergenic
1185152807 22:49175645-49175667 ATGAGGACACAGCCAGAAGGAGG + Intergenic
1185163869 22:49245725-49245747 GTGAGGACACAGCCAGAAGGTGG - Intergenic
1185188722 22:49419029-49419051 CTGAAGACAGGGTCAGAGGGTGG - Intronic
1185198220 22:49485943-49485965 GTGAGGACATAGCAAGAGGGTGG + Intronic
949806029 3:7956812-7956834 GTGAGGACACAGCAAGAAGGTGG - Intergenic
950011908 3:9729956-9729978 CTGGGGCCACATCAAGAGGGAGG + Intergenic
950268045 3:11589761-11589783 ATAAGGACACAGCAAGAAGGCGG - Intronic
950309118 3:11940381-11940403 AGGAAGTCACAGGAAGAGGGAGG - Intergenic
950449397 3:13057227-13057249 CTGAAGACACAGCCAGGGGATGG + Intronic
950844748 3:16003682-16003704 GTGAAGCCATAGCAAGATGGTGG + Intergenic
950885579 3:16359563-16359585 GTGAGGACACAGCAGGAAGGTGG + Intronic
951061695 3:18215846-18215868 GTGAGGAAACAGCAAGAAGGTGG + Intronic
951318762 3:21219651-21219673 CTGAAGACACAGCATAAGTATGG - Intergenic
951326746 3:21312180-21312202 GTGAGGACACAGCAAGAGAGTGG - Intergenic
951640371 3:24829348-24829370 CTGAGGGCACAGCCAGCGGGCGG + Intergenic
951969229 3:28424528-28424550 GTGAGGACATAGCAAGAAGGTGG + Intronic
952011504 3:28905385-28905407 GTGAGGACACAGCAAGAAGGTGG - Intergenic
952090908 3:29884490-29884512 CCAAAGACAGAGAAAGAGGGAGG - Intronic
952104061 3:30049704-30049726 GTGAGTACACAGCAAGAAGGTGG - Intergenic
952328986 3:32346541-32346563 GTAAAGACACAGCAAGAAGGTGG - Intronic
952330786 3:32362805-32362827 CTGGAGACAGAGCAACAGGAAGG - Intronic
952333761 3:32387408-32387430 GTGTGGACACAGCAAGAAGGTGG + Intergenic
952540891 3:34366591-34366613 TTGAGGACACAACAAGAAGGTGG + Intergenic
952929739 3:38349806-38349828 GTGAAGACACAGCAAGAGAGTGG - Intronic
952942840 3:38456301-38456323 CTGAAGCCAAAGCAACAGGACGG - Intronic
953203545 3:40799678-40799700 GTGATGACACAGCAAGAAGGTGG + Intergenic
953356592 3:42261491-42261513 CTGAAGGCAAAGGGAGAGGGGGG + Intronic
953796771 3:45991990-45992012 GTGAGGCCACAGCAAGAAGGCGG + Intronic
954078265 3:48196827-48196849 TTCAAGAAACAGCAGGAGGGAGG + Intergenic
954643735 3:52117978-52118000 AAGAACAGACAGCAAGAGGGTGG + Intronic
955098546 3:55823996-55824018 GTGAGGACACAGCAAGAAGGTGG - Intronic
955517522 3:59742482-59742504 GTGAGCACACAGCAAGATGGTGG - Intergenic
955539327 3:59957317-59957339 GTGAAGATAGAGCAAGAAGGTGG + Intronic
955829864 3:62989691-62989713 ATGAAGGCACAAAAAGAGGGAGG - Intergenic
955864542 3:63369191-63369213 GTGAAGAGGCAACAAGAGGGTGG + Intronic
955892371 3:63663662-63663684 CAGATCACACAGCAAGAGAGGGG - Intronic
956271568 3:67453407-67453429 GTGAGGACACAGCAAGAAGGTGG - Intronic
956762669 3:72457698-72457720 GTAAAGACACAGCAAGAAGGTGG + Intergenic
956772280 3:72536799-72536821 CTGAAGAGAAAGCAAGATGGGGG + Intergenic
956793320 3:72696959-72696981 CTCAGGACACAGCAACAGTGGGG + Intergenic
956863442 3:73347152-73347174 GTGAGCACACAGCAAGAAGGTGG - Intergenic
956927562 3:74005480-74005502 GTGAGGACACAGCAAGAAGGTGG + Intergenic
957134526 3:76268502-76268524 GTGAGGACACAACAAGAGGGTGG - Intronic
957656956 3:83092631-83092653 GTGAAGAAGTAGCAAGAGGGTGG + Intergenic
957915624 3:86684790-86684812 GTGAAGATACAGCAAGAAGCTGG + Intergenic
957960053 3:87237387-87237409 CTGAGAACACAGCAAGAAGGTGG + Intronic
957973741 3:87416928-87416950 GTGGAGACACAGCAAGAAGGTGG + Intergenic
958657552 3:97021635-97021657 GTGATGACACAGCAAGAATGTGG - Intronic
958812266 3:98874798-98874820 GTGAGGACACAGGAAGAAGGTGG + Intronic
959101586 3:102016542-102016564 GTGAGGGCACAGCAAGAAGGTGG - Intergenic
960020615 3:112948162-112948184 TTGAATATAAAGCAAGAGGGGGG - Intronic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960358673 3:116684133-116684155 TTGAAGACATAACAAGAAGGTGG - Intronic
960463052 3:117960347-117960369 GTGAAGACACAGTGAGAAGGCGG + Intergenic
960633345 3:119755539-119755561 GTGAAGACACAGTAAGAAGGTGG + Intronic
961165477 3:124760570-124760592 GTGAAGACACAGTGAGAAGGTGG - Intergenic
961423856 3:126829690-126829712 GTGACGACAGAGCAAGAAGGTGG + Intronic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962392870 3:134987801-134987823 GTGAGGACATAGCAAGAAGGTGG + Intronic
962930403 3:140030604-140030626 CTGAGGAAACAGCACCAGGGTGG + Intronic
963943524 3:151119427-151119449 GTGAAGACACAGTGAGAAGGTGG - Intronic
964013641 3:151920503-151920525 GTGAGGACACAGCAAGAAGGTGG + Intergenic
964190580 3:153995904-153995926 ATGAAGACACAGTGAGAGGGAGG - Intergenic
964369097 3:155981013-155981035 ATAAGGACACAGCAAGAAGGTGG - Intergenic
964562909 3:158018308-158018330 GTGAAGACACAGGGAGAAGGTGG - Intergenic
966008459 3:175047012-175047034 CTGAGGACACAGTAAGAAGATGG - Intronic
966104081 3:176313959-176313981 GTGAAGACACAGTGAGAAGGTGG - Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966673598 3:182560035-182560057 CTGAAGACACAGGGAGAAGGCGG - Intergenic
967015466 3:185477875-185477897 GTGAGGAAACAGCAAGAAGGTGG - Intronic
967202097 3:187080981-187081003 ATGAGGACACAGGAAGCGGGTGG - Intergenic
967616404 3:191573370-191573392 GTGAGGATACAGCAAGAAGGTGG + Intergenic
967723151 3:192836574-192836596 GTGAGGACACAGCAAGCAGGCGG + Intronic
967744826 3:193043489-193043511 GTGAAAACACAGCAAGAAGGAGG - Intergenic
968187658 3:196644197-196644219 GTGGAGACAAAGCAAGACGGGGG - Intronic
1202739390 3_GL000221v1_random:39917-39939 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
968809816 4:2794732-2794754 CTGAAGAGGCAGACAGAGGGAGG + Intronic
968937522 4:3619903-3619925 GTGAGGACACAGTAAGAAGGCGG - Intergenic
969130022 4:4984201-4984223 GTGAGGACACAGCAAGAAGGTGG + Intergenic
969144811 4:5113240-5113262 GTGAGGACACAGCAAGAAGATGG + Intronic
969272145 4:6110288-6110310 GTGAAGACACAGGGAGAAGGCGG + Intronic
969460712 4:7327343-7327365 GTGAAGACAGAGCCAGACGGAGG - Intronic
969521097 4:7678156-7678178 CTGGAGACACAGCACAGGGGCGG + Intronic
969521170 4:7678521-7678543 CTGGAGACACAGCACAGGGGCGG + Intronic
969591122 4:8122490-8122512 GTGAGGACACAGTAAGAAGGCGG - Intronic
969934050 4:10663907-10663929 GTGAAGACACAGCAAGCAGACGG + Intronic
970075727 4:12217318-12217340 GTGAGGACACAGCAAGAAGCTGG - Intergenic
970076659 4:12229612-12229634 ATGAAGACACAGCCAGAAGATGG + Intergenic
970172847 4:13306450-13306472 CTCAAGCCACAGAAAGAAGGTGG + Intergenic
970209876 4:13698069-13698091 GTGAGGACACAGCAAGAAGTTGG - Intergenic
970260369 4:14217951-14217973 GTGAAAACACAGCAAGAAGAAGG + Intergenic
970378534 4:15482481-15482503 GTGAGCACACAGCAAGATGGTGG - Intronic
970478828 4:16452303-16452325 ATGAAGACACAGCAGGAAAGGGG - Intergenic
970623912 4:17856403-17856425 GTGAGGACACAGCAAGAAGGTGG + Intronic
970682572 4:18527649-18527671 GTGAGGACACAGCAAGAAGATGG - Intergenic
971024513 4:22575451-22575473 GTGAAGACACAGCAAGACGGTGG + Intergenic
971275220 4:25190256-25190278 GTGAGGACACAGCAAGAAGGTGG - Intronic
971303686 4:25462585-25462607 ATGAAGACACAGCAAAAAGATGG - Intergenic
971305915 4:25481380-25481402 GTAAGGACACAGCAAGAAGGTGG - Intergenic
971370767 4:26016886-26016908 GTGAGGACACAGCAAGAAGGTGG + Intergenic
971424757 4:26504723-26504745 ATGAGGACACAGCAAGATGGCGG + Intergenic
971575523 4:28268137-28268159 GTGAGGACATAGCAAGAAGGTGG + Intergenic
971629322 4:28969351-28969373 ATGAAGACACAGCAAGAAGGAGG + Intergenic
971710098 4:30099603-30099625 CAGAAAACACAGCAAGAATGAGG - Intergenic
971823063 4:31584932-31584954 TTGAGGACACAACAAGAAGGTGG - Intergenic
971867636 4:32192582-32192604 ATGAGCACACAGCAAGAAGGTGG + Intergenic
971946302 4:33282860-33282882 ATGAAGACACAGGAAGAAAGTGG - Intergenic
972120861 4:35700597-35700619 CTGAGGAGGCAGCAAGAAGGTGG - Intergenic
972923743 4:43976707-43976729 GTGAAGACACAGCAAACAGGTGG - Intergenic
973274671 4:48294073-48294095 CAGGTGACACAGCAAGAAGGTGG + Intergenic
973369403 4:49233821-49233843 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
973729142 4:53806311-53806333 ATGAAGACACAGTGAGAAGGCGG - Intronic
973824821 4:54694288-54694310 CTGAAGAAAAAGCAAGAGGTGGG - Intronic
973964528 4:56148033-56148055 GTGAAGACGTAGCAAGAAGGTGG + Intergenic
974091573 4:57316644-57316666 CTGAGGAGGCAGAAAGAGGGGGG + Intergenic
974640876 4:64628803-64628825 GTGAGGACACAGCAAGAAGGTGG + Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
975629469 4:76386144-76386166 CTGGAGGCAGAGCAAGATGGCGG + Intronic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976608142 4:87001828-87001850 AAGCAGACACAGGAAGAGGGAGG - Intronic
976920863 4:90441418-90441440 ATGAAGACACAGCAAAAAGGTGG - Intronic
976971208 4:91104772-91104794 GTGAGAACACAGCAAGAAGGTGG - Intronic
976982704 4:91251265-91251287 GTGAAGATACAGCAAGAAAGTGG - Intronic
977334544 4:95679957-95679979 GCAAAGACACAGCAAGCGGGAGG - Intergenic
977980647 4:103317451-103317473 GTAAGGACACAGCAAGAAGGTGG - Intergenic
978178509 4:105764567-105764589 GTGAGGACACAGCAATATGGTGG - Intronic
978706469 4:111718793-111718815 TTCTAGACACAGCCAGAGGGGGG + Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
978924238 4:114223314-114223336 TTGAAGACACAGCGAGAAAGTGG - Intergenic
978944100 4:114473147-114473169 GTGATGGCACAGCAAGAAGGTGG + Intergenic
979071947 4:116219423-116219445 GTGAAGATACAACAAGAAGGAGG + Intergenic
979388592 4:120099912-120099934 GGGAAGACACAGCAAGAAGATGG - Intergenic
979565265 4:122147593-122147615 GTGAAGACACAGGAAGAAGATGG + Intergenic
980093155 4:128463133-128463155 GTGAGGACACAGCAAGAAGGCGG - Intergenic
980354272 4:131723706-131723728 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980354809 4:131726212-131726234 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980355344 4:131728689-131728711 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980355893 4:131731190-131731212 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980356428 4:131733681-131733703 CGGCAGACACAGCAAGAGGGAGG - Intergenic
980356967 4:131736169-131736191 GGGCAGACACAGCAAAAGGGAGG - Intergenic
980357507 4:131738661-131738683 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980358047 4:131741150-131741172 GGGCAGACACAGCAAAAGGGAGG - Intergenic
980358577 4:131743641-131743663 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980359120 4:131746114-131746136 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980360198 4:131751077-131751099 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980360742 4:131753552-131753574 GGGCAGACACAGCAAAAGGGAGG - Intergenic
980361284 4:131756032-131756054 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980361825 4:131758507-131758529 GGGCAGACACAGCAAAAGGGAGG - Intergenic
980362367 4:131760987-131761009 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980362907 4:131763470-131763492 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980378376 4:131977522-131977544 GGGCAGACACAGCAAGAGGGAGG + Intergenic
980528841 4:134024456-134024478 GTGAAAACAAAGCAAGAAGGTGG - Intergenic
980596815 4:134965858-134965880 CTGCAGACATGGCATGAGGGAGG - Intergenic
980627625 4:135393858-135393880 GAGAAGACACAGCAAGATGATGG - Intergenic
980800397 4:137741133-137741155 GTGAAGACACAGGAAGAAGGTGG + Intergenic
981444434 4:144819309-144819331 GTGAAGACACAGGAAGAAGACGG - Intergenic
981719841 4:147790178-147790200 GTGAGGACACAGCAAGAAGGTGG - Intronic
981768936 4:148284232-148284254 TTGAATCCCCAGCAAGAGGGGGG - Intronic
982221345 4:153127983-153128005 CTGAGGACAGAACAAAAGGGTGG - Intergenic
982881980 4:160731495-160731517 CTGAAGGCACAACAAAAGCGTGG - Intergenic
982951195 4:161698158-161698180 GTGAGGACACAGCAAGAAGATGG + Intronic
983052539 4:163065596-163065618 ATGAGGACACAGCAAGAAGATGG + Intergenic
983057806 4:163119381-163119403 CTGAAGACAGAAAAAGAGGCTGG - Intronic
983467049 4:168107717-168107739 GTAAAGACACAGCAAGAAAGTGG - Intronic
983898676 4:173109244-173109266 GTGAGGACACAGCAAGAAGGTGG - Intergenic
983930396 4:173447208-173447230 GTGAGGACACAGCAAGAAGATGG - Intergenic
983953265 4:173667309-173667331 GTGAGGACACAGTAAGAAGGAGG + Intergenic
984210078 4:176836590-176836612 CTGAGGACACAGCGAGAAGATGG + Intergenic
984546311 4:181108357-181108379 GTGAAAACACAGCAAGAAGAGGG - Intergenic
985175113 4:187192395-187192417 GTGAGGACACGGCGAGAGGGTGG + Intergenic
985287342 4:188349693-188349715 CTAAAGACAAAGCAAGAGAAGGG - Intergenic
985323928 4:188745970-188745992 CAGAAGACAGAGCATGAGAGAGG + Intergenic
1202766516 4_GL000008v2_random:153331-153353 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985944632 5:3168443-3168465 ATGAAGATACAGCAAGAAGATGG + Intergenic
986355030 5:6915595-6915617 CAGGAGCCACAGCAAGAGAGAGG + Intergenic
986532882 5:8757791-8757813 GTGAGGACACACCAAGAAGGTGG + Intergenic
986928188 5:12784278-12784300 GCGAGGACACAGCAAGAGGGTGG + Intergenic
987048813 5:14132266-14132288 CTGAGGACACAGCGAGGTGGAGG - Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987167769 5:15219141-15219163 GTGAGGACACAGCAAGAAGGTGG - Intergenic
987174079 5:15289280-15289302 GTGAGGACACAGCAAGAAGGTGG - Intergenic
987259516 5:16189318-16189340 CTGAAGACACAGGAAGGCAGAGG - Intergenic
987278519 5:16388440-16388462 GTGAGGACAAAGCAAGAAGGTGG + Intergenic
987306919 5:16645719-16645741 CTGAAGACACAGGAAGGCAGAGG + Intergenic
987463386 5:18243061-18243083 GTGAGGACACAGCAATAAGGTGG - Intergenic
987575844 5:19726943-19726965 ATGATGACACAGCAAGAAGATGG + Intronic
988029423 5:25743519-25743541 GTGAAGACACAGTGAGAAGGTGG - Intergenic
988320535 5:29689365-29689387 GTAAGGACACAGCAAGAAGGTGG + Intergenic
988413428 5:30915622-30915644 GTGAACACACAGCAAGAATGTGG - Intergenic
988492775 5:31718573-31718595 AAGCAGACACAGCAAGAAGGTGG - Intronic
988731499 5:33977141-33977163 ATGAGGACACAGCAAGAAGGCGG + Intronic
989004628 5:36796705-36796727 GTGAGGACACAGCAAGAAGGTGG - Intergenic
989118180 5:37977092-37977114 GTGAGGACACAGCAAGAGGATGG + Intergenic
989246805 5:39264290-39264312 GTGAGGACACAGCAAGAAGTTGG + Intronic
989304834 5:39941767-39941789 CTGAGAACACAGCAAGAAGTTGG - Intergenic
991335884 5:65546735-65546757 GTGAAGACACAGGAAGAAGATGG + Intronic
991996425 5:72391521-72391543 ATGAGGACACAGAAAGAAGGTGG + Intergenic
992070202 5:73141301-73141323 GTGAGGGCACAGCAAGAAGGTGG - Intergenic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992102666 5:73422307-73422329 ATGAAGACACAGCAAGCAGGTGG - Intergenic
992110579 5:73488784-73488806 ATGAGGACACAGCAAGAAGATGG - Intergenic
992152237 5:73916526-73916548 GTGAAGACGCAGGAAGAAGGTGG - Intronic
992191392 5:74295419-74295441 GGGAGGAGACAGCAAGAGGGTGG + Intergenic
992210182 5:74471523-74471545 GCGAGGACACAGCAAGAAGGTGG + Intergenic
992261209 5:74972093-74972115 ATGAAGACACAGCAGCAGGGTGG + Intergenic
992379555 5:76223884-76223906 GTACAGACACAGCAAGAAGGTGG - Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992883806 5:81137671-81137693 GTGAAGACACAGGAAGAAGACGG + Intronic
993057933 5:83003803-83003825 CTGAAGACAAAGCAAGCAGGAGG - Intergenic
993255077 5:85580549-85580571 GTGAAGACACAGTCAGAAGGAGG - Intergenic
993410763 5:87570437-87570459 GGGAGGACACAGCAAGAAGGTGG + Intergenic
993545781 5:89211365-89211387 GTGAGGACACAGTGAGAGGGTGG + Intergenic
993756112 5:91732608-91732630 TTGAAGACAAAGCAATAGAGTGG - Intergenic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
994117249 5:96074443-96074465 GTGAAGACACAGTGAGAAGGTGG + Intergenic
994254410 5:97576279-97576301 GTGAAGACACAGCAAGAAGGTGG + Intergenic
994920839 5:106040858-106040880 ATGAGGACACAGTGAGAGGGTGG - Intergenic
994984991 5:106921105-106921127 GTGAGGACACAGAAAGAAGGTGG - Intergenic
996581769 5:125039111-125039133 GTGAGGACATAGCAAGAAGGTGG - Intergenic
996993976 5:129672126-129672148 GTGAAGACACAGCTAGAAGTCGG - Intronic
997230710 5:132240340-132240362 GTGAGGACATAGCAAGAAGGTGG + Intronic
997370624 5:133357376-133357398 CTGAAGATGCAGCTAGAGAGAGG - Intronic
997432604 5:133851173-133851195 CTGAAGACTCTGCCAGTGGGAGG - Intergenic
997621339 5:135298207-135298229 GTGAAGACATAGCAAGAAGCAGG + Intronic
997738152 5:136229574-136229596 GTGAGGACACAGCAAGAAGGTGG + Intronic
997806898 5:136927112-136927134 GTGAGCACACAGCAAGAAGGTGG + Intergenic
998069105 5:139182777-139182799 CTGAGGACACAGGAGCAGGGGGG + Intronic
998352948 5:141512880-141512902 CGTGAGACACAGGAAGAGGGTGG - Exonic
998480709 5:142460347-142460369 GTGAGGACACAGCAAGAAGGTGG - Intergenic
999118638 5:149188577-149188599 GCGAAGACGCAGCAAGATGGCGG - Intronic
999592909 5:153168331-153168353 GTAAGGACACAGCAAGAAGGAGG - Intergenic
999625172 5:153512981-153513003 GAGAACACACAGCAAGATGGCGG + Intronic
999671511 5:153962741-153962763 AGGAAGACACAGCAAGAAGTCGG - Intergenic
1000041292 5:157486984-157487006 GTGAGAACACAGCAAGAGGGCGG + Intronic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000616201 5:163430317-163430339 GTGAAGACAGAGTAAGAAGGTGG + Intergenic
1001306581 5:170578896-170578918 CAGAAGGAATAGCAAGAGGGAGG + Intronic
1001533075 5:172478555-172478577 GTGAGGACACAGTAAGAAGGTGG - Intergenic
1001567052 5:172706628-172706650 GTGAAGACACAGCAAGAAAGTGG + Intergenic
1001668550 5:173454182-173454204 ATGAGGACATAGCAAGAAGGTGG + Intergenic
1001848804 5:174944810-174944832 TTGAGCACACAGCAAGAAGGTGG - Intergenic
1001986414 5:176077076-176077098 CTGAATCCACAGCAGGAGGTTGG - Intronic
1001999134 5:176187412-176187434 CTGAATCCACAGCAAGGGGTTGG + Intergenic
1002147711 5:177198422-177198444 ATGACGACACAGCAACAAGGTGG - Intronic
1002230453 5:177761049-177761071 CTGAATCCACAGCAGGAGGTTGG + Intronic
1002264883 5:178022698-178022720 CTGAATCCACAGCAGGAGGTTGG - Intronic
1002826397 6:777944-777966 ATGAAGACACAGGAAGATGAAGG + Intergenic
1002909760 6:1480745-1480767 ATGAGGACACAGCAAGGAGGTGG - Intergenic
1002965934 6:1966592-1966614 GTGATGACACAGCTGGAGGGTGG - Intronic
1003140429 6:3467043-3467065 CTGAGGACACAGCAACAATGGGG + Intergenic
1003305976 6:4929628-4929650 CTGAAGGCACAGCAATAGACAGG - Intronic
1003311191 6:4971215-4971237 GTGAGGACACAGCAGGAAGGTGG - Intergenic
1003856928 6:10285985-10286007 GTAAAGACACAGCAAGAAGATGG + Intergenic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1004022230 6:11786398-11786420 CTGAAGACAAGGCAAGTCGGCGG + Intronic
1004288929 6:14348971-14348993 GTGAGGACACAGCAGGAAGGCGG - Intergenic
1004410094 6:15373242-15373264 CTTGAGACAGAGCAAGAGGTGGG - Intronic
1004470970 6:15928793-15928815 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1004559170 6:16730863-16730885 CAGAACACTCAGCAAGAGGAAGG - Intronic
1004564918 6:16787305-16787327 GTGAGAACACAGCAAGAAGGTGG + Intergenic
1005104419 6:22207784-22207806 CTGAAGACATAGCAAGGGATTGG - Intergenic
1005161163 6:22865724-22865746 TTGAGGACACAGCAAGAGGATGG - Intergenic
1006375434 6:33669178-33669200 CCAAAGGCACAGGAAGAGGGAGG - Intronic
1007114902 6:39336446-39336468 CTGAAGCCAGAGCAAGTGAGGGG + Exonic
1007227982 6:40328171-40328193 CTGAAACCACAGGAAGAGTGGGG + Intergenic
1007500561 6:42293748-42293770 CTGAATACACAGCAACAGGGTGG - Intronic
1007630580 6:43270951-43270973 GTGAAGACACAGCAGAAGAGAGG + Intronic
1007710077 6:43817326-43817348 CTGATGACACAGCACGGGTGGGG + Intergenic
1007839982 6:44708195-44708217 GTACAGACACAGCATGAGGGTGG - Intergenic
1007971309 6:46054750-46054772 GTGGAGATACAGCAAGACGGTGG + Intronic
1008700682 6:54095930-54095952 CTGAAGTACCAGCAAGTGGGAGG - Intronic
1008852927 6:56046757-56046779 CAGAAGCCACAGCTAGACGGCGG + Intergenic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1009641062 6:66337445-66337467 GTGAGGACACAGCAAGAAGAAGG - Intergenic
1009895846 6:69747294-69747316 GTGAAGACAGAGCAAGAAGGTGG + Intronic
1010082727 6:71883128-71883150 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1010504240 6:76636896-76636918 GTGAAGATACAGCAAGAAGATGG + Intergenic
1010553436 6:77251427-77251449 ATGAGAACACAGCAAGAAGGTGG - Intergenic
1010554289 6:77259743-77259765 ATGAGGACATAGCAAGAAGGTGG - Intergenic
1011046296 6:83087046-83087068 TTCAGAACACAGCAAGAGGGAGG + Intronic
1011248937 6:85349891-85349913 GTGAAGACACAGGCAGAGGGTGG - Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1011521916 6:88216951-88216973 GTGAAGACCCAGCAAGAGAGTGG - Intergenic
1011824760 6:91292830-91292852 GTGAGGACCCAGCAAGAAGGAGG - Intergenic
1012049277 6:94319681-94319703 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1012794482 6:103742300-103742322 CTGAAGATATAGAAAGACGGAGG - Intergenic
1012996879 6:105983090-105983112 GTGAAGACACAGCAAGACAGTGG + Intergenic
1013350528 6:109301795-109301817 CTGAAGAAAAGGCAAGAGGCAGG + Intergenic
1013787590 6:113798954-113798976 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1013798739 6:113915284-113915306 GTGAGGACACAGTAAGAAGGTGG - Intergenic
1013948673 6:115753065-115753087 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1014060309 6:117064063-117064085 GTGAAGACACAGTGAGAAGGTGG + Intergenic
1014143806 6:117973166-117973188 GTGAAAGCACAGCAAGAAGGTGG - Intronic
1014707205 6:124762222-124762244 ATGAGGACACAGAAAGAAGGTGG - Intronic
1015719710 6:136228448-136228470 GTGAAGACACAGCAAGAAGATGG + Intergenic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016353174 6:143189981-143190003 GTGAGGACACAGCAAGAAGCTGG - Intronic
1016388037 6:143548161-143548183 GTGAGGACACAGCAAGAAGATGG - Intronic
1016485249 6:144530265-144530287 GTGAGGACACAGCAAGAAGGTGG - Intronic
1016645664 6:146405603-146405625 GTGAGCACACAGCAAGATGGTGG - Intronic
1016740989 6:147528380-147528402 GTGAGGACACAGTAAGAAGGTGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017733500 6:157339188-157339210 GTGAAGGCACAGCAAGAAGGTGG + Intergenic
1017780093 6:157709144-157709166 GTGAGGACACAGCAAGAAGGCGG - Intronic
1017780259 6:157710301-157710323 ATGAGGACACAGCAAGAAGGTGG - Intronic
1017888629 6:158621454-158621476 CTGAAAACCCAGGAAGAGGATGG - Intronic
1018212612 6:161496781-161496803 AGGGAGACACAGCAAGAAGGTGG + Intronic
1018223578 6:161606265-161606287 CTAAACACACAGCAGGAGGAAGG + Intronic
1018332179 6:162741452-162741474 GTGAGGACACAGCAAGAAGGTGG - Intronic
1018393526 6:163359294-163359316 CTGCGGACACAGGATGAGGGAGG + Intergenic
1018433439 6:163741680-163741702 CTGAAGACACAGCCAGCTGCGGG + Intergenic
1019073499 6:169368580-169368602 GCGAAGACACAGCAGGAGGGCGG + Intergenic
1019162414 6:170077698-170077720 CAGAGGACACAGCGAGAAGGCGG - Intergenic
1019182745 6:170201609-170201631 GTGAGGACACAGCAAGAAGATGG - Intergenic
1019864920 7:3698717-3698739 GTGAGGACACAGCGAGAAGGTGG - Intronic
1019867972 7:3730762-3730784 CCTCAGACATAGCAAGAGGGTGG + Intronic
1019967875 7:4514815-4514837 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1020215066 7:6183902-6183924 GTGAGGATACAGCAAGAAGGCGG + Intronic
1020266530 7:6564239-6564261 GTGAAGACACAGCATGAAGGCGG + Intergenic
1020405986 7:7834595-7834617 GTGAAGACACAGCAAGAAGGTGG - Intronic
1020530661 7:9329909-9329931 GTGAGGACACAGCAAGAAGATGG + Intergenic
1020835300 7:13142102-13142124 ATGAGGACACAGCAAGAAGACGG + Intergenic
1020876386 7:13700009-13700031 GTGAGGATACAGCAAGAAGGTGG - Intergenic
1021281763 7:18728300-18728322 CTGTAGACAAAGGAAGAGGTTGG - Intronic
1021462146 7:20900723-20900745 GTGAGGACACGGCAAGAAGGTGG - Intergenic
1021802221 7:24318316-24318338 CTGAGGACAAAGCAATTGGGCGG - Intergenic
1021872907 7:25020649-25020671 GTAAAGCCACAGCAAGAAGGTGG + Intergenic
1022201806 7:28124236-28124258 GTGAGGACACAGCGAGGGGGCGG + Intronic
1022407191 7:30101471-30101493 GTGAGGACACAGCAAGAAGGTGG - Intronic
1022425087 7:30261220-30261242 GTGAGGACACAGCAAAAAGGTGG - Intergenic
1022566596 7:31409411-31409433 ATGAAGACAAAGCAAGAAGGTGG + Intergenic
1023043598 7:36193482-36193504 CTGAAGGCAGAGGCAGAGGGAGG + Intronic
1023257520 7:38326794-38326816 CTAAAGACACAACCAGAGGTGGG - Intergenic
1023275078 7:38510204-38510226 ACGAGGACACAGCAAGAAGGTGG - Intronic
1023294636 7:38702124-38702146 CTGAAGTCACCTCAAGTGGGAGG + Intergenic
1023507685 7:40917760-40917782 CTGAGGACCCAGCAAGAAGGTGG - Intergenic
1023529488 7:41137523-41137545 CAGATGACACAGCAAGATGAAGG - Intergenic
1023680684 7:42684389-42684411 CTGAAGATAGAGGCAGAGGGAGG + Intergenic
1023856345 7:44186416-44186438 GTGAGGACACAGCAAGAAGGTGG + Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1023959453 7:44914185-44914207 CTGAAGGCACCCAAAGAGGGAGG - Intergenic
1024036824 7:45513825-45513847 GTGAGGATACAGCAAGAAGGCGG + Intergenic
1024269904 7:47634611-47634633 GTGAGGACACAGTAAGAAGGCGG - Intergenic
1024387454 7:48769249-48769271 GTGAGGACACAACAAGAAGGAGG - Intergenic
1024391061 7:48812994-48813016 GTGAAGAGACAGTAAGAGGGTGG + Intergenic
1025284013 7:57648301-57648323 GGGCAGACAGAGCAAGAGGGAGG + Intergenic
1025284358 7:57650180-57650202 GGGAGGACAGAGCAAGAGGGAGG + Intergenic
1025295621 7:57773493-57773515 CGGGAGACAGAGCAAGAGGGAGG - Intergenic
1025295890 7:57775099-57775121 GGGCAGACAGAGCAAGAGGGAGG - Intergenic
1025300749 7:57818306-57818328 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1026116793 7:67502599-67502621 ATGAGGACACAGCAGGAAGGTGG - Intergenic
1026330040 7:69344039-69344061 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1026493398 7:70882414-70882436 GTGAGGACAGAGCAAGAAGGCGG + Intergenic
1026661395 7:72305855-72305877 GTGAGGACAGAGCAAGAAGGTGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026883697 7:73923446-73923468 GTGAGGACACAGCAAGATGGCGG - Intergenic
1027409814 7:77904591-77904613 GTGAAGACACAGCAAGAAGGTGG - Intronic
1027882804 7:83863409-83863431 GTGAGGAGACAGCAAGAAGGAGG + Intergenic
1027949998 7:84803591-84803613 GTGAAGTCACAGCAAGAAGGTGG + Intergenic
1028403935 7:90456137-90456159 GTGAGGACACAGCAAAAAGGTGG + Intronic
1028744345 7:94310215-94310237 GTGAAGACACAGCGAGAAGGTGG + Intergenic
1028892266 7:96001665-96001687 GTGAAGACACAACAAGACAGTGG - Intronic
1029601572 7:101566617-101566639 GTGAAGACACAGCAAGAAGGCGG - Intergenic
1029921947 7:104274575-104274597 GTGAGGACACATCAAGAAGGTGG - Intergenic
1029978995 7:104860565-104860587 GTGAAGAGACTGCAAGATGGGGG - Intronic
1030208746 7:106975687-106975709 GTGAGGACACAGCGAGATGGTGG + Intergenic
1030698314 7:112610659-112610681 CTGAGGAGACAGCAAGAGATTGG - Intergenic
1030833522 7:114255473-114255495 CTGAAGACTCAGCAACTGCGGGG + Intronic
1031035774 7:116786150-116786172 GTGAGGACACAGCAAGAAGGTGG - Intronic
1031061984 7:117062077-117062099 GTGAAGACACTGCAAGAAAGTGG - Intronic
1031291974 7:119949467-119949489 GTGAAGAAACATAAAGAGGGTGG - Intergenic
1031427841 7:121629080-121629102 ATAAAGACACAGCAAGAAGAGGG + Intergenic
1032546480 7:132748060-132748082 GTGAAGACACAGAGAGAAGGTGG - Intergenic
1032642712 7:133787654-133787676 GTGAAGACACAGCAAGGAGGAGG - Intronic
1032751319 7:134844766-134844788 GTGAAGACACAGGGAGAAGGTGG - Intronic
1032762453 7:134956506-134956528 ATGAGGACACAGCAGGAAGGTGG + Intronic
1032796334 7:135279321-135279343 GTGAGGACACAGCTAGAAGGTGG + Intergenic
1032900030 7:136296647-136296669 ATGAGGACACAGCAAGAAGGCGG + Intergenic
1033044253 7:137947131-137947153 CTAAGGACACAGCAAGAAGGTGG + Intronic
1033208753 7:139444566-139444588 GTGAGGACACAGTGAGAGGGTGG + Intergenic
1033818453 7:145103913-145103935 CTAAAGACAGAGCAGGAGGTGGG + Intergenic
1033952762 7:146805572-146805594 AGGAAGGAACAGCAAGAGGGAGG + Intronic
1034031783 7:147774647-147774669 GTGAGGACACAGCAAGAAGGTGG + Intronic
1034042882 7:147897954-147897976 CAGAAGACACAGCTTCAGGGTGG + Intronic
1034570530 7:151952262-151952284 GTGAGGACAAAGCAAGAAGGTGG + Intergenic
1034707900 7:153162800-153162822 GTGAGGACACAGCAAAAAGGGGG + Intergenic
1034874871 7:154716317-154716339 TAAAAGACACAGCAAGAGTGGGG - Intronic
1035050096 7:155993774-155993796 GTGAAGACACAGGGAGAGGGCGG - Intergenic
1035061437 7:156072298-156072320 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1035116881 7:156532315-156532337 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1035276673 7:157752142-157752164 CTGCAGACACAGCAGGCAGGTGG - Intronic
1035526244 8:315507-315529 GTGAAGACACAGGGAGAGGATGG - Intergenic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036693472 8:10959539-10959561 GTGAGGACACAGCAAGAAGGTGG - Intronic
1036774201 8:11598907-11598929 GTGAGGACACAGCAAGAATGTGG + Intergenic
1036943637 8:13074080-13074102 ATGAAGACACAGCTATAGGGTGG - Intergenic
1037219082 8:16495350-16495372 CTGAGTACACAGCAAGAAGACGG + Intronic
1037396571 8:18449907-18449929 ATGAAGACACAGGAAGAAGGTGG - Intergenic
1037443613 8:18942667-18942689 GTGAAGACACAGGGAGAAGGTGG + Intronic
1037595029 8:20347841-20347863 CAGGAGAGACAGCAAGAAGGGGG + Intergenic
1037772026 8:21807616-21807638 GTGAGGACACAGCAAGAAGGTGG - Intronic
1037844552 8:22271610-22271632 GTGAGGACACAGCAAGATGGCGG - Intergenic
1037943508 8:22972508-22972530 CTGGAGGCATAGCAAGAAGGAGG - Intronic
1037983078 8:23269049-23269071 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1038146767 8:24904558-24904580 GTGAAGACACAGGGAGAGGACGG + Intergenic
1038208722 8:25494898-25494920 GTGAGGACACAGCAAGAAGGTGG + Intronic
1038276680 8:26127195-26127217 GGGAGGACACAGCAAGAGGGCGG - Intergenic
1038286840 8:26212819-26212841 CTGAGGACACAGTAAGAAGACGG + Intergenic
1038431324 8:27502620-27502642 GTGAGGATACAGCAAGAAGGTGG - Intronic
1038433683 8:27519931-27519953 GTGAGGACACAGGAAGAAGGTGG - Intronic
1038529275 8:28304522-28304544 ATGAGGACACAGCAAGAAGGTGG - Intergenic
1038818962 8:30934642-30934664 GTGAGGACACAGGAAGAAGGTGG + Intergenic
1038845649 8:31226999-31227021 GTGAGGACACAGCAAGAAGGCGG - Intergenic
1039041560 8:33413408-33413430 GTAAGGACACAGCAAGAAGGTGG + Intronic
1039100300 8:33934503-33934525 GCTAAGACACAGCAAGAAGGTGG - Intergenic
1039163504 8:34649698-34649720 GTGAAGACATAGCAAGAAGGTGG - Intergenic
1039208752 8:35187157-35187179 GTGAGGACACTGCAAGAAGGTGG - Intergenic
1039722973 8:40184680-40184702 GTGAGGACACAGCAAGAAGACGG + Intergenic
1039780033 8:40775945-40775967 GTGAGGATACAGCAAGAAGGCGG + Intronic
1039800409 8:40949802-40949824 GTGAAGACACAGAAAGAAGGTGG + Intergenic
1039818513 8:41115782-41115804 CTGGAGAAAGAGCAAGAGTGGGG - Intergenic
1040859661 8:51986028-51986050 CTGAGGACACAGTGAGAAGGTGG + Intergenic
1041377007 8:57215537-57215559 CTGATGGCACAGCAGCAGGGAGG + Intergenic
1041466321 8:58161060-58161082 GTGACGGCACAGCAAGAAGGTGG - Intronic
1041741832 8:61164737-61164759 ATACAGACACAGAAAGAGGGGGG - Intronic
1041914202 8:63123115-63123137 CTGAAACCTCAGCAACAGGGTGG + Intergenic
1041970953 8:63742172-63742194 CTGAGGACACAGCACGAAGGTGG + Intergenic
1042058774 8:64794542-64794564 GTGAGGACACAGCAAGAAGATGG - Intronic
1042106242 8:65329463-65329485 CTGAAGACAGAGAAAGAAAGAGG + Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042455822 8:69001466-69001488 GTGAGGACACAGCAAGAAAGTGG - Intergenic
1043055935 8:75438533-75438555 ATGAAGAGAGAGAAAGAGGGAGG - Intronic
1043208342 8:77476345-77476367 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1043585227 8:81760853-81760875 CAGAAGACAGAGAAAGAGAGAGG + Intergenic
1043880562 8:85537842-85537864 CTCAATACAAAGCAAGAGGATGG - Intergenic
1044321254 8:90803930-90803952 CTGAGAACACAGGGAGAGGGTGG - Intronic
1044364423 8:91326410-91326432 GTGAGGAAGCAGCAAGAGGGAGG - Intronic
1044544903 8:93448777-93448799 ATGAGGACACAGCAAGAAGATGG + Intergenic
1044937338 8:97305831-97305853 GTGAAGACACAGCAAGAAGATGG - Intergenic
1045429046 8:102096278-102096300 GTGAAGACACAGGGAGAGGAAGG - Intronic
1045646942 8:104308454-104308476 GTGAGGACACAGCAGGAAGGCGG + Intergenic
1045660550 8:104433063-104433085 GTGAAGACACAGGAAGAAGATGG + Intronic
1045680337 8:104652969-104652991 CTGAGCAAACAGCAAGAGGGCGG - Intronic
1045754855 8:105530532-105530554 GTGTGGACACAGCAAGAAGGCGG - Intronic
1045793981 8:106021009-106021031 GTGAAGACACAGTGAGAAGGCGG + Intergenic
1045980799 8:108184995-108185017 GTGAGGACACAGCACGAAGGTGG + Intergenic
1046290808 8:112158030-112158052 CTGAAGCCACAGCAAGAATGTGG - Intergenic
1046622713 8:116545186-116545208 ATGAGGACACAGCTAGAAGGCGG - Intergenic
1046625460 8:116572263-116572285 GAGAAGAGACAGCAAGAGAGCGG - Intergenic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047202025 8:122775503-122775525 GTGAGGACACAGCAAGAAGATGG - Intergenic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1047612038 8:126530439-126530461 GTGGAGACACAACAAGAAGGTGG - Intergenic
1048140621 8:131790813-131790835 GCGAAGACACATCAAGAAGGTGG - Intergenic
1048150299 8:131887282-131887304 GTGAAGACACAGTAAGAAGGTGG - Intergenic
1048314378 8:133351270-133351292 GTGAGGACACAGCAAGAAAGTGG - Intergenic
1048761663 8:137802276-137802298 GTGATGACACAGTAAGAAGGTGG - Intergenic
1048878718 8:138856674-138856696 CAGGAGAGACAGCAAGAGAGAGG + Intronic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049368366 8:142251774-142251796 CTGAAGACAGAGAACGTGGGCGG - Intronic
1049368390 8:142251862-142251884 CTGAAGACAGAGAATGCGGGCGG - Intronic
1049825874 8:144667410-144667432 CTGCAGAGACAGGATGAGGGAGG - Intergenic
1050385732 9:5088745-5088767 GTGAGGACACAGCAAGAAGATGG - Intronic
1050593146 9:7180542-7180564 CAGCAGATATAGCAAGAGGGAGG + Intergenic
1050605938 9:7301187-7301209 ATGAGGACATAGCAAGAAGGTGG + Intergenic
1050834197 9:10055053-10055075 GTGAGGACCCAGCAAGAAGGTGG + Intronic
1051188394 9:14484969-14484991 GTGACAACACAGCAAGAAGGTGG - Intergenic
1051596133 9:18825995-18826017 GTGATGAGACAGGAAGAGGGAGG - Intronic
1052211126 9:25904830-25904852 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1052406540 9:28068323-28068345 GTGAGCACACAGCAAGATGGTGG - Intronic
1052675504 9:31617264-31617286 GTGAGTACACAGCAAGAAGGTGG + Intergenic
1052877287 9:33576370-33576392 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1053039930 9:34862046-34862068 GTGAGGACACAGCAAGAAGTTGG - Intergenic
1053348779 9:37397743-37397765 GGGAAGACATAGCAAGAAGGTGG - Intergenic
1053359497 9:37474239-37474261 GTGAGGATACAGCAAGAAGGTGG + Intergenic
1053498715 9:38568024-38568046 CTGGAGACAGGGCAAGAGGAAGG - Intronic
1053578055 9:39372777-39372799 GTGAGGACACAGTAAGAAGGTGG - Intergenic
1053585596 9:39455269-39455291 ATGAACACACAGCAAGAAAGTGG + Intergenic
1053662477 9:40293281-40293303 CTGGAGACAGGGCAAGAGGAAGG + Intronic
1053749103 9:41235444-41235466 CTGGAGTCTCAGCGAGAGGGTGG - Intergenic
1053793075 9:41700365-41700387 GGGGAGACAGAGCAAGAGGGAGG + Intergenic
1053842581 9:42200832-42200854 GTGAGGACACAGTAAGAAGGTGG - Intergenic
1053912931 9:42923456-42923478 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054099639 9:60931563-60931585 GTGAGGACACAGTAAGAAGGTGG - Intergenic
1054121036 9:61207187-61207209 GTGAGGACACAGTAAGAAGGTGG - Intergenic
1054152100 9:61614459-61614481 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1054181483 9:61912386-61912408 GGGGAGACAGAGCAAGAGGGAGG + Intergenic
1054254542 9:62800297-62800319 CTGGAGTCCCAGCGAGAGGGTGG - Intergenic
1054336761 9:63815305-63815327 CTGGAGTCTCAGCGAGAGGGTGG + Intergenic
1054374606 9:64439506-64439528 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054453634 9:65417790-65417812 GTGAGGACACAGTAAGAAGGCGG + Intergenic
1054471874 9:65545603-65545625 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1054580714 9:66909956-66909978 ATGAACACACAGCAAGAAAGTGG - Intronic
1054586703 9:66975321-66975343 GTGAGGACACAGTAAGAAGGTGG + Intergenic
1054764147 9:69029007-69029029 AGGAAGAGGCAGCAAGAGGGCGG - Intergenic
1055297494 9:74849476-74849498 CTGAAGACACAATAAGAAGGTGG + Intronic
1055392994 9:75843443-75843465 GTGAGCACACAGCAAGATGGTGG + Intergenic
1055566781 9:77577533-77577555 CTGATGACAGTGCTAGAGGGAGG - Intronic
1055696045 9:78885443-78885465 GTGAGGTCACAGCAAGAAGGGGG - Intergenic
1055803755 9:80069598-80069620 GTGAGGACACAGCAAGAAGTTGG + Intergenic
1055808408 9:80122389-80122411 GTGAGGACACTGCAAGAAGGTGG + Intergenic
1055902147 9:81252854-81252876 CTGAGGACACAACAAGAAGGTGG + Intergenic
1055904128 9:81273023-81273045 GTGAAGACACAGACAGAAGGTGG + Intergenic
1055917410 9:81419436-81419458 GTGAAGACACCAGAAGAGGGTGG - Intergenic
1055957460 9:81787514-81787536 GTGAAGACAGAGCCAGAAGGCGG - Intergenic
1056260969 9:84848022-84848044 GTGAGGACACAGCAAGAAGGTGG - Intronic
1056744726 9:89290507-89290529 GTGAACACACAGCATGAAGGTGG - Intergenic
1056906142 9:90649547-90649569 ATGAGGACACAGCAGGAAGGTGG + Intergenic
1056944664 9:90984167-90984189 CTGAAGGCAAAGCAAGGGAGGGG - Intergenic
1057161768 9:92894322-92894344 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1057237161 9:93370821-93370843 GTGAAGGCAAAGCAAGAAGGTGG - Intergenic
1057678166 9:97152517-97152539 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1057706325 9:97397671-97397693 CTGAGGACACAACAAGAAGCTGG - Intergenic
1057843651 9:98505714-98505736 GTGAAGACAGAGGCAGAGGGTGG + Intronic
1058145260 9:101403657-101403679 GTGAAGACACAGTAATAAGGTGG - Intronic
1058482531 9:105411391-105411413 ATGGAGACAGAGCAAGAGAGAGG - Intronic
1058483161 9:105417399-105417421 CTGAAGACCAAGCAGGAGGGAGG - Intronic
1058547639 9:106077844-106077866 CTGTAGCCATAGCAACAGGGAGG - Intergenic
1059085913 9:111302830-111302852 GTGAGGACACAGCGAGAAGGTGG - Intergenic
1059358478 9:113719752-113719774 GTGAGGACACAGCGAGAAGGCGG + Intergenic
1059419800 9:114183769-114183791 CTGGAGACAGAGCCAGGGGGAGG + Intronic
1059496994 9:114718239-114718261 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059910148 9:119034362-119034384 GTGAAGACACAGGGAGAGGATGG - Intergenic
1060034112 9:120240368-120240390 CTGAAGAGCCAGCAGGAGGGGGG + Intergenic
1060050930 9:120377625-120377647 ATGCAGACACAGCAAGAAGATGG - Intergenic
1060222205 9:121770521-121770543 GTAAAGGCACAGCAAGAGGCAGG - Intronic
1060337767 9:122742718-122742740 AAGAACACACAGCCAGAGGGTGG - Intergenic
1060986859 9:127825071-127825093 CAGAAGACGCAGCAGGAGTGGGG - Intronic
1061609699 9:131738572-131738594 CTGTCCAGACAGCAAGAGGGCGG - Intronic
1061712170 9:132495847-132495869 GTGAAGATACAACAAGAAGGCGG + Intronic
1061785251 9:133023928-133023950 GTGAGGTCACAGCAAGAAGGCGG - Intergenic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062214070 9:135379568-135379590 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1062514823 9:136927527-136927549 CTGAAGACACGGGAAGAGACTGG - Intronic
1062610059 9:137369552-137369574 CTGGGGACACAGCAAGGGGCAGG + Intronic
1203708033 Un_KI270742v1:69866-69888 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1203547271 Un_KI270743v1:138209-138231 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1185959242 X:4529449-4529471 GTGAGGGCACAGCAAGAAGGCGG + Intergenic
1185986923 X:4845213-4845235 GTGAAGACACAGGGAGAAGGTGG + Intergenic
1186012598 X:5151658-5151680 GTGAAGACACAGCAGGGAGGTGG + Intergenic
1186146741 X:6632140-6632162 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1186372143 X:8958197-8958219 CTGAAGACAGAGCAAGAGAAGGG - Intergenic
1186439255 X:9571191-9571213 GTGAGGACACAGCAAGAAGGCGG - Intronic
1186793970 X:13025962-13025984 CTTAAGCCACAGTGAGAGGGTGG - Intergenic
1186929038 X:14367832-14367854 GTTAGGACACAGCAAGAAGGTGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187338923 X:18404244-18404266 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1187495199 X:19789526-19789548 GTGAGGACACAGCAAGCAGGTGG - Intronic
1187536880 X:20149053-20149075 GTGAAGAGGCAGCAAGAGGGCGG + Intergenic
1188266357 X:28080716-28080738 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1188434641 X:30147263-30147285 GGGAAGCAACAGCAAGAGGGTGG - Intergenic
1188459346 X:30405440-30405462 ATGAAGATACAGGAAGAAGGTGG - Intergenic
1188643382 X:32534647-32534669 GGGAGGACACAGCAAGAAGGAGG - Intronic
1189025558 X:37390125-37390147 GTGAGGACACAGCAATAAGGTGG - Intronic
1189275199 X:39780423-39780445 GTGAAGACACAGCGAGAAGACGG + Intergenic
1189286952 X:39858445-39858467 GTGAAGACACAGCAATAAGGTGG - Intergenic
1189339077 X:40190858-40190880 AGGGAGACACACCAAGAGGGAGG + Intergenic
1189775943 X:44470245-44470267 GTGAGGACACAGCAAGAAGTTGG + Intergenic
1189859884 X:45261558-45261580 GTGAAGACACAGTGAGAAGGTGG - Intergenic
1190018454 X:46849999-46850021 GTGATGACATAGCAAGAGGTTGG + Intronic
1190104563 X:47550152-47550174 CTGAGCACACAGCGAGAGAGCGG - Intergenic
1190104931 X:47553172-47553194 GTGAGGACACAGCAAGAAGGTGG - Intergenic
1190283760 X:48948628-48948650 CTGATGACAAAGCCAGTGGGTGG - Intronic
1190792210 X:53711024-53711046 GTGAAGAGGCAGCAAGAGAGAGG + Intergenic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191146307 X:57169059-57169081 GTGAAGACACAGTGAGAAGGTGG - Intergenic
1193369646 X:80679017-80679039 GTGAGGACAAAGCAAGAAGGTGG + Intronic
1193533057 X:82679439-82679461 CTGAGGACACAGCAAAAAGATGG + Intergenic
1194310912 X:92305396-92305418 GTGAGCACACAGCAAGACGGTGG - Intronic
1194597524 X:95877167-95877189 GTGAGGACACAGCAAGAAGATGG - Intergenic
1195016140 X:100783304-100783326 ACGAAGACACAGCAAGAAAGTGG + Intergenic
1195096689 X:101508413-101508435 GTGACGACACAACAAGAAGGTGG - Intronic
1195208820 X:102630745-102630767 GTGACGACACAGCAAGATGGTGG + Intergenic
1195406028 X:104514351-104514373 ATGAAGACACAGTGAGAAGGAGG - Intergenic
1195818469 X:108915387-108915409 GTGAGGACATAGCAAGAAGGTGG + Intergenic
1195934581 X:110112725-110112747 GTGAAGAGGCAGCATGAGGGTGG - Intronic
1196291469 X:113946738-113946760 CAGAAGCCAAAGCAAGAGAGAGG + Intergenic
1196573827 X:117295405-117295427 GTGAGGACACAGCAAGAATGTGG - Intergenic
1197033938 X:121852654-121852676 GTGAGGACTCAGCAAGAAGGTGG - Intergenic
1197253585 X:124239525-124239547 ATGATGACAGAGCAAAAGGGAGG - Intronic
1197265131 X:124361253-124361275 ATGAGCACACAGCAAGAAGGCGG + Intronic
1197456688 X:126684688-126684710 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1197531923 X:127639276-127639298 GTGAAGACACAGTGAGAAGGTGG + Intergenic
1197823239 X:130562888-130562910 ATGAGGACACAGCAAGAAGGTGG - Intergenic
1197973612 X:132141207-132141229 CTGAGGACTCAGCAAGAAGGTGG + Intergenic
1198256859 X:134931641-134931663 GTGAAGACACAGGATGAAGGTGG + Intergenic
1198691051 X:139284973-139284995 GTGAGGACACAGCAAGAAGGTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199245922 X:145604186-145604208 AAGAAGACAAAGCAAGATGGTGG + Intergenic
1199417254 X:147599524-147599546 GTGAGGACACTGCAAGAAGGGGG + Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1199736577 X:150692025-150692047 GTGAGTACACAGCAAGAAGGTGG - Intergenic
1199881800 X:151979386-151979408 AGGAAGACACAGCTAGAGGGAGG + Intergenic
1199948761 X:152688691-152688713 GTGAAGACACAGGAAGAGAATGG + Intergenic
1199960915 X:152779758-152779780 GTGAAGACACAGGAAGAGAATGG - Intergenic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200386232 X:155893632-155893654 CTGAGAACACAGCAAGAAGGTGG - Intronic
1200458188 Y:3418501-3418523 ATGAACCCACAGCAAGAAGGCGG + Intergenic
1200619188 Y:5419671-5419693 GTGAGCACACAGCAAGACGGTGG - Intronic
1201281773 Y:12348850-12348872 CTGAAGACAGGGGAAGAAGGCGG - Intergenic
1201665982 Y:16455130-16455152 AAGAGGACACAGCAAGAAGGTGG - Intergenic