ID: 1095364992

View in Genome Browser
Species Human (GRCh38)
Location 12:41392598-41392620
Sequence ATAACTAGGATGTAAGTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095364992_1095364997 25 Left 1095364992 12:41392598-41392620 CCCCTTACTTACATCCTAGTTAT 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1095364997 12:41392646-41392668 TATCACCTATTGAATCCTATTGG 0: 1
1: 0
2: 1
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095364992 Original CRISPR ATAACTAGGATGTAAGTAAG GGG (reversed) Intronic
902847365 1:19122538-19122560 CTGACTAGGATGTAAGCAAATGG + Intronic
905154853 1:35968031-35968053 ATAACCAGAATGTAATCAAGGGG - Intronic
906187412 1:43871968-43871990 ATGACTGGGATGTGAGAAAGAGG + Intronic
907803359 1:57793799-57793821 ATCACTAGGCTTTTAGTAAGAGG + Intronic
909604918 1:77498301-77498323 GTGACTAGGAAGTAAGTAAATGG + Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915682341 1:157593519-157593541 ATAACTAGGCCTCAAGTAAGAGG - Intronic
917277555 1:173346943-173346965 ATAACTAGTATTCAAGTAAGAGG + Intergenic
919485304 1:198138839-198138861 ATAAGTAGGCTGTAAGTATCTGG + Intergenic
919713066 1:200747472-200747494 ATGACTAGGTTGAAAGTAAATGG + Intronic
919953481 1:202389170-202389192 ATAACTAGGAAGCAAGGAAGAGG + Intronic
920041673 1:203101961-203101983 AAAACAAGGATGTAATTCAGAGG + Intronic
922075744 1:222242489-222242511 ATAAATAGTATGTAAATAAATGG - Intergenic
922336652 1:224623750-224623772 ATAACTAGGAGGGGAGGAAGTGG - Intronic
923919616 1:238548453-238548475 ATAACTTGGCTGTAAGTATTTGG - Intergenic
1064214274 10:13386485-13386507 ATGAGTAGGATCTAAGTAATGGG + Intergenic
1065660836 10:28002823-28002845 ATAACCAGGGAGAAAGTAAGAGG + Intergenic
1067918926 10:50432895-50432917 ATAACAATAATGTTAGTAAGTGG - Intronic
1068489557 10:57705977-57705999 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
1069106830 10:64393631-64393653 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
1069141476 10:64832194-64832216 ATAAATAGGAACTGAGTAAGAGG + Intergenic
1070445520 10:76497133-76497155 ATAACAAGGAAGTAAGTGAAGGG - Intronic
1071199215 10:83199606-83199628 ATAAATAGGCTGTTAGTAAGAGG + Intergenic
1071454150 10:85830277-85830299 TTAAATATGATGTAAGGAAGGGG - Intronic
1072527988 10:96291174-96291196 TTAACTAGGTTTTAAATAAGTGG + Intergenic
1073203590 10:101756022-101756044 ATAAGTAGGCTGAAAGTAAAAGG - Intergenic
1075058141 10:119235354-119235376 CTCACTAGCATGTAAGTAATTGG + Intronic
1078593796 11:12669476-12669498 ATAAGTAGGAGGTAAATAAATGG + Intergenic
1079534080 11:21489902-21489924 ATAAATAGGATTGATGTAAGTGG - Intronic
1079709026 11:23657410-23657432 AAAACTGGAATGTAATTAAGTGG - Intergenic
1081052733 11:38365254-38365276 AGAACTAGGATGTAAACATGTGG - Intergenic
1084754505 11:71227349-71227371 ATAGGTAGGATGAAAGTAAAAGG + Intronic
1085219036 11:74857275-74857297 ATAAATAGGTTGCAAGTAAATGG + Intronic
1088044249 11:105428360-105428382 AAAACTAGGTTGTAGGGAAGAGG + Intergenic
1088093273 11:106067901-106067923 ATAAGTAGGTTGAAAGTAAAAGG + Intronic
1089853454 11:121519659-121519681 ATAATTAGGTTGTAAGTACCTGG + Intronic
1090623938 11:128588713-128588735 TTAACTTGGAAGTAAGGAAGAGG + Intergenic
1090680245 11:129048010-129048032 ATTACTAGGCTATAAGTAAATGG - Intronic
1091262043 11:134242319-134242341 ATAACCAGGATGTGAGTAGGGGG - Intronic
1093751124 12:22801328-22801350 ATAACTATGTTATAAGTAAAAGG + Intergenic
1095196121 12:39319658-39319680 ATAACTGGCAAGTAAGTAAGTGG + Intronic
1095364992 12:41392598-41392620 ATAACTAGGATGTAAGTAAGGGG - Intronic
1096682591 12:53266670-53266692 ATAGCTAAGGTGTAAGCAAGAGG + Intergenic
1097247309 12:57613675-57613697 ATACCTAGGATGAAAGCAGGAGG - Exonic
1097373009 12:58807231-58807253 ATAATTAGGATGTTAGAAAAGGG + Intronic
1097765184 12:63518310-63518332 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
1098640536 12:72833624-72833646 ATAACTAGTCTTTAAATAAGAGG - Intergenic
1098881210 12:75919351-75919373 ATAACAAGGATAAAAGTAAAAGG + Intergenic
1100729749 12:97451579-97451601 ATAAGTTGGATGTAAGTATGTGG + Intergenic
1100818526 12:98409011-98409033 AGAACGAGGATGGAATTAAGTGG + Intergenic
1106460938 13:29967499-29967521 ATAGGTAGGATGAAAGTAAAAGG + Intergenic
1106577825 13:30992394-30992416 ATAACAAGTATGAAAGTATGAGG + Intergenic
1109581779 13:64348699-64348721 ATAATTATGATGCAAGTAATTGG + Intergenic
1110744456 13:79036710-79036732 ATAACTAGTCTTGAAGTAAGAGG + Intergenic
1111876938 13:93909623-93909645 ATAACTAGGATCTCCTTAAGAGG - Intronic
1112971791 13:105270760-105270782 GTATCTAGGAAGTAACTAAGTGG + Intergenic
1115254826 14:31388668-31388690 TAAACTAGGTTGCAAGTAAGAGG - Intronic
1116322268 14:43483540-43483562 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
1116515262 14:45796985-45797007 ATTACTAGGATGAAAGCATGGGG + Intergenic
1118400866 14:65378458-65378480 CTGCCCAGGATGTAAGTAAGAGG + Intergenic
1119118668 14:72052335-72052357 ATAACTAGAATGAACATAAGTGG + Intronic
1119550411 14:75507216-75507238 ATAAATAGGTTGTATGTAAAAGG + Intergenic
1121503079 14:94454343-94454365 ATAACTGGGCTGTAAGTATTTGG + Intergenic
1121646152 14:95518030-95518052 ATAAATGGGATCTAACTAAGAGG - Intergenic
1122666856 14:103335563-103335585 ATAACTAGGATGTAAAAAGGAGG + Intronic
1125333902 15:38608583-38608605 ATAACACAGATGTAAGTTAGTGG + Intergenic
1126374691 15:47985374-47985396 TTAACTAGGATCTAACTAGGTGG + Intergenic
1126424444 15:48511623-48511645 ATAACTGGGAAGTAAGTGAGGGG - Intronic
1126557986 15:50011343-50011365 ATAACTAAAATGCAAGTAAAAGG + Intronic
1127010040 15:54615199-54615221 ATAACTGGATTGTAAGTAAAAGG - Intronic
1131654986 15:94446777-94446799 ATAACTAGGTTGTCAGAAACAGG + Intronic
1133816913 16:9204461-9204483 ATAACTAGGGTGTTAGTCATTGG - Intergenic
1134481778 16:14625926-14625948 ATAAGGAGAATGTGAGTAAGGGG - Intronic
1136528631 16:30850345-30850367 ATAAATAGTTTGTAAGTAAAAGG - Intronic
1137331441 16:47501309-47501331 ATGACTAGGAAATAAGTATGAGG + Intronic
1138260102 16:55612910-55612932 ATAAATAGGTTGAAAGTAAATGG - Intergenic
1140325446 16:73997067-73997089 AGAACTAGGATGTGGCTAAGAGG + Intergenic
1141045944 16:80716248-80716270 ATAATTATGATGTAAGTACTTGG - Intronic
1143227242 17:5316525-5316547 ATATATAGGATGTAAGAAATAGG + Intronic
1145083468 17:19915420-19915442 ATGCCAAGGATGTAAATAAGAGG - Intronic
1149711743 17:58749362-58749384 ATAACTAATATGTAAATCAGGGG - Intergenic
1155831514 18:30521278-30521300 ATAATTAGAATTTAAATAAGTGG + Intergenic
1159155695 18:64578692-64578714 AAAAATATGGTGTAAGTAAGGGG + Intergenic
1159549988 18:69884804-69884826 ATAACTAGTCTTCAAGTAAGAGG - Intronic
1160472322 18:79146985-79147007 ATAGATAGGATGAAAGTAAAAGG + Intronic
1164387479 19:27787127-27787149 ACAACTAGGCTGAAAGTAAAAGG + Intergenic
925533409 2:4889589-4889611 ATAAAAAAGATGTAAGAAAGTGG + Intergenic
927269770 2:21193600-21193622 CTAACTTGGAAGTAAGTGAGTGG - Intergenic
931677654 2:64713751-64713773 ATCACTGAGTTGTAAGTAAGTGG + Intronic
932800382 2:74737154-74737176 ATAACTAGGAGGTAAACAATAGG - Intergenic
932916964 2:75870057-75870079 ATAACTAGTCTTCAAGTAAGCGG + Intergenic
933043177 2:77496012-77496034 ATAAGGAAGATGTAAGTAATGGG - Intronic
934707512 2:96494462-96494484 ATAACTTGTATGCAATTAAGTGG + Intergenic
934972363 2:98773792-98773814 ATGATTAGGATGTAACTCAGGGG + Intergenic
935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG + Intergenic
935914759 2:107937050-107937072 ATCAATAGGATGTAATCAAGGGG - Intergenic
939431296 2:142112094-142112116 ATAACTGTGATGTAAGTTATCGG - Intronic
943880591 2:193139939-193139961 GTATCTAGGAAGTAAGTAATTGG - Intergenic
944353710 2:198759985-198760007 ATAAATTGGAGGTATGTAAGTGG + Intergenic
944540362 2:200748544-200748566 ATCACTAGGCTGTAAGGAGGTGG - Intergenic
946704037 2:222439651-222439673 ATAACTTGGATGTATGTCACGGG + Intronic
947096147 2:226569047-226569069 ATCACTAGGAAGTAATTAAGTGG - Intergenic
947249984 2:228091133-228091155 ATAAATAGGTTGAAAGTAAAAGG + Intronic
1170108427 20:12778226-12778248 ACCACTAGGATGTGAGTAACTGG + Intergenic
1170242818 20:14188267-14188289 AAAACTATAATGTACGTAAGAGG - Intronic
1170451897 20:16491557-16491579 TTAACTTGGATATAAGGAAGAGG + Intronic
1170792022 20:19516379-19516401 ATAACTAGAATGGAATTAAGGGG - Intronic
1173449778 20:43152803-43152825 ATATATAGTATGTAATTAAGAGG - Intronic
1181381808 22:22510826-22510848 ATATCTAAAATGTACGTAAGAGG + Intergenic
1181661456 22:24352910-24352932 GAATCTAGGCTGTAAGTAAGTGG - Intronic
1181757295 22:25033061-25033083 ATGGCTAGGTGGTAAGTAAGGGG - Intronic
1182313982 22:29431041-29431063 ATAAGCAGGATGTAAATGAGAGG + Intergenic
1182382244 22:29901220-29901242 ATGACTAGGATGTAAGCACTAGG + Intronic
1182882617 22:33746714-33746736 AAAACTAAGATTTAAGTCAGAGG + Intronic
950271852 3:11622959-11622981 ATACCAAGTATGTAAGTAAATGG - Intronic
952591204 3:34956122-34956144 ATAACTAGAAAGTAGGAAAGTGG + Intergenic
957784400 3:84863149-84863171 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
959507243 3:107170078-107170100 TTATCAAAGATGTAAGTAAGTGG - Intergenic
959743583 3:109749728-109749750 CTAATTTGGAAGTAAGTAAGAGG + Intergenic
960487554 3:118271840-118271862 TTAACTAGGAAGGAAGAAAGTGG - Intergenic
960596298 3:119410992-119411014 ATAACTTAGATGGAAGAAAGGGG + Intronic
962902789 3:139775689-139775711 ATAACTAGTATCTCTGTAAGAGG + Intergenic
963559488 3:146844416-146844438 AAAACTAGGATGTAAAAAACTGG + Intergenic
964996109 3:162883178-162883200 ATAACTGGGAAGTAAGGAAGTGG + Intergenic
966475789 3:180344301-180344323 ATAAGTTGGCTGTAGGTAAGTGG + Intergenic
967277425 3:187790130-187790152 ATGAATAGGAGGTAAGGAAGTGG - Intergenic
967560658 3:190915124-190915146 ATAGCAAGGATATTAGTAAGTGG - Intergenic
968714424 4:2144711-2144733 ATAACTAAGATGTAAGTCCCTGG + Intronic
970169411 4:13274861-13274883 ATAACTAGAGTGTGAGGAAGAGG - Intergenic
971729218 4:30354719-30354741 ATAATTATGATGATAGTAAGGGG - Intergenic
972114512 4:35613102-35613124 ATAACTAGTATTGAAATAAGTGG + Intergenic
972880391 4:43416010-43416032 ATAACTAGTACTCAAGTAAGAGG - Intergenic
972920548 4:43935929-43935951 ATAAGTAGGTTGTAGGTATGTGG - Intergenic
979700336 4:123659422-123659444 TTATCTGGGATGTAAGTCAGAGG + Intergenic
980262692 4:130473131-130473153 TTAAAGAGGATGTAAATAAGTGG - Intergenic
980305691 4:131058526-131058548 ATCAGTTGGTTGTAAGTAAGTGG - Intergenic
981988037 4:150881447-150881469 ATAACTAGGAGCTAAATAATGGG + Intronic
982508857 4:156254738-156254760 ATAACCAGGAAGGAAGGAAGAGG + Intergenic
983971791 4:173884194-173884216 ATAACTAGGATTTTAGCAAGTGG - Intergenic
984630782 4:182058307-182058329 ATAGCTAGGATGGAAGCAAATGG - Intergenic
985340267 4:188944352-188944374 ATAACTTGGATGAAAATAACAGG - Intergenic
985933584 5:3078286-3078308 ATAACAAGAATGTACATAAGGGG + Intergenic
987592998 5:19956999-19957021 ATTGTTAGTATGTAAGTAAGTGG - Intronic
987908709 5:24113495-24113517 ATCACTAGGATGTAAGAGACAGG - Intronic
988645309 5:33088866-33088888 ATCAGTTGGATGTAAGTATGTGG + Intergenic
989231146 5:39087378-39087400 ATATATAGACTGTAAGTAAGGGG + Intergenic
991466432 5:66917622-66917644 TTAACTAGGACTTAAGTAACTGG - Intronic
991509241 5:67358646-67358668 ACAATGAGGATGTAAATAAGTGG - Intergenic
992699075 5:79321879-79321901 ATTACAAGGATGTAAATATGTGG - Exonic
994458902 5:100049387-100049409 ATAAGGAGGATGTAAGTCCGTGG + Intergenic
994857668 5:105145155-105145177 ATAAATAGTATGCATGTAAGAGG - Intergenic
995374572 5:111459559-111459581 TTAACTTTGATTTAAGTAAGTGG - Intronic
995375077 5:111464763-111464785 TTAACTTTGATTTAAGTAAGTGG + Intronic
995410435 5:111851278-111851300 ATGAGCAGGATTTAAGTAAGTGG - Intronic
995422765 5:111985891-111985913 ATAACTATGATGTAAATAACTGG + Intronic
996461106 5:123743905-123743927 ACAACTAGAATGTAAGCCAGGGG - Intergenic
996757451 5:126949655-126949677 ACAACCAGGAAGGAAGTAAGGGG - Intronic
997113294 5:131098798-131098820 ATAAATATGATGTAGATAAGAGG + Intergenic
998560195 5:143164403-143164425 ATAACTGGCTTGTAAGGAAGAGG - Intronic
999170948 5:149594792-149594814 AAAGCTAGGAGGTAAGTACGTGG - Intronic
1000792959 5:165629636-165629658 AAAGCTAAGATGTAAGAAAGGGG + Intergenic
1003578610 6:7319384-7319406 AGCACAAGGATGCAAGTAAGTGG - Intronic
1003707665 6:8552392-8552414 ATAAATATTATTTAAGTAAGTGG + Intergenic
1004308980 6:14527069-14527091 ATAAATAGGTTGACAGTAAGTGG + Intergenic
1004679805 6:17882295-17882317 TTAACTAGACTGTAAGCAAGAGG - Intronic
1006247679 6:32754438-32754460 ATAACTTGGAGGAAAGTATGTGG - Intergenic
1009396821 6:63208772-63208794 ATATAAATGATGTAAGTAAGTGG + Intergenic
1009553507 6:65131227-65131249 AAAACTATAAAGTAAGTAAGGGG + Intronic
1010275255 6:73961675-73961697 ATAACTAGTCCTTAAGTAAGAGG - Intergenic
1010578246 6:77561069-77561091 AGAACTAAGATGTAATTGAGTGG + Intergenic
1010813714 6:80329845-80329867 CTAAAAAGGAAGTAAGTAAGGGG - Intronic
1010921004 6:81680572-81680594 ATAACTAGGATCTAAACAATGGG + Intronic
1011936281 6:92782359-92782381 ATAACTAGGTTTTAAGTGAGTGG - Intergenic
1012463778 6:99493983-99494005 TTAAGTATGATATAAGTAAGAGG + Intronic
1013675113 6:112450794-112450816 ACAACTAGGCTGAAAGTAAAAGG - Intergenic
1014347361 6:120290213-120290235 ATAAAAAGTACGTAAGTAAGTGG + Intergenic
1015613854 6:135054641-135054663 ATAACTACGATGAAGGTAGGTGG - Exonic
1017040806 6:150307342-150307364 ATTATTATGTTGTAAGTAAGAGG + Intergenic
1017551681 6:155516476-155516498 ATAAGTAGGTTGAAAGTAAATGG - Intergenic
1019110660 6:169709687-169709709 ATCACTACAATGTAAGTAACAGG + Intronic
1021257255 7:18408005-18408027 GTAAGTACGATGTAAGTATGAGG - Intronic
1024298840 7:47869391-47869413 AAAATTAGGTTGTAAGTAAAAGG + Intronic
1024614271 7:51095667-51095689 ATAAATAGGCTGGAAGTAAAAGG + Intronic
1025321523 7:58099496-58099518 AAAAATAGGATGTAAGAATGAGG - Intergenic
1026882096 7:73913548-73913570 ATGAATAGGATGAAAGGAAGGGG - Intergenic
1028961828 7:96757448-96757470 ATCAGTTGGCTGTAAGTAAGTGG + Intergenic
1030319708 7:108152437-108152459 AAAAGTAGGAGTTAAGTAAGGGG + Intronic
1039596923 8:38798677-38798699 AAAACTATGATGTACCTAAGAGG + Intronic
1040669079 8:49665305-49665327 ATAACTAGGCTGTGAGCAATGGG + Intergenic
1040718570 8:50289454-50289476 ATAACTAAGGTATAAGCAAGAGG - Intronic
1040741076 8:50576674-50576696 ATACTTAGGAATTAAGTAAGAGG - Intronic
1042015924 8:64311184-64311206 ATAACTGGGAGCTAAGTAATGGG + Intergenic
1044075703 8:87819858-87819880 ATAGCAAGGATATCAGTAAGAGG + Intergenic
1048781603 8:138007749-138007771 GTATCTAGGAAGTAAGTAACTGG + Intergenic
1052512472 9:29439380-29439402 AGAAATAGCATGTAAGAAAGGGG + Intergenic
1054714662 9:68545635-68545657 ATAAAAAGAATGTAAGAAAGAGG + Intergenic
1055301235 9:74885264-74885286 ATAGGTAGGATGCATGTAAGTGG + Intronic
1056260057 9:84839943-84839965 AGAAATACGATGTTAGTAAGTGG + Intronic
1057157185 9:92853227-92853249 ATGACTGGGAGGTAAGAAAGAGG + Intronic
1058867054 9:109170214-109170236 AAACCTAGGATGTAACTAAGAGG - Intergenic
1059126153 9:111687617-111687639 TTAATTAGGATATAAGTTAGAGG + Intronic
1185872559 X:3676104-3676126 ATGACTTGCATGTCAGTAAGGGG - Intronic
1186682312 X:11888182-11888204 ATAACTAGGATGTGGATGAGAGG + Intergenic
1191632862 X:63341520-63341542 ATAAATAGGTTGGAAGTAATAGG + Intergenic
1192280143 X:69676286-69676308 AGAAGCAGGAAGTAAGTAAGGGG + Intronic
1194227203 X:91275595-91275617 ATCAGAAGGCTGTAAGTAAGTGG - Intergenic
1194376520 X:93140655-93140677 AAAACTAGGTTGAAAGTAAAAGG - Intergenic
1194889384 X:99358722-99358744 ATAATTAGGATAAAAGTAAAAGG - Intergenic
1197259387 X:124301428-124301450 ATAACTAGGCTGAAAGTGAAAGG - Intronic
1198115900 X:133544523-133544545 ATAGTAAGTATGTAAGTAAGTGG - Intronic
1198323619 X:135544290-135544312 ATGACTGGGAAGTAAGAAAGGGG - Intronic
1199388500 X:147251314-147251336 AGAACTGGGATGGAAGAAAGAGG + Intergenic
1200396553 X:155993074-155993096 ACAAATAGGATGAAAGTAAAAGG + Intergenic
1202063333 Y:20911166-20911188 ACAACTAGGATGGAAATAAGGGG + Intergenic
1202581183 Y:26382095-26382117 ATAACTAGGAAGCAAGGAAGAGG - Intergenic