ID: 1095365345

View in Genome Browser
Species Human (GRCh38)
Location 12:41397455-41397477
Sequence AGGGTTGGATTATTACTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095365345_1095365349 8 Left 1095365345 12:41397455-41397477 CCAATCAGTAATAATCCAACCCT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1095365349 12:41397486-41397508 TGCACTAAATTATTTTCATTTGG 0: 1
1: 1
2: 1
3: 46
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095365345 Original CRISPR AGGGTTGGATTATTACTGAT TGG (reversed) Intronic
903496044 1:23767959-23767981 AGGTTTTGTTTTTTACTGATGGG + Intergenic
905228461 1:36495111-36495133 CGGGTTGGATTATTTCTTTTTGG + Intergenic
907730137 1:57058016-57058038 AGGGTTGGATTTTTCCTCCTGGG - Intronic
910726740 1:90347912-90347934 AGGGTTGGAAAATTACCTATTGG + Intergenic
917218019 1:172698080-172698102 AGCCTTGGATTATACCTGATTGG + Intergenic
919102416 1:193110806-193110828 AAGATATGATTATTACTGATTGG - Intergenic
921357213 1:214296333-214296355 AGTATTTGATTATTACTGACTGG - Intronic
923728516 1:236528428-236528450 ATGGTTGTTTTGTTACTGATAGG + Intronic
924199328 1:241642480-241642502 AGGGTTGGAATGTTTCTGGTCGG + Intronic
1065456882 10:25916306-25916328 AGGGTTGGAATGTTTCTGGTTGG - Intergenic
1065508348 10:26452791-26452813 AGGGTTGAAAAATTACCGATTGG - Intronic
1067990263 10:51204140-51204162 AGGATTGTATTATTTCTGATGGG + Intronic
1069471250 10:68691509-68691531 CGGGTTGGATGATTACGGTTGGG - Exonic
1073831801 10:107393175-107393197 ATGGGTGGCTTATTACTTATTGG - Intergenic
1078949508 11:16113892-16113914 AGGATTGGATTAAGACTGAATGG + Intronic
1079581711 11:22072908-22072930 AGGGTTGAATAATTACCTATTGG - Intergenic
1079691240 11:23420222-23420244 AGGGCTTGATTAATTCTGATGGG - Intergenic
1079694366 11:23460674-23460696 AGGGTTTTATTCTTACTGGTGGG - Intergenic
1082563274 11:54644452-54644474 AGGGTGGGATTACTTCAGATTGG + Intergenic
1084313820 11:68332210-68332232 AGGGTTGGCATATGACTGTTGGG - Intronic
1087582881 11:100081529-100081551 AGTGTTGGATTAGTTCAGATGGG - Intronic
1091963331 12:4717993-4718015 AGGGCTGCCTCATTACTGATGGG + Intronic
1095365345 12:41397455-41397477 AGGGTTGGATTATTACTGATTGG - Intronic
1099949045 12:89279523-89279545 AGGGTTGGAAAACTACTTATTGG - Intergenic
1103611232 12:122125351-122125373 AGGGTTAAGTTATTACTGAAAGG - Intronic
1107293970 13:38890217-38890239 AGGGTTGGAGTGTTTCTGGTCGG - Intergenic
1108204624 13:48075136-48075158 AAGTTTGGATTATTTCTGATAGG + Intronic
1108600619 13:51991380-51991402 AGGGTGGGAGGATCACTGATGGG + Intronic
1112829226 13:103428175-103428197 AGGGTTGGTTTCTTACGGACAGG - Intergenic
1112829233 13:103428210-103428232 AGGGTTGGTTTCTTACAGAAAGG - Intergenic
1113523966 13:110959383-110959405 GGGGTTGGATTAAAAGTGATGGG + Intergenic
1113898927 13:113785088-113785110 AGGGTTGGAATGTTTCTGGTCGG + Intronic
1121291764 14:92781622-92781644 AGATTTGGAGTAATACTGATGGG - Intergenic
1124642310 15:31403395-31403417 AGGGTTTCATTATTAAAGATGGG - Intronic
1124939331 15:34203495-34203517 AGGGTGGGGTTATTCTTGATTGG - Intronic
1127037641 15:54936234-54936256 AGGGATGAATAATTACCGATTGG + Intergenic
1131396937 15:92093653-92093675 AGGCTAGGATTTTTACTGGTTGG + Intronic
1131753838 15:95539048-95539070 TGGTTTGTATTATTACTCATAGG - Intergenic
1134838867 16:17384868-17384890 AGGGTTAGTTTATTACTAAACGG - Intronic
1135916080 16:26606763-26606785 AGGGTGGGGTTGTTACTGGTGGG - Intergenic
1143307213 17:5956915-5956937 AGGGTTGGTTTGTGACTGCTGGG - Intronic
1144142234 17:12360825-12360847 ACTGTTGGATTAATACTGTTTGG + Intergenic
1149059036 17:52400010-52400032 AGGGTTGAAAAATTACTTATTGG + Intergenic
1149101751 17:52915098-52915120 AGGGTTGGAAAATTACCTATTGG - Intergenic
1150660812 17:67076182-67076204 GGGGGTGGATAATCACTGATGGG + Exonic
1153140213 18:1963659-1963681 AGGCCTGGAGTATTACTGATTGG - Intergenic
1155373993 18:25136423-25136445 TGGGTTGGGTAATTACTGTTAGG + Intronic
1163227928 19:15978203-15978225 AGGGTTGGAATGTTTCTGGTCGG - Intergenic
1166598286 19:44071176-44071198 ATGGTTGGAATGTTTCTGATTGG - Intergenic
1168200172 19:54809273-54809295 AGGGTTGGATCATGACAGACAGG - Intronic
1168514619 19:57001238-57001260 AGGCCTGGATTCTTCCTGATAGG - Intergenic
925552060 2:5086977-5086999 ATGGTTATATTATTACAGATTGG - Intergenic
926113870 2:10198882-10198904 AGGGTTGGAATGTTTCTGATTGG + Intronic
929218327 2:39438022-39438044 AGGGTTGGATTATCAAAGACGGG + Intergenic
930405937 2:50955810-50955832 AGTGTTTGATAATTACTGAGGGG + Intronic
931743282 2:65268303-65268325 AGGGTGGTATTAATAATGATGGG + Intronic
933510321 2:83232849-83232871 AGGGTTGAAAAATTACTTATTGG + Intergenic
934495485 2:94793279-94793301 AGGGTTGGAAAACTACTTATTGG - Intergenic
935611616 2:105031554-105031576 AGGGTTGGAATGTTTCTGGTTGG + Intergenic
937668803 2:124517218-124517240 AGGGTTGTGGTATTAGTGATGGG + Intronic
938393806 2:130926893-130926915 AGGCTTGGAATATTTCTGTTGGG + Intronic
939102027 2:137906400-137906422 AGGGTCTGTTTTTTACTGATGGG + Intergenic
939296688 2:140275206-140275228 AGGTTTGTATTGTTACTGACAGG - Intronic
939938195 2:148317577-148317599 AGGGTTGAAAAATTACTTATTGG - Intronic
942849387 2:180465923-180465945 AGTGATGGATTATTACTGAACGG - Intergenic
943492055 2:188566862-188566884 ATGGTTGGATTTTTAATTATAGG - Intronic
943968769 2:194375182-194375204 AGGGTTGAATAATTACCTATTGG - Intergenic
944639475 2:201708517-201708539 AGGGTTGAAAACTTACTGATAGG - Intronic
947172166 2:227322864-227322886 AGGCTTGGAATATTTCTGCTTGG + Intergenic
1170329810 20:15196605-15196627 TGGCTTGGCTTACTACTGATTGG - Intronic
1170479616 20:16753104-16753126 AGGGTTGGGAAAGTACTGATAGG - Intronic
1171515002 20:25723099-25723121 AGGGTTGGGAGATTACTTATTGG + Intergenic
1172595825 20:36150561-36150583 AGGGTCGGAATATGACTGACAGG - Intronic
1172852873 20:37979226-37979248 TGGGTTGGATTTTTAGAGATGGG - Intergenic
1173769969 20:45647824-45647846 GGGGTTGGCTTAGTACTGAGTGG + Intergenic
1177336691 21:19737150-19737172 AGGGTTGGAATGTTTCTGGTTGG + Intergenic
1183049043 22:35245997-35246019 AGGGGTGGCTAATTACTGCTGGG + Intergenic
1183258389 22:36777890-36777912 AGGGTTGGAATGTTTCTGATTGG - Intergenic
1183454114 22:37912209-37912231 TGGGTGGGATTAATACTGAGGGG + Intronic
1185243721 22:49761515-49761537 AGGGTTGAAATATTACCTATTGG + Intergenic
950293137 3:11803952-11803974 AGGGTTGGAAAATTACCTATTGG + Intronic
957502072 3:81069948-81069970 AGGGTTGGAATGTTTCTGGTTGG - Intergenic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
963112436 3:141698573-141698595 AGGGTTGGAGTATTAATTATGGG + Intergenic
968014312 3:195315007-195315029 AGGTTTGGACTTTCACTGATTGG + Intronic
971181089 4:24329153-24329175 ATGCTGGGATTATTGCTGATTGG + Intergenic
971260206 4:25050084-25050106 AGGGTTGAAAAATTACTTATTGG + Intergenic
975042868 4:69766405-69766427 TGGTTTGGATGATAACTGATGGG - Intronic
975043203 4:69769843-69769865 GAGGTTGGATTAATAATGATGGG + Intronic
979084364 4:116388257-116388279 AGGGTTGGCATATTTCTGGTTGG - Intergenic
982786034 4:159537988-159538010 AGGGTTGAAAAATTACTTATTGG + Intergenic
983070153 4:163257902-163257924 AGGGTTGGTTTACAAGTGATGGG + Intergenic
983296848 4:165876960-165876982 AGGAATGGATTACTACTGTTAGG + Intronic
984110660 4:175609379-175609401 AGGGTTGTTTTGTAACTGATTGG - Intergenic
984191822 4:176614903-176614925 ATGGTTGGATTATTACTATTGGG + Intergenic
984986060 4:185330337-185330359 AGGGTTGGAATGTTTCTGGTTGG + Intronic
986521566 5:8624401-8624423 AGGGTTGAAAAATTACTTATTGG - Intergenic
994052604 5:95380016-95380038 AGGGTTGGAATGTTTCTGGTTGG - Intergenic
995372475 5:111434392-111434414 GAGGTAGGATTATGACTGATTGG + Intronic
995681562 5:114726359-114726381 AGGGTTGGAATGTCTCTGATGGG - Intergenic
996565353 5:124874595-124874617 AGGGATGGATTAGTTCTCATGGG - Intergenic
996633918 5:125667587-125667609 AGGGTTGGAATGTTTCTGGTTGG + Intergenic
999775777 5:154812069-154812091 AGGGCTGGGTTATTACTGCTGGG + Intronic
999801416 5:155041450-155041472 AGGGAGGGGTTATTACTGATGGG - Intergenic
1003906176 6:10701646-10701668 AGGATTGGATTGTGGCTGATTGG + Intronic
1003993838 6:11517663-11517685 AGGGTTGAAATATTACCTATTGG + Intergenic
1008876142 6:56330624-56330646 AGGGATGAAATATTACTTATTGG - Intronic
1009681622 6:66900770-66900792 AGGGGTGGATTATTCATGAAAGG + Intergenic
1010111092 6:72233774-72233796 TGATTTGGATTATTACTGGTTGG + Exonic
1012818519 6:104055097-104055119 AGGGTAGGATTGTCACTGCTGGG + Intergenic
1014287792 6:119521043-119521065 ATGGTAAGATTATTACTGTTGGG + Intergenic
1032327972 7:130950184-130950206 AGGGTAGGGTTACTACAGATGGG + Intergenic
1033027487 7:137789759-137789781 AAGGTTGGAGAATTTCTGATAGG - Intronic
1034051688 7:147990588-147990610 GGGGTTGGAATGTTTCTGATTGG + Intronic
1035770264 8:2141653-2141675 AGGGTTGGAATGTTTTTGATTGG + Intronic
1037235678 8:16717040-16717062 AGGGTTGGAATGTTTCTGATCGG - Intergenic
1039059024 8:33558800-33558822 AGGGTTGGAAATTTACTGCTGGG + Intronic
1039090969 8:33829295-33829317 AGGGTTGAAAAATTACTTATTGG - Intergenic
1044129656 8:88505902-88505924 AGGGTTGGGTTTTTACTGGGTGG - Intergenic
1044778489 8:95719421-95719443 AAGTTTGGATTATAACTGTTTGG + Intergenic
1047971666 8:130089650-130089672 TGTGTTGTATTATTACTGCTTGG - Intronic
1051869368 9:21718786-21718808 AGGGATGGAATATTACCTATTGG + Intergenic
1051873719 9:21768521-21768543 AGGGTTGTAGTATTTGTGATTGG + Intergenic
1053661648 9:40287091-40287113 AGGGTTGGAAAACTACTTATTGG + Intronic
1053912018 9:42916441-42916463 AGGGTTGGAAAACTACTTATTGG + Intergenic
1054373769 9:64433324-64433346 AGGGTTGGAAAACTACTTATTGG + Intergenic
1054522960 9:66089193-66089215 AGGGTTGGAAAACTACTTATTGG - Intergenic
1057950502 9:99365867-99365889 AGGGGTGAATTATTCCTGACTGG + Intergenic
1059947139 9:119421115-119421137 AAGGATGGATTAATTCTGATGGG + Intergenic
1061436741 9:130568061-130568083 AGGGTTGGATTATTCATTCTGGG - Intergenic
1186562512 X:10627940-10627962 ATGGTTGTGTTATTTCTGATTGG + Intronic
1191737194 X:64399341-64399363 AGGGCTGTATTCTTACAGATGGG - Intergenic
1194143511 X:90234963-90234985 AGGGTTGGAATGTTTCTGGTTGG - Intergenic
1195907085 X:109854670-109854692 GGGGTTGGGTTAGTACTAATAGG + Intergenic
1196059702 X:111394734-111394756 AGGGAAGGATTATTACTAATGGG - Intronic
1199181309 X:144857069-144857091 AGGGTTGAATAATTACCTATTGG + Intergenic
1199342129 X:146693249-146693271 AGGGTTGGGTTAATACTTCTTGG + Intergenic
1200489264 Y:3804284-3804306 AGGGTTGGAATGTTTCTGGTTGG - Intergenic
1201516068 Y:14819621-14819643 AGAGGAGGCTTATTACTGATAGG + Intronic
1201611643 Y:15849377-15849399 ATGGTTAGATTATGACTCATTGG - Intergenic