ID: 1095355908

View in Genome Browser
Species Human (GRCh38)
Location 12:41274951-41274973
Sequence CAGTATAATTAGGTAGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095355904_1095355908 14 Left 1095355904 12:41274914-41274936 CCCAGTGAATTATTATAGACAGA 0: 1
1: 0
2: 2
3: 23
4: 218
Right 1095355908 12:41274951-41274973 CAGTATAATTAGGTAGATTCAGG 0: 1
1: 0
2: 2
3: 7
4: 101
1095355905_1095355908 13 Left 1095355905 12:41274915-41274937 CCAGTGAATTATTATAGACAGAA 0: 1
1: 0
2: 4
3: 17
4: 221
Right 1095355908 12:41274951-41274973 CAGTATAATTAGGTAGATTCAGG 0: 1
1: 0
2: 2
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095355908 Original CRISPR CAGTATAATTAGGTAGATTC AGG Intronic
910141876 1:84035074-84035096 AACTATAATTTGGTAGATTCAGG - Intergenic
911501895 1:98696782-98696804 CAGTTCTATTAAGTAGATTCTGG + Intronic
911977027 1:104510882-104510904 CAAAATATTTAGGTATATTCTGG - Intergenic
919085739 1:192918414-192918436 CATAATATTTAGGGAGATTCTGG - Intergenic
919611120 1:199747071-199747093 CAGAACAATTAGGTAGAATCAGG + Intergenic
920576782 1:207067028-207067050 AAGCATGATTAGGTAGATGCAGG + Intronic
921499228 1:215880398-215880420 TAGTATAATTTGGTAGATATTGG - Intronic
1064324496 10:14336291-14336313 CAGAATGGTTAGGCAGATTCAGG - Intronic
1069504383 10:68984533-68984555 CAGTGTAATTTATTAGATTCTGG + Exonic
1071779386 10:88826366-88826388 CAGTGGAATTAGGTAGGTTTGGG - Intronic
1072308379 10:94130453-94130475 CACTATTCTTAGGGAGATTCTGG - Intronic
1077832714 11:5892511-5892533 CAGTATAATAAGGTAATGTCTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080011689 11:27466566-27466588 CTGTATTAGTAGGTAGATCCAGG - Intronic
1087558277 11:99750638-99750660 CAGTATATTTAGTTAGATTCTGG - Intronic
1087998434 11:104841687-104841709 CAGTAAAATGAGGAAGAATCTGG - Intergenic
1095355908 12:41274951-41274973 CAGTATAATTAGGTAGATTCAGG + Intronic
1095927015 12:47588777-47588799 CATTATATTTAGGTAGCTGCAGG - Intergenic
1096828404 12:54296511-54296533 CATTATAGTCAGGTAGAGTCAGG - Intronic
1099316776 12:81093540-81093562 CATTTTAATTAGGTAAATGCAGG + Intronic
1100987196 12:100213535-100213557 CAGTATCATTATGTATATTATGG + Intronic
1102179265 12:110899721-110899743 CAGTCTTATGAGGTAGATACTGG - Intronic
1107277658 13:38694743-38694765 ATGTATAATTAGGTAAATTATGG + Intronic
1109526058 13:63578223-63578245 TAGAATAATTTGGGAGATTCAGG + Intergenic
1110206049 13:72914915-72914937 CAGAAAAATTAGGAAGTTTCAGG - Intronic
1112516437 13:100057191-100057213 CAGCATAATTAGGTATATAGTGG + Intergenic
1116948984 14:50861508-50861530 AAGTATATATAGGAAGATTCTGG - Intronic
1124963976 15:34419583-34419605 CAGGATAAGCAGGTAGCTTCGGG + Intronic
1124980590 15:34565814-34565836 CAGGATAAGCAGGTAGCTTCGGG + Intronic
1127589372 15:60408300-60408322 TATTATAATCAGGTAGATACTGG - Intergenic
1132307908 15:100830952-100830974 CAGTACAATTAAGTAGATTGGGG - Intergenic
1144134848 17:12283889-12283911 CAGTATTACTAGGTACTTTCTGG + Intergenic
1147015419 17:37488574-37488596 CAGCATACTTTGCTAGATTCAGG - Intergenic
1150343844 17:64389009-64389031 CAGGATAATTATGAAGATTATGG + Intronic
1155298690 18:24409063-24409085 AAGTATTAGTAGGCAGATTCAGG + Intergenic
1158437146 18:57441618-57441640 CAGGATAGTTAGGAAGACTCGGG - Intronic
1161894655 19:7071287-7071309 CTGTATAATAAGGTAGCTGCTGG + Intronic
1165648439 19:37465710-37465732 CAGAATAATTGGATAGGTTCTGG + Intronic
925142930 2:1562412-1562434 CAGTGGAATTTGGGAGATTCTGG - Intergenic
929475566 2:42244021-42244043 CAGTATAAGCAGGAAAATTCAGG - Intronic
930855645 2:56014456-56014478 CACTCAAATTTGGTAGATTCTGG - Intergenic
938895879 2:135749980-135750002 CTGTATTGATAGGTAGATTCAGG + Intronic
942041593 2:172069760-172069782 CAGAATATAGAGGTAGATTCAGG - Intronic
942866365 2:180680243-180680265 CAGTATAATTAGACAGATATAGG + Intergenic
944947000 2:204699474-204699496 CAGAATAATTTGGTATATTTAGG + Intronic
945611250 2:212006190-212006212 AAGAATAATTAGAAAGATTCTGG - Intronic
946999405 2:225436549-225436571 CAATATAATTAGGTAAAATAAGG - Intronic
1168782156 20:501926-501948 TAGTATTATTTGGTAGTTTCTGG - Intronic
1174724750 20:52849939-52849961 CAGCATAAATGGGAAGATTCTGG - Intergenic
1177566372 21:22827813-22827835 CAGAATAATTATGTAGATCAAGG - Intergenic
1181014132 22:20058950-20058972 CATTAAAATGAGGTAGAATCTGG + Intronic
1182403499 22:30102968-30102990 AAGTATAAAAAGGTAGATTTCGG + Intronic
949243205 3:1895128-1895150 CAATAAAATTATGTGGATTCTGG - Intergenic
949510663 3:4764131-4764153 CACCATAATTAGGTGGCTTCAGG + Intronic
950992975 3:17461147-17461169 CAGTATAATTAGGTAGTTTATGG + Intronic
954323415 3:49847498-49847520 CAGTAGAATCAGATAAATTCTGG + Intronic
954851543 3:53605067-53605089 GCTTTTAATTAGGTAGATTCAGG - Intronic
961135989 3:124511743-124511765 CAGTATAGTTTGGTAGATGAAGG - Intronic
962437127 3:135377473-135377495 CACTTTCATTAGCTAGATTCAGG - Intergenic
964283345 3:155090977-155090999 CAGCACAATTAGGTAAATACAGG + Intronic
971479708 4:27103538-27103560 AAGTATAATTCAGTAGATTCAGG - Intergenic
979215071 4:118153490-118153512 CTATATAATAAGGTACATTCAGG + Intronic
981114478 4:140974005-140974027 AAATATAATTAAGTAGATTATGG + Intronic
981532044 4:145762549-145762571 CAGGCAATTTAGGTAGATTCTGG + Intronic
984375519 4:178923909-178923931 AAATATAAGTAGGTAGACTCAGG + Intergenic
986856198 5:11871399-11871421 CAGGATTATTAGGGGGATTCAGG + Intronic
986858250 5:11897450-11897472 CAGTATAAATAATTAGATTTTGG - Intronic
986921601 5:12690356-12690378 CATTAAAATTAGGTAGAATTTGG + Intergenic
986987719 5:13517734-13517756 CAATATTATTATGCAGATTCTGG - Intergenic
989798160 5:45501202-45501224 AAGTATAATATGGTAGAATCAGG - Intronic
990128043 5:52543341-52543363 CGGTATAATTATGGAGATTATGG + Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
994650916 5:102526322-102526344 CAGTATTATTAGGTGGATATAGG + Intergenic
995094130 5:108214911-108214933 CAGTATAAATGGGCATATTCTGG + Intronic
995839449 5:116429893-116429915 CAGTTTAATTAGGTAAAATCGGG - Intergenic
1000815840 5:165920517-165920539 CCTTTTAATTAGCTAGATTCAGG + Intergenic
1004323329 6:14650548-14650570 CAGTAAAATCAGGTAGATGGAGG - Intergenic
1004910101 6:20274630-20274652 CAATGAAATTAGGTAGATTTAGG + Intergenic
1010144413 6:72650295-72650317 CAATATAAATAGGTACATTCTGG + Intronic
1010180787 6:73084738-73084760 CAGAATAAGTGGGGAGATTCTGG - Intronic
1011841889 6:91511082-91511104 TATTATAATTAGCTAGAATCTGG - Intergenic
1017312993 6:152996227-152996249 CAGTGTACTCAGGTATATTCAGG - Intronic
1028185372 7:87778741-87778763 CAGTATAATAAGCTACTTTCTGG + Intronic
1029287827 7:99478417-99478439 CCGTATAATTTGGGAGGTTCTGG + Intronic
1029303841 7:99604453-99604475 CAGTATAATCAGGTAGCCTAGGG - Exonic
1038815841 8:30903224-30903246 CTATATAATTAGATAGATACAGG - Intergenic
1040781694 8:51117176-51117198 CAGAATGACTAGGTAGATTGTGG + Intergenic
1041464149 8:58142341-58142363 CAGTCTGATTTGGTAGATTTCGG - Intronic
1042093596 8:65187175-65187197 AATTATAATTAGATAGAATCTGG + Intergenic
1042379007 8:68091399-68091421 CAATGTAATTAGCTAGATGCAGG + Intronic
1043267271 8:78282206-78282228 TAGTATATTTAGGTATATTGAGG + Intergenic
1044023240 8:87133756-87133778 CTATATAATTATGTTGATTCAGG + Intronic
1046173867 8:110549010-110549032 CAAAATAATTACCTAGATTCTGG - Intergenic
1046270202 8:111885816-111885838 CATTAGAATTACGTAGATTTAGG + Intergenic
1047477614 8:125249219-125249241 CAGTATAATAAAGTGGACTCTGG - Intronic
1047784527 8:128141187-128141209 CAGTATTCTCAGGTAGAATCAGG - Intergenic
1048219683 8:132529919-132529941 CAGTCTTATTAGGTACATTTTGG - Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1055925324 9:81504422-81504444 CAATATAATTAGCTAAAATCAGG - Intergenic
1058703043 9:107616472-107616494 CAGTAGAAATATGTAGATTGAGG + Intergenic
1059126443 9:111691090-111691112 CAGTATTATTAGCTCCATTCTGG - Intronic
1059538389 9:115105926-115105948 CAGAATAATCAAGTAGATTTGGG - Intronic
1188247847 X:27856002-27856024 CAGTATAATTTGGAAAATTAAGG + Intergenic
1188273071 X:28166479-28166501 CAGTTTAAGTACCTAGATTCTGG + Intergenic
1188319048 X:28712503-28712525 CAGTACAATCATGTTGATTCTGG + Intronic
1188406644 X:29818896-29818918 GAGTGTGATTAGGTGGATTCTGG - Intronic
1189029960 X:37440345-37440367 CAATATAATTAGGCCGATTTGGG + Intronic
1190525170 X:51321887-51321909 AAGTATAAATAGGTAAATTAAGG + Intergenic
1191071210 X:56401871-56401893 AAGTAAAATTGGGTAGATTTGGG - Intergenic
1192657520 X:73007113-73007135 AAGTATAAATTGGTATATTCAGG - Intergenic
1193318440 X:80092276-80092298 TAGTATATTCAGGTATATTCAGG + Intergenic