ID: 1095353252

View in Genome Browser
Species Human (GRCh38)
Location 12:41240346-41240368
Sequence CACCCATTATGTTTTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095353252 Original CRISPR CACCCATTATGTTTTGAGAC AGG (reversed) Intronic
901303824 1:8217969-8217991 CTCCCATTTTATTTTGAGACAGG - Intergenic
901733382 1:11296522-11296544 CCCCCCCTTTGTTTTGAGACAGG + Intergenic
901778129 1:11574719-11574741 CCCCCATCTTTTTTTGAGACAGG - Intergenic
902593260 1:17490167-17490189 CAGCTGTTTTGTTTTGAGACAGG + Intergenic
903078329 1:20788806-20788828 CACCAAGATTGTTTTGAGACAGG - Intergenic
903196458 1:21692555-21692577 CACACATTATATTCTGAGAACGG + Intronic
904579965 1:31535594-31535616 CACCCTTTTATTTTTGAGACAGG - Intergenic
904931051 1:34087813-34087835 TACCTATTATGTCTTGACACTGG - Intronic
909462984 1:75940600-75940622 TACCTAATATGTTTTGATACAGG + Intergenic
913192387 1:116424654-116424676 CACCCATTACCCTTTGTGACTGG - Intergenic
915938811 1:160105415-160105437 GACACATTTTTTTTTGAGACAGG - Intergenic
916262599 1:162857358-162857380 CACCCTGTAGGGTTTGAGACTGG - Intronic
916716415 1:167450486-167450508 CACTTATTTTTTTTTGAGACAGG - Intronic
918130416 1:181622664-181622686 CTCCCACTATATTTGGAGACAGG - Intronic
921350741 1:214231764-214231786 CACACAGTAAGTTGTGAGACTGG - Intergenic
922109319 1:222542111-222542133 CCGCCATTATGGTTTGAGGCTGG + Exonic
923605978 1:235443205-235443227 CACACAATTTTTTTTGAGACAGG + Intronic
924812143 1:247412512-247412534 CAACTATTTTTTTTTGAGACAGG + Intergenic
1064506363 10:16034576-16034598 CAACTATTTTTTTTTGAGACAGG - Intergenic
1065144907 10:22759064-22759086 CAACCATTAGTTGTTGAGACCGG - Intergenic
1065159663 10:22906627-22906649 CTCCCATTTTTTTTTGAGACAGG - Intergenic
1065208847 10:23382849-23382871 TACTCATTTTTTTTTGAGACAGG - Intergenic
1065965549 10:30767706-30767728 CACCAATTTTTTTTTGAGACAGG - Intergenic
1069648732 10:70026504-70026526 CACACATGATGTTCTGATACAGG - Intergenic
1071044249 10:81354579-81354601 CCCCCCTTTTTTTTTGAGACAGG + Intergenic
1071584750 10:86809293-86809315 CTCCCTTTTTTTTTTGAGACAGG + Intronic
1071682590 10:87721095-87721117 CACCAATTGTGTTCTGACACTGG + Intronic
1072125004 10:92437706-92437728 CACCAATTTTTTTTTGAGACAGG - Intergenic
1073173563 10:101534562-101534584 CACCCCTTATATTTAGAGAGAGG - Intronic
1073475997 10:103754210-103754232 AACCAATTTTGTTTAGAGACAGG + Intronic
1073537048 10:104287057-104287079 CTGCCATTTTATTTTGAGACAGG + Intronic
1075067811 10:119301434-119301456 CACCCACTATGTGTGGAGACAGG - Intronic
1076324995 10:129614172-129614194 CAGCCATTGTCTTTTGTGACTGG + Intronic
1079980395 11:27145401-27145423 GAACCATTTTTTTTTGAGACAGG + Intergenic
1080719665 11:34836960-34836982 CACATTTTATTTTTTGAGACAGG - Intergenic
1083971309 11:66077553-66077575 CACCCATTTTTGTTTGAGACAGG - Intronic
1084335265 11:68453963-68453985 CAGCCATGATGTTTTGATACAGG - Intergenic
1084340300 11:68494226-68494248 CGGCCATGATGTTTTGATACAGG - Intronic
1087936106 11:104036436-104036458 AACACATTTTTTTTTGAGACAGG - Intronic
1088285182 11:108180319-108180341 CTTACATTATTTTTTGAGACAGG - Intronic
1088650859 11:111957164-111957186 TACCTATTATTTTTTGAGACAGG - Intronic
1090792677 11:130105407-130105429 CACCCTTTTTTTTTTGAGACAGG - Intronic
1091736502 12:2926477-2926499 AACTTATTATTTTTTGAGACAGG - Intronic
1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG + Intronic
1092363313 12:7856463-7856485 CACACATTAGTTTTTGAGACAGG - Intronic
1094545857 12:31404217-31404239 CCCCCTTTTTGTTTTGAGATAGG - Intronic
1095353252 12:41240346-41240368 CACCCATTATGTTTTGAGACAGG - Intronic
1096708280 12:53436972-53436994 CAGCCTGTTTGTTTTGAGACAGG + Intergenic
1096752537 12:53770891-53770913 CACTGATTTTTTTTTGAGACAGG + Intergenic
1097685864 12:62690347-62690369 CACCTATTATGTTTTATGGCTGG + Intronic
1097865644 12:64557247-64557269 CAATCATGCTGTTTTGAGACTGG + Intergenic
1099296235 12:80831651-80831673 CACACATCATGTTATGGGACAGG - Intronic
1099957691 12:89367366-89367388 GACCCTTTTTTTTTTGAGACAGG + Intergenic
1102154682 12:110715324-110715346 CAAAAATTATTTTTTGAGACAGG + Intergenic
1103657045 12:122479857-122479879 AACTAATTATTTTTTGAGACAGG + Intronic
1104173921 12:126310357-126310379 CTCCAATTATGATTTGAGAGAGG - Intergenic
1104314123 12:127681185-127681207 CATCCATTTTGTTTTGAGAAAGG + Intergenic
1105056356 12:133103304-133103326 CACCCCCTTTGTTTTAAGACAGG + Intronic
1105599853 13:21876922-21876944 CTACTATTATTTTTTGAGACAGG + Intergenic
1105627280 13:22125190-22125212 TACCTTTTATTTTTTGAGACAGG + Intergenic
1105697349 13:22901542-22901564 AACCCTTTATACTTTGAGACAGG - Intergenic
1110016030 13:70405298-70405320 CACTTTTTATTTTTTGAGACAGG + Intergenic
1112441836 13:99429928-99429950 AACCATTTTTGTTTTGAGACAGG - Intergenic
1115747101 14:36449234-36449256 CTCTCATTTCGTTTTGAGACAGG + Intergenic
1117544456 14:56780997-56781019 CACTTTTTTTGTTTTGAGACAGG + Intergenic
1117977561 14:61313461-61313483 AAACCATTTTATTTTGAGACAGG + Intronic
1118287014 14:64484377-64484399 CACTCATTATTCTTTGACACAGG - Exonic
1118403469 14:65400877-65400899 CAGCCCTTTTTTTTTGAGACAGG - Intergenic
1119533779 14:75382867-75382889 CACATATGATGTTTTGATACAGG + Intergenic
1121533206 14:94673013-94673035 CCCCCTTTTTTTTTTGAGACAGG - Intergenic
1123047223 14:105524799-105524821 TAGACATTATGTTATGAGACTGG + Intergenic
1125618813 15:41040773-41040795 CACCCTTTTTTTTTTGAAACAGG - Intronic
1125871190 15:43103356-43103378 CATCCTTTTTGTTTTGAGACAGG - Intronic
1127751993 15:62055230-62055252 CAACCTTTTTTTTTTGAGACGGG + Intronic
1127914741 15:63446066-63446088 CATCCATTTTATTCTGAGACAGG - Intergenic
1128551944 15:68603553-68603575 CCCCCAGTGTGTTTGGAGACAGG + Intronic
1133262117 16:4557673-4557695 CCCCAATTTTTTTTTGAGACAGG + Intronic
1133295842 16:4751900-4751922 CCCCCTTTTTTTTTTGAGACGGG - Exonic
1134149309 16:11793525-11793547 CACCCCCTTTTTTTTGAGACAGG - Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1135553002 16:23412689-23412711 AACCTTTTTTGTTTTGAGACAGG + Intronic
1136574502 16:31115534-31115556 CCCCCCTTTTTTTTTGAGACAGG + Intergenic
1137331252 16:47498895-47498917 CTACCCTTTTGTTTTGAGACAGG - Intronic
1138436854 16:57006001-57006023 TACACATTTTTTTTTGAGACAGG + Intronic
1139224522 16:65221369-65221391 CACCTATGATTTTTTGAAACAGG - Intergenic
1139663610 16:68439555-68439577 CACCCGCTATGCTTTGAGTCAGG + Intronic
1139761063 16:69185254-69185276 CAGACTTTCTGTTTTGAGACAGG + Intronic
1140043127 16:71422614-71422636 CAGCCTTTATTTTTTGAAACAGG + Intergenic
1142179672 16:88662336-88662358 CACCCAGTATCTTTTGAGTTTGG - Intronic
1142531291 17:581307-581329 AACCCATTAGGTTCTGAGAGGGG - Intronic
1142657234 17:1402207-1402229 CCCACTTTATTTTTTGAGACAGG - Intergenic
1144089430 17:11840933-11840955 CATCCATGTTGTTTTGAGTCAGG + Intronic
1144588001 17:16500305-16500327 AACACATTATTTTTAGAGACAGG - Intergenic
1147280478 17:39356359-39356381 CATCTGTTTTGTTTTGAGACAGG + Intronic
1147695966 17:42353578-42353600 CAGACTTTATTTTTTGAGACAGG + Intronic
1150163466 17:62919066-62919088 ACCCCTTTTTGTTTTGAGACAGG - Intergenic
1150792635 17:68210941-68210963 CCCCCCTTTTTTTTTGAGACAGG - Intergenic
1152080091 17:78181762-78181784 CCCCCTTTTTTTTTTGAGACAGG + Intronic
1155752888 18:29451769-29451791 AACACATTATCTTTTCAGACTGG - Intergenic
1157018483 18:43748788-43748810 CAACCATTATTTTTTCAAACTGG - Intergenic
1160098227 18:75895928-75895950 CCCTCATTATGTTTAGAGACAGG + Intergenic
1160608473 18:80069868-80069890 CACTCATTATATTTTTAGAATGG + Exonic
1160729610 19:635147-635169 CACTTGTTTTGTTTTGAGACAGG - Intergenic
1161527779 19:4767973-4767995 CATCGATTTTTTTTTGAGACAGG + Intergenic
1161757040 19:6141737-6141759 CCACCCTTTTGTTTTGAGACAGG + Intronic
1161846794 19:6716222-6716244 CCCCAATTATTTTTTGAGACAGG + Intronic
1162469804 19:10865816-10865838 CGCCAATTTTTTTTTGAGACAGG + Intronic
1163278198 19:16299064-16299086 CACTTTTTATTTTTTGAGACAGG - Intergenic
1163511557 19:17738587-17738609 CCCCTTTTATTTTTTGAGACAGG - Intergenic
1165470906 19:36004016-36004038 GACACATTATTTTTTGAGACAGG + Intronic
1165757432 19:38302361-38302383 CAGCCTGTGTGTTTTGAGACAGG + Intronic
1166133317 19:40760032-40760054 TTCATATTATGTTTTGAGACAGG + Intronic
1166403430 19:42501487-42501509 CAACTTTTATTTTTTGAGACAGG - Intergenic
1166474596 19:43112059-43112081 AACCAATTATTTTTTGAGATAGG + Intronic
1167844410 19:52149531-52149553 AAACCATTATTTTTTGAGAGAGG - Intergenic
927129501 2:20046490-20046512 CACACATTTTATTTTGAGACAGG + Intronic
927435270 2:23061001-23061023 CACTGTTTTTGTTTTGAGACAGG + Intergenic
927595288 2:24391436-24391458 CACACTTTTTTTTTTGAGACAGG + Intergenic
928165939 2:28972092-28972114 CACATTTTATTTTTTGAGACAGG + Intronic
929708567 2:44241724-44241746 GACATTTTATGTTTTGAGACAGG - Intronic
929979032 2:46661837-46661859 CACCCATCATGTTTTGACATTGG - Intergenic
930945778 2:57073416-57073438 AAACCAGTATGTTTTGAGAAAGG + Intergenic
932318576 2:70802977-70802999 CCCCCACTGTTTTTTGAGACTGG - Intergenic
934700146 2:96432769-96432791 AACCTATTTTTTTTTGAGACAGG - Intergenic
937619129 2:123965423-123965445 CACCCATTAGGTTTCCAGAATGG - Intergenic
937645543 2:124262237-124262259 CATTTATTATTTTTTGAGACAGG - Intronic
938739534 2:134218355-134218377 AAGCCATTAAGTTTTGGGACAGG - Intronic
938896402 2:135755094-135755116 TATTCATTATGTGTTGAGACTGG - Intronic
940231180 2:151453993-151454015 CAGCCATTATGTCAGGAGACTGG - Intronic
942417785 2:175776957-175776979 CACCCATTTTGTAATGAGGCAGG - Intergenic
944006844 2:194920016-194920038 CACCTTTTATCTTGTGAGACGGG - Intergenic
944296686 2:198072265-198072287 CTGCCATTATGTTTAGAAACAGG + Intronic
945283565 2:208060314-208060336 CCCCCTTTTTCTTTTGAGACAGG + Intergenic
946929826 2:224660568-224660590 CCCCCCTTCTTTTTTGAGACAGG + Intergenic
1169801736 20:9517845-9517867 CACCCATTATCTTGAGAGCCAGG - Intronic
1170287614 20:14727527-14727549 CTCTCTTTCTGTTTTGAGACAGG - Intronic
1172088145 20:32405906-32405928 CACCCCTTTTTTTTTGAGATGGG + Intronic
1172460495 20:35114690-35114712 CACCTTTTTTCTTTTGAGACAGG - Intergenic
1172782373 20:37444503-37444525 CATTCATTTTCTTTTGAGACAGG + Intergenic
1173500434 20:43549054-43549076 CACCCTTCATGTGTTGAGTCTGG + Intronic
1173838905 20:46144088-46144110 CACCCTTTTTTTATTGAGACAGG - Intergenic
1177667255 21:24176497-24176519 CAGCCATTTTGTTTTAAGCCAGG - Intergenic
1178589147 21:33894762-33894784 CCCCCATTCTGTTTAGATACAGG - Exonic
1178636558 21:34308764-34308786 CACAGATTTTTTTTTGAGACAGG + Intergenic
1180225092 21:46387457-46387479 CACCCCTTGTGTTTAGAGCCTGG - Intronic
1182721604 22:32406327-32406349 CACACATTTTTTTTTGAGATGGG + Intronic
1183469003 22:37995994-37996016 CGCTCTTTATTTTTTGAGACAGG - Intronic
1184803297 22:46775482-46775504 CACCTCTTCTGTTTTGAGACTGG + Intronic
951189414 3:19750586-19750608 CTTCCATTTTTTTTTGAGACAGG - Intergenic
951754027 3:26069402-26069424 TACACATGATGTTTTGATACAGG + Intergenic
953621728 3:44538512-44538534 CCCACATCATGTTTTGAGAACGG - Intergenic
954218727 3:49139299-49139321 CAGACATTTTTTTTTGAGACGGG - Intergenic
954780440 3:53055207-53055229 CTACCTTTTTGTTTTGAGACAGG + Intronic
955749925 3:62177279-62177301 TTACTATTATGTTTTGAGACAGG - Intronic
958876011 3:99618073-99618095 AATCCTTTATTTTTTGAGACAGG - Intergenic
960795334 3:121480490-121480512 CACCCTTTTTTTTTTGAGATGGG + Intronic
961095120 3:124147939-124147961 CACCCATTATGTGTGTACACAGG - Intronic
965622967 3:170658983-170659005 CATTTATTATTTTTTGAGACAGG + Intronic
970599061 4:17626674-17626696 CAGCCTTTTTTTTTTGAGACAGG + Exonic
971005200 4:22365582-22365604 CACATATTATTTTTTGAGACAGG - Intronic
972277293 4:37569089-37569111 CCCCCCTTTTTTTTTGAGACAGG - Intronic
972628645 4:40824491-40824513 CATCAATTTTTTTTTGAGACAGG + Intronic
973169568 4:47122616-47122638 CACCCAGTGTCCTTTGAGACTGG - Intronic
975210516 4:71694534-71694556 TACTTATTATGTTTTCAGACAGG - Intergenic
976677695 4:87721461-87721483 GAGCAATTATTTTTTGAGACAGG + Intergenic
977604908 4:98974450-98974472 CACCAACTTTTTTTTGAGACAGG + Intergenic
979812125 4:125049405-125049427 CACACATGATATTTTGATACAGG - Intergenic
979853659 4:125605317-125605339 CACCCATCATGTTGTCTGACAGG + Intergenic
980119711 4:128715212-128715234 CACACACTTTTTTTTGAGACAGG + Intergenic
981783936 4:148456587-148456609 CACTGATTATTGTTTGAGACTGG - Intergenic
981954692 4:150455572-150455594 TACCCAAGATGTTTTGATACAGG + Intronic
982028400 4:151275527-151275549 CTTCCATTATTATTTGAGACAGG + Intronic
984782037 4:183534656-183534678 CATTTATTATTTTTTGAGACAGG + Intergenic
984902283 4:184596014-184596036 CTCCCCTTTTCTTTTGAGACAGG - Intergenic
985318394 4:188682110-188682132 CCTCCATTAGGTTTTGAGAAAGG + Intergenic
985965580 5:3336816-3336838 CACCCATGCTGTCTTGACACTGG + Intergenic
987619102 5:20316935-20316957 GACCCATTTTATTTTGAGAATGG + Intronic
987859832 5:23470386-23470408 AACCCATTATATTTACAGACAGG - Intergenic
988553438 5:32217103-32217125 CATTCATTTTGTTTTGAGATAGG + Intergenic
989528838 5:42483072-42483094 CTCTCTTTATTTTTTGAGACAGG + Intronic
991053832 5:62301097-62301119 CACACATATTTTTTTGAGACAGG - Intergenic
992205292 5:74425050-74425072 TAACCATTTTTTTTTGAGACAGG + Intergenic
992789152 5:80198234-80198256 TAGCCCTTATGTTTTGAGATGGG + Intronic
993926562 5:93873284-93873306 CCCCCTTTTTTTTTTGAGACAGG - Intronic
994539675 5:101078156-101078178 AATACATTATTTTTTGAGACAGG - Intergenic
995311168 5:110713488-110713510 CACATATTATATTTTGATACAGG - Intronic
995470384 5:112495678-112495700 CACTTATTATGTGTTGAGAGTGG + Intergenic
997714857 5:136034837-136034859 ATCCCATTATGTATGGAGACAGG - Intronic
999702473 5:154240638-154240660 CAACCATTATATTTTGTGGCTGG + Intronic
1001188725 5:169605075-169605097 CCCCCACTTTTTTTTGAGACAGG - Intergenic
1002080650 5:176735416-176735438 CATAGAATATGTTTTGAGACTGG - Intergenic
1005455454 6:26015714-26015736 AACACGTTATCTTTTGAGACTGG - Intergenic
1005521102 6:26601484-26601506 CCCCTTTTATTTTTTGAGACAGG + Intergenic
1006742388 6:36318715-36318737 CACTGATTTTTTTTTGAGACAGG - Intronic
1009054154 6:58315632-58315654 CACTCATTATTTTATGACACTGG + Intergenic
1009236973 6:61134931-61134953 CACTCATTATTTTGTGACACTGG - Intergenic
1010846090 6:80710140-80710162 CACCATTTATGTTTTCAGAAGGG + Intergenic
1011225609 6:85102462-85102484 CACCTATTATGTTTTGATTATGG - Intergenic
1011593431 6:88993222-88993244 CACAGATTGTGTTTTGAGAGTGG - Intergenic
1012021237 6:93922427-93922449 TAACCATTATTTTTTGAAACAGG + Intergenic
1013516044 6:110886765-110886787 CAGATATTATTTTTTGAGACAGG - Intronic
1015087689 6:129315052-129315074 GAAGCATTATGTTTTGAGATGGG + Intronic
1017923479 6:158890833-158890855 CTCCCTTTTTTTTTTGAGACGGG - Intronic
1018008603 6:159647518-159647540 CCCCCTTTTTTTTTTGAGACAGG - Intergenic
1018153011 6:160957604-160957626 CACACATTATTTTTAGTGACTGG + Intergenic
1021704332 7:23351775-23351797 CACACATTTTCCTTTGAGACAGG + Intronic
1022636653 7:32142533-32142555 CAGCCATTTTGCTTTTAGACAGG + Intronic
1023182230 7:37496452-37496474 CAGCCTGTTTGTTTTGAGACAGG + Intergenic
1025851568 7:65248912-65248934 CACCCATTTTTTTTTGAGACAGG + Intergenic
1026292526 7:69020667-69020689 CCCCCTTTATTTTTAGAGACAGG + Intergenic
1026468725 7:70676424-70676446 CTCTCTTTATTTTTTGAGACAGG - Intronic
1027939205 7:84651796-84651818 CCCTCAATATCTTTTGAGACTGG + Intergenic
1028384942 7:90244423-90244445 CACCCCTGGTTTTTTGAGACAGG - Intergenic
1029273715 7:99392325-99392347 CCCCCATTATGTTTGCAGAGGGG - Intronic
1029311138 7:99666097-99666119 CACCCTTTCTTTTTTGAGATTGG + Intronic
1030074041 7:105721332-105721354 AACCCTTTATTTTTTGAGTCAGG - Intronic
1030611106 7:111690298-111690320 AACAAATTATTTTTTGAGACAGG + Intergenic
1032819978 7:135515187-135515209 TTTCCATTTTGTTTTGAGACAGG - Intergenic
1033009100 7:137600242-137600264 CACTTATTATTTTTTGAGACAGG - Intronic
1034605817 7:152313394-152313416 CAACCTTCAAGTTTTGAGACTGG + Intronic
1034820829 7:154214910-154214932 CACATATTTTGTTTTGAGACTGG - Intronic
1036576746 8:10034486-10034508 CCCCCCTTTTTTTTTGAGACAGG - Intergenic
1036944143 8:13078956-13078978 TATCTATTATTTTTTGAGACAGG + Intergenic
1038786626 8:30623087-30623109 CACAATTTATGTTTAGAGACTGG + Intronic
1039720981 8:40163968-40163990 TATTAATTATGTTTTGAGACAGG - Intergenic
1041036241 8:53793638-53793660 CACCATTTTTTTTTTGAGACAGG - Intronic
1041136693 8:54766688-54766710 CACCCTATATGTTTTAAGGCGGG + Intergenic
1044996035 8:97839028-97839050 CACCCATGATGCTTTGATATTGG - Intronic
1045004859 8:97908942-97908964 CCCCCTTTTTTTTTTGAGACAGG + Intronic
1045079814 8:98613269-98613291 TCCCCATTATATTCTGAGACTGG - Intronic
1046642107 8:116743443-116743465 GGCCTATTATTTTTTGAGACAGG - Intronic
1047701652 8:127455141-127455163 CTCCCTTTATTTTTTGAGACAGG - Intergenic
1050590326 9:7153893-7153915 CTCCCCTTATGTGGTGAGACTGG + Intergenic
1054882365 9:70157960-70157982 AAGACATTATGTTTTTAGACAGG + Intronic
1055309170 9:74960549-74960571 CACTTTTTATTTTTTGAGACAGG - Intergenic
1058357210 9:104096616-104096638 AACCCATTCTGTTTTTGGACAGG + Intronic
1058942239 9:109823892-109823914 CACACTTTATTTTTTTAGACAGG + Intronic
1060104802 9:120866869-120866891 AGCCCATGATGTTTGGAGACCGG - Exonic
1060831639 9:126721382-126721404 CCCCCTTTTTTTTTTGAGACGGG - Intergenic
1062313693 9:135954436-135954458 AACCCATGCTCTTTTGAGACAGG - Intronic
1186239823 X:7554354-7554376 CACATATTATTTTCTGAGACAGG + Intergenic
1188894617 X:35651740-35651762 GAACAATTTTGTTTTGAGACAGG - Intergenic
1188954786 X:36421122-36421144 CAAACCTTATGTTGTGAGACAGG - Intergenic
1189098497 X:38164438-38164460 CAGCCAAGATGTTTTGATACAGG + Intronic
1190305939 X:49081684-49081706 CAGCCCTTTTTTTTTGAGACGGG - Intronic
1193087957 X:77464384-77464406 CACCCATTATTTTTTGATTATGG - Intergenic
1193945809 X:87732648-87732670 TACACATGATGTTTTGATACAGG + Intergenic
1195398220 X:104434149-104434171 CCCCCATGATGTTCTGAGACTGG + Intergenic
1196509552 X:116491707-116491729 CACCCACAATTTTTTAAGACAGG - Intergenic
1198323240 X:135540760-135540782 CACCCCCTTTTTTTTGAGACAGG + Intronic
1198718821 X:139592924-139592946 CAGGCAATATGTTTTGAGACAGG - Intronic
1200414163 Y:2890539-2890561 GACTTATTATTTTTTGAGACAGG - Intronic
1200913141 Y:8548635-8548657 CACACATTTTCTTTTGAGAATGG + Intergenic
1202583001 Y:26401998-26402020 GAACCATTATATTTTGAGATGGG - Intergenic