ID: 1095353019

View in Genome Browser
Species Human (GRCh38)
Location 12:41237173-41237195
Sequence AGGCACTTCTTGGGAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095353010_1095353019 3 Left 1095353010 12:41237147-41237169 CCTTCTTGATACTGGTGCCCCCT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG 0: 1
1: 0
2: 2
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095353019 Original CRISPR AGGCACTTCTTGGGAAAAAT GGG Intronic
900631907 1:3640932-3640954 AGGCACATCTTAGGAAACACAGG + Intronic
900735496 1:4297197-4297219 AGGAACTGCTTGGGAAGAATGGG + Intergenic
901406795 1:9054138-9054160 AGGAACTTCATGGAGAAAATCGG + Intronic
902104469 1:14022880-14022902 AGACACTTCATGGTAGAAATGGG - Intergenic
903857690 1:26346353-26346375 ATGTACTTCTTGGAAAAGATGGG + Exonic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905324792 1:37143915-37143937 ATGTACTTCTATGGAAAAATAGG + Intergenic
905528516 1:38657686-38657708 AGCCCCTTCTTTGTAAAAATGGG + Intergenic
906167550 1:43698201-43698223 AGGTACTTCTAGGGAAAATAGGG - Intronic
907822108 1:57980366-57980388 AGGAAGTGCTTGGGAAAAGTGGG - Intronic
912551982 1:110490482-110490504 AGCCTCATCCTGGGAAAAATGGG + Intergenic
913435904 1:118847427-118847449 AGGCACTTGTTCAGATAAATAGG + Intergenic
913472753 1:119205930-119205952 TGTCACTTCTTGGAAAAACTTGG - Intergenic
915299153 1:154942131-154942153 AGGCCCTACTTGGGCAAACTTGG + Intergenic
917048873 1:170895392-170895414 AGGAACTTCAAGGGAGAAATGGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918555557 1:185795384-185795406 ATGCAGCTCTTGGGAAAAAAAGG - Intronic
918569871 1:185977013-185977035 AGGCACATCTTGGAAAACATAGG - Intronic
920447826 1:206033154-206033176 AGGTACTTTTGGGGAAAAGTTGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921559450 1:216639717-216639739 ATGTAATTCTTGAGAAAAATAGG + Intronic
922252322 1:223860784-223860806 AGGCAGCTCTTCTGAAAAATGGG + Intergenic
923061705 1:230481482-230481504 AGGCTTTTCTTGGGCAAAGTTGG - Intergenic
923255078 1:232215042-232215064 GGGCACTTCTGGGGAGAGATTGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063092830 10:2882924-2882946 TGGCTCTTCTTGTGAAAATTTGG + Intergenic
1066607600 10:37195837-37195859 AGGCCTTTGATGGGAAAAATTGG + Intronic
1067210987 10:44260484-44260506 AGGCACATCTGGGGAGGAATGGG - Intergenic
1067565523 10:47333514-47333536 AGTGACTTCTGGAGAAAAATTGG - Intergenic
1069026922 10:63552478-63552500 AGGCACTACTTGGGCAACTTGGG - Intronic
1070058044 10:72954128-72954150 AGGCAGTTCTTAGGAAAAAAGGG - Intronic
1072297066 10:94019408-94019430 AGCCACTTTTTGAGAAATATTGG - Intronic
1072304295 10:94092490-94092512 AGGGACATCTTTGAAAAAATAGG + Intronic
1073207857 10:101778208-101778230 AGGCACTTCCTGTAAGAAATGGG + Intronic
1074448771 10:113541938-113541960 AGGCTCTTTTTGGAAATAATAGG + Intergenic
1076133301 10:128028467-128028489 CTGCATTTCTTAGGAAAAATGGG + Intronic
1079933100 11:26589591-26589613 AGGGACTTTTGGGGGAAAATAGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082229493 11:49745766-49745788 AGGAACTTGTTGGGATAACTAGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1083728006 11:64638297-64638319 AGACACTTCTTGGGCAGAAGAGG + Intronic
1085013462 11:73157434-73157456 AGTCTCTTCTTGGGACAGATGGG - Intergenic
1086849295 11:91790618-91790640 AGGCACTGTCTGGGAAAAAAGGG + Intergenic
1088318377 11:108530436-108530458 AAGCACTTCCTGGGACAAACAGG + Intronic
1091464245 12:669929-669951 AGGCACCTCTTGGGAACCAATGG + Intergenic
1091697136 12:2635245-2635267 AGGCACCTCTTGGGAGAAGGAGG - Intronic
1091966417 12:4746178-4746200 AGGCACTTCCTGGGAGAGATCGG + Exonic
1092128623 12:6092974-6092996 AGGCACTTCAAGGGAGAAAGGGG - Intronic
1092670460 12:10855508-10855530 AGGAACTTATTGGGAACAACTGG + Intronic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1095467559 12:42503931-42503953 AGGGAATTCTTGGGGAAAAGTGG + Intronic
1095922155 12:47542452-47542474 AGGCCCTTGTTGGGAGAACTTGG + Intergenic
1097626246 12:62003899-62003921 ATGCACTTCTTGTGAAAAATGGG - Intronic
1098871906 12:75826020-75826042 AGGCACATACTGGGGAAAATGGG - Intergenic
1098928363 12:76379489-76379511 AGGAACTTTTTGGGGATAATGGG - Intronic
1100650749 12:96585845-96585867 AGGGACTTCTTGGGAAAGCTTGG - Intronic
1101292043 12:103380417-103380439 AAGCACTTCTTGGCAAAAGCAGG + Intronic
1101455279 12:104825169-104825191 ATGCACCTCTAGGAAAAAATTGG - Intronic
1101734342 12:107451973-107451995 AGGCACATCTTTAGCAAAATGGG - Intronic
1101750459 12:107579111-107579133 AGGAACGTCTAGGGAGAAATGGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108617677 13:52150046-52150068 AGGGACTTATTGGGACAATTGGG - Intronic
1109552999 13:63930317-63930339 AGAAACTTCTGAGGAAAAATTGG - Intergenic
1111600163 13:90462558-90462580 ACGCACTTCTTGGGAACATCAGG - Intergenic
1112124209 13:96446943-96446965 AGGCACACCTAGGGAAAAAGAGG - Intronic
1115035555 14:28852538-28852560 GGGAACATCATGGGAAAAATGGG - Intergenic
1115363752 14:32533298-32533320 AGGCACCTACTGGGAAAAAAGGG + Intronic
1116915541 14:50521503-50521525 AGTTTCTTCTTGGGTAAAATAGG + Intronic
1118172529 14:63402080-63402102 AAGCACTTATTGGAAATAATGGG + Intronic
1118994871 14:70826691-70826713 GAGCAGTTCTTGGGAAAAAGGGG - Intergenic
1119821392 14:77619168-77619190 AGGTACTTCTTCTGTAAAATGGG + Intergenic
1120348869 14:83327186-83327208 AGGCACATATTGGAAAAAATTGG - Intergenic
1120523160 14:85548024-85548046 AGGAACTGCTTGGGCAAACTTGG - Intronic
1120640644 14:87007554-87007576 AGGCACTTGGGGGGAAAAAGAGG + Intergenic
1121066731 14:90974158-90974180 AATCACTAATTGGGAAAAATCGG + Intronic
1124599462 15:31120285-31120307 TGGAACTTATTGGGATAAATAGG + Intronic
1126589972 15:50329027-50329049 AGGCTCTCCTTGGCCAAAATTGG - Intronic
1127000641 15:54500379-54500401 AAGAAAATCTTGGGAAAAATGGG - Intronic
1128377935 15:67090501-67090523 AGTCATTTGTTGGGAAGAATGGG + Intronic
1130082310 15:80744674-80744696 AGTGACTTGTTGGGAAAAAAGGG - Intronic
1130090281 15:80815074-80815096 ATTCACTTCTTTGGAAAAACCGG + Intronic
1132257083 15:100385037-100385059 AGGCACTCCTTAGGAAAGAGAGG - Intergenic
1140707761 16:77646709-77646731 AGGAAGCTCTTGGGAGAAATAGG + Intergenic
1143533301 17:7519175-7519197 AAGCACTTCTTGAGATAAAGAGG - Intergenic
1145901965 17:28495400-28495422 AGGGCCTTCTTGGGAAATTTGGG - Intronic
1149422328 17:56522487-56522509 AGGGACTACCTGGGAAAACTGGG + Intergenic
1150839590 17:68595521-68595543 AGGCTCTAATTGGGAGAAATGGG + Intronic
1151348103 17:73515662-73515684 AGGGGCTTCTTGGGAAGAAGGGG + Intronic
1153377709 18:4399828-4399850 AGGCAGGTCTTGGGAAATACAGG - Intronic
1154040347 18:10848969-10848991 AGACACTTCTTGACAAAAAGAGG - Intronic
1156480449 18:37433164-37433186 AGTCACTTCTTGGGGAAGAGGGG - Intronic
1163380064 19:16960117-16960139 AGGCACTCCTTAGGAAACAGAGG - Intronic
1164833643 19:31341927-31341949 AGGCATTTATTGGAAAAGATGGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168419239 19:56190382-56190404 AGGCTCTTCTTGGGAAATGGAGG + Exonic
1168421751 19:56208623-56208645 AGGCTCTTCTTGGGAAATGGAGG - Exonic
1168423694 19:56222130-56222152 AGGCTCTTCTTGGGAAATGGAGG + Exonic
1168427017 19:56246905-56246927 AGGCCCTTCTTGGGAAATGGAGG - Exonic
925651086 2:6090094-6090116 AGGGACATCTTGGAAACAATTGG + Intergenic
926257677 2:11222150-11222172 AGGTACGACTTGGGAGAAATGGG - Exonic
926798079 2:16635243-16635265 AGGAACATGTTGGGAAAAGTAGG - Intronic
926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG + Intergenic
927910060 2:26891145-26891167 AGGTTCTTCTTGGTAAAAATGGG + Intronic
928043037 2:27897347-27897369 AGACACTTCTTTGGAATAGTAGG + Intronic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
929036660 2:37699657-37699679 AGCCCCTTCTTGGGAAAAACAGG - Intronic
930115365 2:47713454-47713476 AGGGACTTTGTAGGAAAAATTGG - Intronic
930297417 2:49572291-49572313 AAGCTCTTCTTGGGGAAAACTGG - Intergenic
931989024 2:67770889-67770911 AATCAGTTCTTGGGAAAAAGGGG - Intergenic
932399358 2:71469129-71469151 AACCGCATCTTGGGAAAAATGGG + Intronic
934575470 2:95397866-95397888 AGGCACTTCAGAGGAAAAAGCGG + Intergenic
936904604 2:117522805-117522827 TTGCACTTCATGGGAAAAATAGG - Intergenic
937156999 2:119727361-119727383 AATCAATTCTTGGGATAAATTGG - Intergenic
937238718 2:120446651-120446673 ATGCATTTCTTGGGCCAAATGGG + Intergenic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941739076 2:169013921-169013943 AGGCATTTCTAGGCAGAAATTGG - Intronic
945405034 2:209435739-209435761 AGGTACTTCTTTGGAAATTTTGG + Intronic
945889506 2:215413508-215413530 AGGGACTTCATGGAAAAAGTAGG - Intronic
945988520 2:216373338-216373360 AGAAACTCCTTGAGAAAAATAGG - Intergenic
948160884 2:235823103-235823125 AGAAACTACTTGGAAAAAATAGG - Intronic
1169088860 20:2845060-2845082 AGGCAATGCTGGGGAAAAGTTGG + Intronic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1178484001 21:33005571-33005593 AGGAACTTTTTGTGAAGAATGGG + Intergenic
1180076725 21:45466935-45466957 AGGCACTTCTTATGAGAAAAAGG + Intronic
1185404853 22:50642019-50642041 AGGCTCTTCTCGGGAAGAAGGGG - Intergenic
949243068 3:1894035-1894057 AGTTTCTTCATGGGAAAAATGGG - Intergenic
949589632 3:5480587-5480609 AGGCAAATCTTAGGAAAAAATGG + Intergenic
949777015 3:7645092-7645114 AGGCTCATTTTGGGGAAAATGGG - Intronic
954297111 3:49680416-49680438 AGGCACTTCTCGGGGAGAAAAGG + Intronic
954966406 3:54615110-54615132 AAGCACTTCTTCGCAGAAATTGG + Intronic
956288719 3:67638847-67638869 AGCCAGTTATTGGCAAAAATTGG - Intronic
957015752 3:75062989-75063011 GGGGACTTCTGGGGAAGAATGGG - Intergenic
957656152 3:83079196-83079218 ATACAGTTCTTTGGAAAAATGGG - Intergenic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
958689969 3:97451797-97451819 AGGCACTACTTGAGAAACAAAGG - Intronic
960781681 3:121326253-121326275 AACCACATCTTGGGAAAAAAGGG + Intronic
961354432 3:126327070-126327092 AGGCACCTCTGTGGAAAAACTGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963073479 3:141324381-141324403 AGCCAGTTCTTGGGGAAAAGAGG + Intronic
967820830 3:193837282-193837304 AAGAACTTATTGGGGAAAATAGG - Intergenic
968053811 3:195675591-195675613 AGGCACATCTAGGGAAGAAAAGG + Intergenic
968102080 3:195973563-195973585 AGGCACATCTAGGGAAGAAAAGG - Intergenic
970894891 4:21090542-21090564 AGGTACTACTTAAGAAAAATAGG + Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973271663 4:48269024-48269046 ATGTACTTCTTGGAAAAACTAGG - Intronic
975732029 4:77346788-77346810 AAGCAGTTTTTGGGAAGAATGGG + Intronic
978869947 4:113563669-113563691 AGGCACTTCTTGGGATCAATGGG + Intronic
978951208 4:114561680-114561702 AGGCAATCATTTGGAAAAATGGG + Intergenic
980693680 4:136328882-136328904 AGGTACTTCTTGGGGAAACACGG - Intergenic
985737278 5:1591513-1591535 AGGCACATCTAGGGAAGAAAAGG - Intergenic
986955241 5:13142662-13142684 AGGCACTTCATGGGATACAGAGG - Intergenic
989194939 5:38707453-38707475 GGGCACTTCTTGGGTGAAAGGGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991190240 5:63863411-63863433 AGACACTTATTTGGAAAAGTGGG + Intergenic
992580013 5:78164191-78164213 AGTAACTTTTTGGGTAAAATAGG - Intronic
993926182 5:93869248-93869270 ACCCACTTCTTGGGAAGAAAGGG - Intronic
994871441 5:105354658-105354680 AGGCATTTCTTCCAAAAAATAGG - Intergenic
997969741 5:138391509-138391531 AGGCTCTTCTCGGGACAATTTGG - Exonic
998872353 5:146565269-146565291 AAGAACTTCTTGGGGAAACTAGG + Intergenic
998893162 5:146768390-146768412 AGGAATTTCTTGGGAAGCATTGG - Intronic
999422678 5:151458475-151458497 AGGCACTGCTTGGGAGGAGTGGG - Intronic
1001522820 5:172407025-172407047 AGGGACTTCATGTGAAATATCGG + Intronic
1009337923 6:62516595-62516617 AGGTACTTCTTTGGAAAACACGG - Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1009990765 6:70840437-70840459 TGGCCCTTCTTGGAAAAAAATGG - Intronic
1010713968 6:79207043-79207065 AGTTACTTCTTGGGTAAAATGGG - Intronic
1012282521 6:97345577-97345599 AGGCACCACCTGGGAAAAACAGG - Intergenic
1012693728 6:102352627-102352649 AGGAATTTATTGGGAAAAAAAGG + Intergenic
1013311847 6:108901801-108901823 AGGAAATTATTGGGACAAATTGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015510634 6:134034919-134034941 TGGCACTTTTTGGGAGAACTGGG - Intronic
1015686772 6:135872073-135872095 AGGCATCTGTTAGGAAAAATTGG - Intronic
1016529925 6:145046638-145046660 AGAAAGTTCTTGGAAAAAATTGG - Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021944355 7:25711566-25711588 TGGAAATTTTTGGGAAAAATGGG - Intergenic
1023724889 7:43132660-43132682 AGGCACTCACTGGGCAAAATTGG - Intronic
1024198727 7:47085556-47085578 AAGCACTTCTTGAGAAGAATGGG - Intergenic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1026735736 7:72947434-72947456 GGGCCCTGTTTGGGAAAAATAGG - Intronic
1026786079 7:73302365-73302387 GGGCCCTGTTTGGGAAAAATAGG - Intergenic
1027107986 7:75417577-75417599 GGGCCCTGTTTGGGAAAAATAGG + Exonic
1027423401 7:78039210-78039232 AGGCTCTTCTTTGAAAAACTGGG + Intronic
1027508741 7:79052480-79052502 AGCCATTTCTTGGGAAGAGTGGG - Intronic
1028094453 7:86743274-86743296 AAGGACTTTTTGGGAGAAATTGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030227067 7:107165208-107165230 AAAAACTTTTTGGGAAAAATTGG + Intergenic
1031208708 7:118794445-118794467 AGTCATTTCTTGGGAAAGAAGGG + Intergenic
1032671197 7:134083940-134083962 AGACACTTCTAGAGAAAAATTGG - Intergenic
1035449172 7:158964460-158964482 AGGAACTACTTTGTAAAAATTGG + Intergenic
1037691359 8:21183898-21183920 AGGAAGTACTTGGGAACAATAGG + Intergenic
1037775434 8:21832599-21832621 AGGGGCTTTTTGGGGAAAATGGG - Intergenic
1042301371 8:67286004-67286026 AGACACATTTTGGGAAAACTGGG + Intronic
1043470553 8:80558155-80558177 AGGCTCTTTTTAGGAAAAATAGG - Intergenic
1044123034 8:88421633-88421655 AGCCAATTCTTGGGAAAGATGGG + Intergenic
1044212810 8:89570387-89570409 TGGAAATTCATGGGAAAAATAGG - Intergenic
1045380787 8:101622839-101622861 GGGGACTTCTGGGGAAAAGTGGG - Intronic
1046613409 8:116449767-116449789 AGGGACTTGTTTGGAAATATAGG - Intergenic
1050006844 9:1140989-1141011 AGTCACTGCTTGGGAAATATGGG + Intergenic
1050447421 9:5739859-5739881 AGGCACTGATTGGAAAAAAATGG - Intronic
1050585479 9:7106932-7106954 AGGCAGTGCTTGAAAAAAATAGG + Intergenic
1052105510 9:24510108-24510130 AGAGACTTATTGGGGAAAATTGG + Intergenic
1052303593 9:26980717-26980739 AGGCACTTATTAGGATAATTAGG + Intronic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1056868355 9:90252489-90252511 AGGCATTTTTTGGTAGAAATTGG - Intergenic
1057495447 9:95556776-95556798 AGGCGCTTGTTGGAAACAATAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058776848 9:108293017-108293039 AGCCACCTCTTGGGAAGACTTGG - Intergenic
1059262811 9:112994583-112994605 AAGAACTGATTGGGAAAAATTGG - Intergenic
1059803339 9:117772987-117773009 AGGAAATTCTGGGGAAAAAATGG + Intergenic
1059852046 9:118353051-118353073 AGGAAATTCTAAGGAAAAATGGG - Intergenic
1060059188 9:120444003-120444025 TCTCTCTTCTTGGGAAAAATGGG - Intronic
1060474434 9:123976291-123976313 AGCCACTTCTTGGTAGGAATAGG + Intergenic
1062065107 9:134522497-134522519 AGGGGCTTCTGGGGAAAAAACGG - Intergenic
1188482490 X:30649794-30649816 AAGCACTTCTGGGGGAAAAGGGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191618393 X:63190963-63190985 AGGCACTTTTTAGCAAAATTAGG - Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193428977 X:81376873-81376895 AGGCACTACTTGTGAAAAGGTGG + Intergenic
1194341886 X:92715751-92715773 AGTCATTTCTAGGGAAAAAGAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195157020 X:102133744-102133766 AGGCACTTCGAGGGAGAAAGGGG + Intergenic
1195228754 X:102824618-102824640 AGGCAATTCTTGTTATAAATTGG - Intergenic
1199103349 X:143833175-143833197 AGTAAATTCTTGGGTAAAATAGG + Intergenic
1199107482 X:143887373-143887395 ACGGACTTCATGGGACAAATGGG - Intergenic
1199687058 X:150273958-150273980 AGGCATTCCATGGGAGAAATTGG - Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1200650230 Y:5832444-5832466 AGTCATTTCTAGGGAAAAAGAGG - Intergenic