ID: 1095359021

View in Genome Browser
Species Human (GRCh38)
Location 12:41313252-41313274
Sequence CTTTTGTAACAGATGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095359021 Original CRISPR CTTTTGTAACAGATGAAGGA TGG (reversed) Intronic
903077808 1:20786195-20786217 CGTTTGTAAGAGATGGAGGCAGG - Intronic
906632998 1:47388045-47388067 CTTTCATAACAGGTAAAGGAAGG + Intergenic
906797919 1:48712207-48712229 TTTGTGGAACAGAAGAAGGAAGG - Intronic
908216980 1:61964105-61964127 CCTTGGTAACAGAGAAAGGAAGG - Intronic
909840501 1:80315661-80315683 CTTTTTGAACAAATGAATGAAGG + Intergenic
910516076 1:88061456-88061478 CTTTTGAAAAACAGGAAGGAAGG - Intergenic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
912985332 1:114422570-114422592 CTTTTGTCAAGGATGGAGGAAGG - Intronic
913089675 1:115468022-115468044 CTTTTGGAAGAGAACAAGGAAGG - Intergenic
914334887 1:146705049-146705071 CCTTCGGAACAGATGCAGGATGG - Intergenic
915932512 1:160069237-160069259 GTTAGGGAACAGATGAAGGATGG - Intronic
916346956 1:163803647-163803669 GTTTTCTGAAAGATGAAGGATGG + Intergenic
917013624 1:170503973-170503995 CTTTTCTAGTAAATGAAGGAAGG + Intergenic
917070020 1:171140391-171140413 CTTTTCTAAGAAAAGAAGGAAGG - Intronic
918972686 1:191440149-191440171 ATTTTATGACAGAGGAAGGAGGG + Intergenic
920632568 1:207666972-207666994 CTTTTGTAAAAGATAATGGATGG - Intronic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
922561574 1:226573318-226573340 CTTTTGTAACAGATGGTGGCGGG + Intronic
924681138 1:246235366-246235388 CTTTTGCAACATATTCAGGAAGG - Intronic
1064555037 10:16539452-16539474 CTTGTGGAACAGAGGAAGGCAGG + Intergenic
1064710838 10:18122668-18122690 GTTTTGAAAGAGAAGAAGGAAGG - Intergenic
1066544916 10:36489408-36489430 CTTATTTAAAAGAGGAAGGAAGG - Intergenic
1066690196 10:38018759-38018781 CATTTGTAACATCAGAAGGAGGG + Intronic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1067429489 10:46233752-46233774 CTTTGGTGACAGATGAAGTTGGG + Intergenic
1067833290 10:49622366-49622388 CATTTTTAAAAGATCAAGGAAGG - Intronic
1068251691 10:54450564-54450586 CTTTTGTAAGAGAAGAGGCAGGG - Intronic
1068491951 10:57735550-57735572 CTTTTGTAACAGATACAGAGGGG + Intergenic
1070685357 10:78476529-78476551 CTTTTGGAAGATATGAAGAACGG + Intergenic
1072597771 10:96891080-96891102 TTTTTGGAAGAGTTGAAGGAAGG + Intronic
1073692967 10:105831910-105831932 ATTTTCTATCAGAAGAAGGAAGG + Intergenic
1074668726 10:115762211-115762233 TTTTTGAAACAGAAGAAAGAAGG - Intronic
1074924891 10:118058431-118058453 CTTTTGAATAAGCTGAAGGAAGG - Intergenic
1078154905 11:8791035-8791057 CTTTGGGAACAGATTCAGGAAGG - Intronic
1078809968 11:14749647-14749669 CCTTTGTGACATATGAAGAATGG - Intronic
1079632150 11:22691095-22691117 AGTTTGAAGCAGATGAAGGAGGG + Intronic
1082077251 11:47983577-47983599 CTTTTCTAAGACAGGAAGGACGG + Intronic
1083506698 11:63164517-63164539 CTTTTGTACCTGATTATGGAAGG + Exonic
1087121339 11:94577458-94577480 CTTTTGTGACAGAAAAAGGATGG - Exonic
1087162887 11:94967348-94967370 GTGTTGTAACTGATAAAGGATGG - Intronic
1087221283 11:95549201-95549223 CTTTGGTACCTGATGAAAGATGG + Intergenic
1087541198 11:99522867-99522889 TTCTTGTAACACATGAAGGAAGG - Intronic
1087830536 11:102815040-102815062 TTTTTGTATAAGGTGAAGGAAGG + Intergenic
1091381644 12:66099-66121 GTTTCGTCACGGATGAAGGAAGG + Intergenic
1091712972 12:2754851-2754873 CTTTTGTAAAGAATGAATGAAGG + Intergenic
1092300953 12:7249637-7249659 CTTTTGTAAAGAAAGAAGGAGGG - Intergenic
1094250092 12:28349826-28349848 CAGTTGTAACAGAGGAATGAGGG - Intronic
1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG + Intergenic
1095359021 12:41313252-41313274 CTTTTGTAACAGATGAAGGATGG - Intronic
1097709600 12:62903451-62903473 CTTTTGTGATATTTGAAGGAAGG + Intronic
1098696907 12:73571211-73571233 CTTTGGTACCAGACTAAGGATGG - Intergenic
1099080605 12:78175436-78175458 CTTCTGAATTAGATGAAGGATGG - Intronic
1101077087 12:101141705-101141727 CCTATGTAACATGTGAAGGAGGG + Intergenic
1101341863 12:103849197-103849219 CTGTAGTAAAAGATGAAGAATGG - Intergenic
1102186823 12:110955313-110955335 CATTTCAAACAAATGAAGGAAGG + Intergenic
1104222081 12:126794879-126794901 CTTATTGAACAGATGATGGATGG - Intergenic
1104469103 12:129014726-129014748 CATTTTTAACAAATGAATGAAGG - Intergenic
1104767150 12:131337532-131337554 CTTCTGTAACTGCTCAAGGAAGG - Intergenic
1105624028 13:22095912-22095934 CTGTTGTAAAATTTGAAGGAGGG + Intergenic
1105890385 13:24678392-24678414 CTTTTGGAACGGAAGAAGGAGGG + Intergenic
1109613849 13:64804394-64804416 CTTTTGTAATTAATGAAGAAAGG + Intergenic
1110049697 13:70880321-70880343 TATTTGTTACAGATGAATGAGGG + Intergenic
1110129876 13:71994117-71994139 TCTTTGTAACAGCTGGAGGAAGG - Intergenic
1110533345 13:76622590-76622612 CTTTTGTAAAACAGGATGGAAGG - Intergenic
1111465225 13:88599502-88599524 ATTTTGTCACATATGTAGGAAGG - Intergenic
1112289437 13:98132172-98132194 CTTTTGTCAAGGATGAAGAAGGG + Intergenic
1112922685 13:104634962-104634984 TTTATGGAACAGATGAAGCAGGG - Intergenic
1113157787 13:107344341-107344363 CTTTTGTATCAGAGTAATGATGG - Intronic
1115629803 14:35232971-35232993 CTGTTGTAAAAGAGGAAGGAGGG - Intronic
1115899263 14:38126723-38126745 TTTTTGTGAAAGATGAAGAAGGG + Intergenic
1118662863 14:68033887-68033909 TATTTGTGACAGATGATGGAAGG + Intronic
1120061491 14:79988655-79988677 CTTTTCTAACAGATTAAATATGG - Intergenic
1120362084 14:83516889-83516911 CTTTTTTAACACATGACAGAGGG - Intergenic
1121195252 14:92066265-92066287 ATTATGTTACAGATGAAGGAGGG - Intronic
1121356448 14:93219444-93219466 TTTTTGTACCAGAGGAAGAAAGG + Intronic
1121971649 14:98362962-98362984 CATTTATTACAGATCAAGGAAGG + Intergenic
1123540000 15:21280183-21280205 CTTTTGGGACAGATGATAGAAGG + Intergenic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127512123 15:59653199-59653221 ATTTAGAAACAGATGAGGGATGG + Intronic
1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG + Intergenic
1202948310 15_KI270727v1_random:7341-7363 CTTTTGGGACAGATGATAGAAGG + Intergenic
1133826199 16:9280428-9280450 CCTTTGAAACAGATGCTGGATGG + Intergenic
1134180822 16:12046404-12046426 CTTTTGTGATGGATGAAGAAAGG + Exonic
1138810329 16:60141468-60141490 CTTTTGAAAAAAAAGAAGGATGG + Intergenic
1138823591 16:60291161-60291183 CTTTTGCAACAAATAAAGGTAGG - Intergenic
1138969259 16:62124976-62124998 CATTTGTAAGAGATTAAGGTGGG - Intergenic
1139238990 16:65371077-65371099 ATTCTGCAACAGATGAAGGACGG - Intergenic
1139998736 16:71006187-71006209 CCTTCGGAACAGATGCAGGATGG + Intronic
1141373866 16:83512017-83512039 CTTTTTTAAAAAATAAAGGAAGG + Intronic
1141913045 16:87073303-87073325 CATTATTTACAGATGAAGGACGG - Intergenic
1143574002 17:7779149-7779171 CTATTGAAACATTTGAAGGAAGG + Intronic
1144014210 17:11178478-11178500 GTTTTGTGACAGAAGAGGGATGG - Intergenic
1145183294 17:20771851-20771873 GTTTTGTCACAGATCAAAGAGGG + Intergenic
1146618778 17:34379559-34379581 CTTTTCTAATTGATCAAGGAAGG - Intergenic
1146938350 17:36826337-36826359 CTTTTGTACCTGCTCAAGGAAGG - Intergenic
1148203312 17:45764204-45764226 TTGTAGTAACAGATGATGGATGG + Intergenic
1149301668 17:55310066-55310088 CTTTTGTCACAGATTAGGCAAGG - Intronic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152601930 17:81267406-81267428 CTATTTTAAAAGAAGAAGGAGGG - Intronic
1152761152 17:82107622-82107644 CTGTTGTGACAGGAGAAGGAGGG + Intronic
1154256680 18:12787558-12787580 CATTTATAACAACTGAAGGACGG + Intronic
1155646671 18:28086783-28086805 CTTTTGTATCAGACAAAAGATGG + Intronic
1155745043 18:29345637-29345659 CTTTTGTAACAGAGCAAAGAGGG + Intergenic
1157164801 18:45348606-45348628 CTTATTTAACAGATGAATGTTGG + Intronic
1158442230 18:57486651-57486673 CTTTTGTAATAGATGAAAAAAGG + Exonic
1158543351 18:58375963-58375985 CATTTTTAACATATGAAGGAAGG + Intronic
1159523254 18:69553924-69553946 CTTTTGTAACACATGTAGCAGGG + Intronic
1160233121 18:77063759-77063781 CTCTTGGAAAAGATTAAGGAGGG + Intronic
1160713174 19:562717-562739 CTTTTGTTTCAAATGTAGGAAGG + Intergenic
1164254655 19:23516872-23516894 TTTTTGGAAGAGATGAAGAAAGG - Intergenic
1165848059 19:38831655-38831677 CTGTTATAGCAGATGTAGGACGG - Intronic
1168468650 19:56623643-56623665 CTTTTGTTACAGCAGCAGGAAGG - Exonic
926428410 2:12761214-12761236 CATTTTTAAAAGATGATGGATGG - Intergenic
927903160 2:26837490-26837512 CTATTATAAGAGATGAACGAGGG - Intergenic
928239907 2:29577386-29577408 CTTTTGTCACACCTGAGGGAGGG - Intronic
928642344 2:33313568-33313590 CTTTTGTAAGAGATAAAGGGAGG + Intronic
929624019 2:43387714-43387736 TTGTTGTCACAAATGAAGGAGGG + Intronic
929943932 2:46356309-46356331 CTTTTGAAAGAGATAGAGGAGGG - Intronic
930054597 2:47242244-47242266 ATTTTGTAAAAGTTGAAGGGTGG - Intergenic
932668349 2:73716141-73716163 TTTTTTTAACAAATAAAGGAGGG + Intergenic
933496632 2:83058043-83058065 ATTTTATAACAGATAAAGGGAGG + Intergenic
934090912 2:88549829-88549851 CTCTTGTGACAGATGCAGGAGGG - Intergenic
934859603 2:97753274-97753296 CTTGTGTAAGAGAAGAAAGAGGG - Intergenic
935431702 2:102983033-102983055 CTCATGTGACAGATTAAGGATGG + Intergenic
935686526 2:105688733-105688755 CTTTTGTAAAGGATGAAAGTAGG + Intergenic
938052182 2:128184514-128184536 CTTTTGTTAGGGAGGAAGGATGG - Intronic
940986322 2:160055706-160055728 CTTCTTTTACAGATGAAGAAGGG - Intronic
943550534 2:189333352-189333374 CTAATATAACAGATGAAAGAGGG + Intergenic
946049935 2:216854163-216854185 CTTTTCTAAAAGTTGAAGGAAGG - Intergenic
1169584172 20:7061237-7061259 CCTTTGTAACAAATAAAGAAGGG - Intergenic
1171088419 20:22261422-22261444 CATTTGGTACAGATGAAGGCTGG + Intergenic
1172400183 20:34643966-34643988 CTTTACTAACAGATAAAGAAGGG - Intronic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1176214005 20:63939675-63939697 CACTTGTGCCAGATGAAGGAAGG - Intergenic
1176283562 20:64328734-64328756 GTTTCGTCACGGATGAAGGAAGG - Intergenic
1176690062 21:9895520-9895542 CTTTTGAAAGAGATGAATCAAGG + Intergenic
1176980941 21:15380382-15380404 CTTCTGTATCAAATAAAGGATGG - Intergenic
1177910426 21:27024471-27024493 CTTTGCTAACAGATGCAGGGAGG + Intergenic
1178380597 21:32104378-32104400 CTTTTGTATCAGCTGAGGGGAGG + Intergenic
1179602700 21:42490860-42490882 CTTTTGGTAAAGAAGAAGGAAGG + Intronic
1180224733 21:46385509-46385531 CTTTTGTAAATGATGAATAATGG + Intronic
1181986927 22:26806445-26806467 CTTTTCTAACAGGTAAAGCAGGG + Intergenic
949693237 3:6664609-6664631 CTTTTTAACCAGGTGAAGGAAGG - Intergenic
950601808 3:14041684-14041706 CTTTTGTTTCAAATGTAGGAAGG + Intronic
951001919 3:17572801-17572823 CTTGTCCAAGAGATGAAGGAAGG - Intronic
951043215 3:18011088-18011110 CTCTATTAACTGATGAAGGAAGG - Intronic
954006836 3:47597915-47597937 CTTTGGGAACAGATGTAGGCTGG + Intronic
956025269 3:64976779-64976801 CTCTTCTAACAGTGGAAGGAAGG - Intergenic
958506562 3:94985906-94985928 CTTTTGTCACAGATGAGAGTGGG + Intergenic
958726453 3:97911104-97911126 CTTTGATAACAGATCAAGTAAGG + Intronic
958837469 3:99162659-99162681 TTTTAGTATCATATGAAGGAAGG + Intergenic
959404575 3:105944464-105944486 CCTTTGTAAGTGATGAAGCAAGG + Intergenic
959510803 3:107209483-107209505 CTTTTGTAACAGATGAAGAAAGG - Intergenic
960344019 3:116510373-116510395 CTTTTGTTCCAGATCCAGGAAGG + Intronic
960530542 3:118759055-118759077 GTTTTGTTACAGATAAAGAATGG - Intergenic
961349488 3:126290539-126290561 CTTGTGAGACAGAGGAAGGAAGG - Intergenic
962747710 3:138409842-138409864 CTCATGAATCAGATGAAGGAAGG - Intergenic
962956336 3:140270413-140270435 CTTTTGTAACAAATGAGACAGGG + Intronic
967102570 3:186228458-186228480 CTTTTTGAACAGATTAATGAAGG - Intronic
968359276 3:198135935-198135957 TTCATGTGACAGATGAAGGAAGG - Intergenic
968802491 4:2752370-2752392 CTTGTGTTACAGATGAGGTAAGG + Intronic
968855329 4:3116010-3116032 CTTTTTTAACAGATTAAGCCGGG + Intronic
970345381 4:15147801-15147823 CTTTTGTGCCAGATGGAAGAAGG - Intergenic
971017404 4:22502590-22502612 CTTTTTTAACAGAGGAAGAAAGG + Intronic
972373789 4:38451078-38451100 CTTTAGAAACAGATAAAAGAAGG + Intergenic
972473474 4:39429348-39429370 CTTTAGAAATAGATGAAGAAGGG - Intronic
972618258 4:40721362-40721384 CTATTGTAACAGATGTGGGAAGG - Intergenic
975100725 4:70509976-70509998 TTTTTGAAAAAGAAGAAGGAAGG + Intergenic
978221973 4:106287790-106287812 CTTTTATAACAGATGACTGGAGG + Intronic
978403640 4:108357017-108357039 CCTTTGTGACACATGAAGGAAGG - Intergenic
978843759 4:113247617-113247639 CTTGTTTGAAAGATGAAGGAGGG - Intronic
979374086 4:119924054-119924076 ATTTTGAAACAGATAGAGGAGGG - Intergenic
979507291 4:121513235-121513257 CGTTTTTAACAAAAGAAGGAGGG + Intergenic
979792357 4:124801002-124801024 CTTTTGTAACTCATGAGGGCTGG - Intergenic
980353476 4:131713451-131713473 CTTTTGAAAGAGATGAATCAAGG + Intergenic
981833296 4:149026942-149026964 TTTTTTTAACTGATGAAGGCAGG + Intergenic
982232392 4:153221646-153221668 GCCTTGTGACAGATGAAGGAAGG + Intronic
982634536 4:157876934-157876956 CTCTTGTAACAGCTTATGGAAGG + Intergenic
984293507 4:177825173-177825195 CTTATGTAAAAGATTTAGGATGG + Intronic
984432674 4:179668145-179668167 ATTTTGTAAAATATAAAGGATGG + Intergenic
984503590 4:180589640-180589662 CCCTTGTAACAGAAGAAGGCAGG + Intergenic
985994266 5:3588020-3588042 CTTTTGTAGGACATGAAGAAAGG - Intergenic
990013285 5:51026265-51026287 CTTTTGCAAGTGAGGAAGGAAGG + Intergenic
990401780 5:55445305-55445327 CTTTTGATGCTGATGAAGGATGG - Intronic
992237260 5:74723712-74723734 CTGTAGTACCAGATGAAGGCAGG - Intronic
992699288 5:79324665-79324687 ATTTTTTAAAAGATGAAGAATGG + Exonic
993853999 5:93049614-93049636 CTTTTGAAAGATATTAAGGATGG + Intergenic
994608220 5:101998534-101998556 TTTGTGTAGCAGCTGAAGGAAGG - Intergenic
994611928 5:102053298-102053320 TTTGTGTAACAAATGAATGATGG - Intergenic
995934348 5:117490173-117490195 CTTTTCTAAAAGAGGAAAGAAGG - Intergenic
996411979 5:123168509-123168531 CATTTGTAACAGGAGAAGGTAGG + Intronic
999531751 5:152470671-152470693 CTTTGGTTAAAGATGGAGGAAGG + Intergenic
999554159 5:152722394-152722416 CTTTTGTTTCAAATGTAGGAAGG - Intergenic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1001268141 5:170290121-170290143 CTTTTGGAAAAGGTGGAGGAGGG - Intronic
1001402479 5:171453850-171453872 CATTTATAACAGATCCAGGAGGG + Intronic
1002777360 6:340648-340670 CTTTTGTATCATTTGCAGGAAGG + Intronic
1005727164 6:28660806-28660828 CTTTGGTAAGAGAGGAAGGCAGG + Intergenic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1008068421 6:47074858-47074880 TGTTTTTAAAAGATGAAGGAGGG + Intergenic
1008586698 6:52957331-52957353 CCTTTGTAAGAGGTGAGGGAGGG - Intergenic
1009660862 6:66609392-66609414 ATTTTGAAACAGAGGAAGCAAGG - Intergenic
1010640123 6:78315221-78315243 CTTTTGTAACAGCAGTAAGATGG + Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1014912987 6:127116471-127116493 ACTTTGCAACAGATAAAGGATGG + Intergenic
1015427155 6:133084386-133084408 CTGGAGTAACACATGAAGGATGG - Intergenic
1016113223 6:140251806-140251828 GTTTTGCAACAGAAGAAGTAAGG + Intergenic
1017109168 6:150916259-150916281 ATTTTCTAAGTGATGAAGGAAGG + Intronic
1018150106 6:160930063-160930085 CTTTTGTGGCAGATGGAGCAGGG + Intergenic
1019195288 6:170277890-170277912 CTTTTGAAACAGGAGAGGGAAGG - Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020432032 7:8124574-8124596 TGTTTGTTACAAATGAAGGATGG - Intronic
1020877812 7:13720455-13720477 TGTTTGTCACAAATGAAGGAGGG + Intergenic
1020896805 7:13950683-13950705 CTTTTTGAAAAGATGAAAGATGG - Intronic
1020908964 7:14104393-14104415 CTTCTGTTACTGGTGAAGGAGGG + Intergenic
1024924832 7:54601577-54601599 CTTCTGGAACAGATGTAGTACGG - Intergenic
1026246619 7:68626130-68626152 ATTTTGTAACCAATGAATGATGG + Intergenic
1028019807 7:85756082-85756104 CTTTTGTATAAGATGTAAGAAGG - Intergenic
1028811797 7:95096406-95096428 TTTGTGCAACAGAAGAAGGAAGG - Intronic
1029380198 7:100209289-100209311 TTTTTATAACAGGTGAGGGAGGG + Intronic
1029493960 7:100887292-100887314 GTTTGGGAACAGAGGAAGGAAGG - Intronic
1030366784 7:108655797-108655819 TTTTTCTAAGAGATGTAGGAAGG + Intergenic
1031486484 7:122332641-122332663 ATTTTTTAAAAGATGAAGTATGG - Intronic
1032214884 7:129950290-129950312 CTTTTGTCAGAAAGGAAGGAAGG + Intronic
1032891692 7:136201454-136201476 CTTTTGTTACTGATAAAAGATGG - Intergenic
1033222446 7:139537406-139537428 CCTTTTTAACAAATGAAAGAGGG + Intronic
1034161602 7:148997831-148997853 CTTTTGTAGCAGATTGGGGAGGG + Intergenic
1034442653 7:151094457-151094479 CTTACGTATCAGATGAAGAAGGG - Intronic
1034762300 7:153684366-153684388 CTTATTTTACAGATGAAGGCAGG + Intergenic
1034942556 7:155240383-155240405 CTCCTGTAAAAGATGAAGAATGG + Intergenic
1037688607 8:21164339-21164361 CTTGGGAAACAGATCAAGGAAGG - Intergenic
1040464054 8:47678388-47678410 CTTTTCCCACAGCTGAAGGAAGG + Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041580167 8:59449536-59449558 CTTTTGTATAAGGTGAAGGAAGG - Intergenic
1042125450 8:65533629-65533651 GTTTTTTAACTGAAGAAGGAGGG + Intergenic
1042258986 8:66837467-66837489 CTTTTGTGACAGATGTAGAAAGG - Intronic
1042268949 8:66936628-66936650 CAGTTGTAAGAGATCAAGGAAGG - Intergenic
1042604322 8:70530473-70530495 CTTTTGTAAGAGATGCTGGGTGG + Intergenic
1042636452 8:70881091-70881113 TTTTTGTATAAGGTGAAGGAAGG - Intergenic
1042638169 8:70901829-70901851 CTTTTGTGTAAGGTGAAGGAAGG + Intergenic
1042790736 8:72602894-72602916 CATTTGTGACAGATCAAAGATGG - Intronic
1042969952 8:74397526-74397548 TTTTTGTATAAGGTGAAGGAAGG + Intronic
1043010186 8:74871358-74871380 TTTTTGTATAAGGTGAAGGAAGG - Intergenic
1044023158 8:87132185-87132207 TTTTTTTAACATATGAAGCAAGG - Intronic
1045449712 8:102310254-102310276 CTTTTGGAAATGAGGAAGGAGGG - Intronic
1045901090 8:107280789-107280811 CTGTTGAAATATATGAAGGAGGG + Intronic
1047526360 8:125637747-125637769 CTGTTATCACAGCTGAAGGAGGG + Intergenic
1047680140 8:127246236-127246258 CTTTTGTTCCAATTGAAGGATGG + Intergenic
1050789084 9:9443371-9443393 CTTTTGTAGAGGATTAAGGATGG + Intronic
1051607172 9:18927408-18927430 CTTTAGTCACAGGTGATGGAGGG - Intergenic
1051705881 9:19879133-19879155 CTTGTGTAAAAGATGAGGAAGGG - Intergenic
1052019730 9:23511875-23511897 ACTTTGTTACAGCTGAAGGAAGG - Intergenic
1052333078 9:27291289-27291311 CTTATGTAGCAGATTAATGAAGG + Intronic
1053626790 9:39880065-39880087 CTTTTGAAAGAGATGAATCAAGG + Intergenic
1053779198 9:41585955-41585977 CTTTTGAAAGAGATGAATCAAGG - Intergenic
1054167158 9:61796196-61796218 CTTTTGAAAGAGATGAATCAAGG - Intergenic
1054217097 9:62370638-62370660 CTTTTGAAAGAGATGAATCAAGG - Intergenic
1054670389 9:67784702-67784724 CTTTTGAAAGAGATGAATCAAGG + Intergenic
1054878593 9:70122128-70122150 CTTTGGCAACAAATGAATGATGG + Intronic
1056141371 9:83683645-83683667 CTTATGTAAGAGATGGAGGTAGG + Intronic
1057861813 9:98646693-98646715 CTGTTGTAACATATGAGGAAGGG - Intronic
1058587261 9:106522893-106522915 CTATTCTAAAAGATGGAGGAGGG + Intergenic
1059493679 9:114691520-114691542 CTTTTGGAAGAGAAGGAGGAAGG + Intergenic
1059809517 9:117840213-117840235 GTTCTCTAACAGATGAAGGAAGG + Intergenic
1060040662 9:120297609-120297631 CTTTTGTGGCAGATTAAAGATGG + Intergenic
1060583697 9:124772527-124772549 CTTTCGTAGCAGGTGAGGGACGG - Intergenic
1061829326 9:133280802-133280824 CTTTTGTTTCAAATGTAGGAAGG + Intergenic
1062743964 9:138199654-138199676 TTCATGTGACAGATGAAGGAAGG - Intergenic
1185888510 X:3803429-3803451 TTTTTGTAAAGGAGGAAGGAAGG - Intergenic
1187200566 X:17130119-17130141 TTTTATTAACAGCTGAAGGAGGG - Intronic
1190773151 X:53531799-53531821 GTTTTGTGACAGATGAAGAAAGG - Intergenic
1192373621 X:70536757-70536779 TTTTTGTAAAAGAACAAGGAAGG - Intronic
1193338290 X:80316489-80316511 CTTTTGTAACAGAACAAAGTTGG + Intergenic
1194424066 X:93715498-93715520 CATTTGTAACAGATGTAATAGGG - Intergenic
1194712442 X:97252017-97252039 CTTTTCTGACAGAAGAAGCAAGG - Intronic
1195707211 X:107746217-107746239 CTTATGAAACAGAGAAAGGAGGG + Intronic
1195857326 X:109345322-109345344 CTTGGATAACAGATGAAGAATGG - Intergenic
1195971128 X:110474696-110474718 GTTTTGTAACAGCTCAAAGAAGG + Intergenic
1199080569 X:143572133-143572155 CTTGTGGACCAGAAGAAGGAAGG - Intergenic
1200714681 Y:6524799-6524821 TTTTTGTATAAGGTGAAGGAAGG + Intergenic
1200738944 Y:6832138-6832160 CTTTTGCAACTCATTAAGGAGGG + Intergenic
1200773559 Y:7149775-7149797 TTTTTATAAAGGATGAAGGAAGG + Intergenic
1201019143 Y:9636331-9636353 TTTTTGTATAAGGTGAAGGAAGG - Intergenic
1201433274 Y:13928207-13928229 TTTTTGTAACAGACGAATCATGG + Intergenic