ID: 1095364429

View in Genome Browser
Species Human (GRCh38)
Location 12:41385599-41385621
Sequence CACCCTTCCAAGACTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13358
Summary {0: 2, 1: 37, 2: 590, 3: 5453, 4: 7276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095364429 Original CRISPR CACCCTTCCAAGACTGAACA AGG Intronic
Too many off-targets to display for this crispr