ID: 1095367488

View in Genome Browser
Species Human (GRCh38)
Location 12:41425340-41425362
Sequence TGGAAGTATAGCCAAGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095367483_1095367488 9 Left 1095367483 12:41425308-41425330 CCTAGAAGCTGGGCATTATCTAG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1095367488 12:41425340-41425362 TGGAAGTATAGCCAAGGAGTAGG 0: 1
1: 0
2: 3
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095367488 Original CRISPR TGGAAGTATAGCCAAGGAGT AGG Intronic
901743164 1:11355649-11355671 TGGCAGCACTGCCAAGGAGTAGG - Intergenic
903709969 1:25316210-25316232 TGGAAGTATGTTCAAGGGGTAGG + Intronic
903717145 1:25376196-25376218 TGGAAGTATGTTCAAGGGGTAGG - Intronic
904377737 1:30092405-30092427 TGTAAGTCAAGCCAAGGAGCAGG + Intergenic
906317087 1:44793390-44793412 TGACAATATAGCCAGGGAGTGGG - Intergenic
906665078 1:47615746-47615768 GGGAATTATAGCCAAGGAGCAGG + Intergenic
909888537 1:80973448-80973470 TGCAAGTATATCCATGGTGTGGG - Intergenic
909938332 1:81580723-81580745 TGGAAGTCTTGACAATGAGTCGG + Intronic
910719681 1:90272387-90272409 GGGATTTATAGCCAAGGAGAAGG - Intergenic
913531613 1:119737772-119737794 TGGAAGCAAAGACAAGAAGTGGG - Intronic
916487010 1:165268941-165268963 TGGAACCAAAGCCAAGGAATAGG + Intronic
919196081 1:194287871-194287893 GGGAAGAATAGGCTAGGAGTTGG + Intergenic
921921208 1:220671931-220671953 TTGAAATATAGACAAGGTGTGGG + Intergenic
922014829 1:221634704-221634726 TGGATTTATAGCCAAGGAGAAGG + Intergenic
922313146 1:224415399-224415421 TGGAAGTATAACTAAGGATGAGG + Intronic
922697503 1:227738444-227738466 TGAACGTATAGGCAAGGACTGGG - Intronic
1064264344 10:13812805-13812827 TGGAAGTATAGACTATGAGGTGG - Intronic
1065424646 10:25586961-25586983 AGGTACTATAGCCAAGGAGCTGG + Intronic
1067342461 10:45416909-45416931 TGGAAGTATAGACAGAGAGATGG + Intronic
1068285188 10:54924256-54924278 TGGAAGGAGAGCCTAGGAGGAGG - Intronic
1068719179 10:60223300-60223322 GGAATTTATAGCCAAGGAGTAGG - Intronic
1071651152 10:87394249-87394271 GGGAATTATAGTCAAGGAGGAGG - Intergenic
1073630823 10:105147134-105147156 TGGAGGTATAACCAATGAGTGGG - Intronic
1074956163 10:118392335-118392357 AGGCAGTATAGCCAAGGAAATGG + Intergenic
1078020908 11:7655298-7655320 TGGAGGGACAGGCAAGGAGTGGG - Intronic
1078152701 11:8772855-8772877 TGTAAGCATACCCAAGGAGTTGG - Intronic
1079898286 11:26149397-26149419 TGGAAGTCTAGCCAACGCGTGGG - Intergenic
1082114154 11:48309601-48309623 TAGAAGTCTAGGCAAAGAGTGGG - Intergenic
1083505103 11:63149301-63149323 TGGAAGTACATTCAAGTAGTGGG - Intronic
1087403835 11:97703530-97703552 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1088502580 11:110497388-110497410 TGGAAGTAGAGCCAATTAGGGGG + Intergenic
1089773760 11:120821634-120821656 TGGAATTAGACCCAAGGAGCTGG + Intronic
1091890024 12:4046048-4046070 AGGGAACATAGCCAAGGAGTGGG - Intergenic
1094762932 12:33556314-33556336 GGAATGTATAGTCAAGGAGTAGG + Intergenic
1095367488 12:41425340-41425362 TGGAAGTATAGCCAAGGAGTAGG + Intronic
1096013474 12:48243963-48243985 TGGAAGGATGGCCCAGGAGGTGG + Intergenic
1096266947 12:50131176-50131198 TGGTAGTTGAGCCCAGGAGTGGG - Intronic
1097853153 12:64434100-64434122 TGGGAGGATAGCCCAGGAGGTGG - Intronic
1098834629 12:75407160-75407182 GGGATTTATAGCCATGGAGTAGG - Intronic
1099693503 12:85991566-85991588 GGGAAGGATAACCAAGGAGGGGG - Intronic
1100313023 12:93414784-93414806 TGGAGATAAAGCCAGGGAGTGGG - Intronic
1100380253 12:94055064-94055086 TGGAAGGATAGCCCAGGGTTTGG - Intergenic
1100380414 12:94056445-94056467 TGGAAGGATAGCCCAGGGTTTGG - Intergenic
1100799948 12:98220633-98220655 TGGAAGAACAGGCAAGGAGTTGG + Intergenic
1101153796 12:101908520-101908542 CGAATCTATAGCCAAGGAGTAGG + Intronic
1101644830 12:106621600-106621622 TGCATGTATAGCTTAGGAGTGGG + Intronic
1103329093 12:120141472-120141494 TGGAAGTAGACCAAAGGAGATGG + Intronic
1105770957 13:23611322-23611344 GGGATATATAGCCAAGGAGCAGG + Intronic
1105941355 13:25150792-25150814 TGGAAAGAGAGCCAGGGAGTGGG - Intergenic
1106032330 13:26014331-26014353 TGGTGCTATAGCCAAGGAGGTGG + Intronic
1106332709 13:28754220-28754242 GGAATGTATAGCCAAGGAGCAGG - Intergenic
1106467082 13:30023083-30023105 CGGATGCATAGCCAAGGAGCAGG - Intergenic
1107365321 13:39666556-39666578 TGGATGTAAAACTAAGGAGTTGG - Intronic
1107452063 13:40518694-40518716 TGGAAGTCTAGGCGAGGTGTGGG + Intergenic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1111427219 13:88102778-88102800 GGGATTTATAGCCAAGGAGAAGG + Intergenic
1115051297 14:29067006-29067028 AGGAAGCATAGTCATGGAGTAGG + Intergenic
1118065928 14:62190069-62190091 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1119765223 14:77183542-77183564 TGTGAGCATAGCCAGGGAGTGGG + Intronic
1121505979 14:94477006-94477028 TGGAAGGATATTCCAGGAGTAGG - Intronic
1121798542 14:96755007-96755029 TGGATGTGGAGCCAAGGATTGGG + Intergenic
1125882727 15:43208212-43208234 TGGAGGTAAAGCCTAGGGGTGGG - Exonic
1126992875 15:54403194-54403216 TGGCAGTATGACAAAGGAGTTGG - Intronic
1127086057 15:55425420-55425442 GGGGTTTATAGCCAAGGAGTAGG - Intronic
1129374954 15:75124091-75124113 TGGAAGTAATCCCAGGGAGTAGG + Intergenic
1129491018 15:75925810-75925832 GGGATTTATAGCCAAGGAGGAGG + Intronic
1130212488 15:81937861-81937883 GGGAATTGTAGCCCAGGAGTAGG + Intergenic
1130953677 15:88611960-88611982 TGGAAGGATAGCCAAAAAGGGGG - Intergenic
1135113238 16:19706989-19707011 TGGAAGTACAGCCGGGGAGCCGG - Exonic
1135782742 16:25319395-25319417 TGAAAGTATTGGCAAGGACTTGG + Intergenic
1136345271 16:29671479-29671501 TGGAAGAAGAGCCAGGGACTTGG - Intronic
1136597754 16:31263351-31263373 TGGAAGTAAAGGCTAGGACTGGG + Intronic
1136665540 16:31808665-31808687 AGAGAGTATAACCAAGGAGTTGG + Intergenic
1137505711 16:49052090-49052112 TGCAAGAATAGGCAAGGACTGGG + Intergenic
1139477115 16:67208305-67208327 TGCCAGTTTAGCCAAGGTGTGGG - Exonic
1153335322 18:3917977-3917999 AGGAGGGAGAGCCAAGGAGTGGG - Intronic
1153944007 18:10003055-10003077 GGAAGGTATAGCCAAGGAGCAGG - Intergenic
1155295523 18:24381187-24381209 TGGGATTATAGCCAAGGAGTAGG + Intronic
1155602180 18:27562367-27562389 GAGATTTATAGCCAAGGAGTAGG + Intergenic
1156526085 18:37768583-37768605 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1156652700 18:39243802-39243824 TGCAAGTATTGCCAGGGAGGTGG - Intergenic
1156713351 18:39975712-39975734 TGGAAGTTAGGCTAAGGAGTTGG - Intergenic
1158192377 18:54844894-54844916 TGGAGGTATAGGGAGGGAGTTGG + Intronic
1160110001 18:76017345-76017367 TGAAAGTATAGGCAAGGACTGGG - Intergenic
1162904111 19:13813283-13813305 TGGAAGAACAGCCAAGGACTGGG - Intronic
1163290560 19:16376773-16376795 CTGAAGTATAGCCAGGGCGTCGG + Intronic
925811181 2:7702437-7702459 TGGAATTCTAGGCCAGGAGTTGG + Intergenic
927248863 2:20980596-20980618 AGGCAGTATAGCCAAGGCCTTGG + Intergenic
927597607 2:24410404-24410426 GTGAAGTATAGCCATTGAGTAGG + Intergenic
929998478 2:46845163-46845185 TGGAAGTAAAAAGAAGGAGTGGG + Intronic
930444500 2:51452659-51452681 GGAATTTATAGCCAAGGAGTAGG - Intergenic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
935655106 2:105415324-105415346 TGGAAGGATGCACAAGGAGTTGG + Intronic
937249125 2:120512204-120512226 TGGCATTCTGGCCAAGGAGTTGG + Intergenic
937667140 2:124500402-124500424 GGGATTTATAGCCAAGGAGTAGG + Intronic
938652530 2:133398739-133398761 TGGGAGCATAGCCAAGCAGATGG + Intronic
941712593 2:168729683-168729705 TGGCAGTGTTGCCAAGGAGACGG + Intronic
941947361 2:171114458-171114480 TGGAAGAATGGTCAAGGAGATGG + Intronic
942304105 2:174589171-174589193 TGGAAAGACAGCCAAGAAGTGGG - Intronic
942413317 2:175733886-175733908 TGGAAGGATAGCCTAAGGGTGGG - Intergenic
942594614 2:177581069-177581091 TGGAAGCAAAGGCAAGGAGATGG + Intergenic
943002637 2:182348117-182348139 TGTGATTATAGCCAAGTAGTAGG - Intronic
944364538 2:198902124-198902146 TGGAAGTGTCCACAAGGAGTGGG + Intergenic
1169773475 20:9226562-9226584 TGGAAGTATTGACAGGGAGATGG + Intronic
1170080048 20:12464657-12464679 TGGGAAAATAGACAAGGAGTTGG - Intergenic
1170233986 20:14081281-14081303 GGGATTTATAGCCAAGGAGCAGG - Intronic
1170271803 20:14535547-14535569 TTGAAGTCTTGCCAAGGACTTGG + Intronic
1170789820 20:19498446-19498468 GGGAAGTAGAGACAAGGTGTGGG - Intronic
1171279582 20:23884413-23884435 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1171284662 20:23927013-23927035 AGGATATATAGCCAAGGAGCAGG - Intergenic
1172019805 20:31906098-31906120 TGGAACAATGGCCAAGCAGTTGG - Intronic
1174075700 20:47934472-47934494 TGGGTTTATAGCCAAGGAGCAGG + Intergenic
1174237506 20:49106161-49106183 TGCAACTATAGCCTAGGTGTTGG - Intergenic
1176011448 20:62898656-62898678 TGGCAGTGTTGCCAAGGAGGGGG - Intronic
1177162073 21:17558609-17558631 GGGAAGAATAGCTAAGGAATGGG + Intronic
1177202769 21:17976341-17976363 TGAATGTACAGACAAGGAGTGGG + Intronic
1177881143 21:26696482-26696504 TGGATGTCTGGCCAAGGATTTGG - Intergenic
1177885473 21:26741177-26741199 TGGATGTCTGGCCAAGGACTTGG - Intergenic
1177898605 21:26885331-26885353 GGGAACTCTAGCAAAGGAGTGGG + Intergenic
1180110695 21:45647658-45647680 TGGAAGCATAGTGAAGGAGTTGG + Intronic
1180324845 22:11361075-11361097 GGGAAGTAGAGAAAAGGAGTGGG - Intergenic
1181666319 22:24400571-24400593 TTGAAGTATAGACAAGGAGTGGG + Intronic
1182063465 22:27414281-27414303 GGTAAGTATAGGAAAGGAGTTGG + Intergenic
1184803380 22:46776104-46776126 TGGCAGTATAGGCAAGGAAAGGG + Intronic
950794772 3:15501851-15501873 GGGAATTATAGCCAAGAAGCAGG - Intronic
950983038 3:17329747-17329769 AGGAAGTAAAACCAAGGAGCTGG - Intronic
952449430 3:33417808-33417830 TGGGAGTATGGACAAGGTGTTGG - Intronic
954868049 3:53746363-53746385 TGGAAATATGGCCAAGATGTAGG - Intronic
957932076 3:86892910-86892932 TGGAAGTAAAGGCAAAGAGATGG + Intergenic
958665881 3:97138097-97138119 TGGACCCAAAGCCAAGGAGTAGG + Intronic
959770565 3:110090314-110090336 GGGATTTATAGCCAAGGAGCAGG + Intergenic
963337990 3:143999665-143999687 TGTAAGTAAATCTAAGGAGTAGG + Intronic
968257524 3:197290345-197290367 TGGAAATTTTGCTAAGGAGTAGG + Intronic
969241344 4:5900425-5900447 TGTAAGTCTAGCCAAAAAGTAGG + Intronic
970123083 4:12779227-12779249 TCGAACTATAGCCAAGGCCTTGG + Intergenic
970598521 4:17621862-17621884 AAGAAGTAAAGCCAAGGAGTGGG + Intronic
972228580 4:37043743-37043765 GGGATTTATAGCCAAGGAGCAGG + Intergenic
972875438 4:43352890-43352912 GGGATGCATAGCCAAGGAGCAGG - Intergenic
975049019 4:69836431-69836453 TGCAAGTGTAGTCAAGAAGTAGG + Intronic
975682645 4:76891924-76891946 TGGAAGAATATCCCAGGAGAGGG - Intergenic
975997048 4:80327864-80327886 TAGAAGTTTAGCCAAGGTGGTGG + Intronic
978036045 4:103996257-103996279 CAGGAGTATAGCCAGGGAGTTGG + Intergenic
980264509 4:130497743-130497765 TAGAAGTATTTCCAATGAGTGGG - Intergenic
981251841 4:142612172-142612194 TCTAGGAATAGCCAAGGAGTTGG + Intronic
985354446 4:189102763-189102785 TGGGAGGAGAGCCAAGGAGGGGG - Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
995516401 5:112958551-112958573 TGGAAGTACTGCCAAGCAGATGG + Intergenic
998896701 5:146807743-146807765 AGGAGGTTTAACCAAGGAGTTGG - Intronic
999175897 5:149631508-149631530 TGAAAGTAGAGACAAGGATTTGG - Intronic
1000758909 5:165196441-165196463 TGGAAGTGTGGGTAAGGAGTTGG + Intergenic
1003075770 6:2982668-2982690 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1003660862 6:8060381-8060403 TTTAAGTAGAGCCAAGGAGCTGG + Intronic
1003689375 6:8337501-8337523 TAGAAGAATGGCCAAGTAGTGGG - Intergenic
1004450757 6:15743530-15743552 GAGATTTATAGCCAAGGAGTTGG - Intergenic
1005815846 6:29552203-29552225 TGATAGTAAAGCCAAGGATTTGG + Intergenic
1006242070 6:32691371-32691393 GGGAAGTAGAGCCAAGATGTAGG + Intergenic
1007381276 6:41491782-41491804 TGAAAGTAGAGCCAACGAGATGG + Intergenic
1008806935 6:55441127-55441149 AGAATTTATAGCCAAGGAGTGGG + Intronic
1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG + Intergenic
1011008041 6:82670268-82670290 TAAAAGTATAACCAAAGAGTAGG + Intergenic
1011926304 6:92649636-92649658 GGGATGTATAGCAAAGGAATAGG - Intergenic
1013148166 6:107415674-107415696 TTGAAGTAGAGCTAAGGTGTAGG - Intronic
1013744555 6:113329983-113330005 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1015978829 6:138818691-138818713 TGGGCGGATAGCCAAGGAGCAGG + Intronic
1016850798 6:148616964-148616986 TGGAAGTAAAGCCAAGTTGTTGG - Intergenic
1017574133 6:155782610-155782632 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1019407721 7:892505-892527 TGCAAGTGTAGCCATGGTGTGGG + Intronic
1019873800 7:3791278-3791300 TGGAACTACAGCCAGTGAGTAGG + Intronic
1021212488 7:17871691-17871713 GGGATTTATAGCCAAGGAGCAGG - Intronic
1021852153 7:24818860-24818882 GGGAAGTATGGCCTAGGAGAAGG + Intronic
1022144123 7:27520213-27520235 GTGAAGAATGGCCAAGGAGTAGG + Intergenic
1023372667 7:39527641-39527663 TGGCAGTATAGTCAAGATGTTGG - Intergenic
1024213983 7:47231127-47231149 TGCCAGTACAGCCAAGGAGGAGG + Intergenic
1024812589 7:53230262-53230284 TGGATGTATTGCGAAGAAGTAGG + Intergenic
1027620992 7:80484843-80484865 AGGACCTATAGCCAAGGAGTAGG - Intronic
1030819803 7:114082672-114082694 AGGAAGTATAGCCAAGATGAAGG - Intergenic
1032264474 7:130361474-130361496 TGGGAGGATGGCTAAGGAGTTGG + Intronic
1034394033 7:150806411-150806433 TGGGGGTTTATCCAAGGAGTGGG - Intergenic
1036960968 8:13244147-13244169 AGGAAGTATAGCTAAACAGTAGG - Intronic
1039203095 8:35118409-35118431 TGGAAGTAGAGACAAGAAGTAGG + Intergenic
1041409533 8:57537819-57537841 TGGAAAAATTGCCAAAGAGTAGG + Intergenic
1042341548 8:67684961-67684983 GGAATGTATAGCCAAGGAGCAGG - Intronic
1045858235 8:106789150-106789172 TGGGACTATTGCCAAGGAATGGG + Intergenic
1047146601 8:122207228-122207250 TAGAATCAAAGCCAAGGAGTAGG + Intergenic
1047546862 8:125826569-125826591 TGGAAGTTTAGCCAGCCAGTTGG - Intergenic
1050030966 9:1384962-1384984 TTGAAGAAAAGCCAAGGAATTGG - Intergenic
1052419302 9:28221486-28221508 TGGAAGTAGAGGGAAGGTGTTGG + Intronic
1053097924 9:35345315-35345337 TGGGAATTTAGCCAAGGAGCAGG + Intronic
1055315590 9:75030297-75030319 TGGAAGAATGGGCAAGGAATTGG - Intergenic
1055953818 9:81755468-81755490 GGGACTTATAGCCAAGGAGCAGG - Intergenic
1056062295 9:82896305-82896327 TGCATCTATAGCAAAGGAGTGGG + Intergenic
1057630303 9:96714718-96714740 AGAATGTACAGCCAAGGAGTAGG + Intergenic
1058186400 9:101860545-101860567 TGGATTTATAGTTAAGGAGTAGG - Intergenic
1186719833 X:12291506-12291528 TGGAAGTATAGATAAGGAGATGG - Intronic
1186907029 X:14121907-14121929 TGCAAGTATACCCATGGAGGAGG + Intergenic
1188495696 X:30780845-30780867 GGAATGTATAGCCAAGGAGCAGG - Intergenic
1189526238 X:41824931-41824953 AGGAATTATTGCCAAGGGGTTGG - Intronic
1189595609 X:42562330-42562352 TAGAAGTAAAGCCATGGAATAGG + Intergenic
1189789126 X:44586627-44586649 TGGAAATCCAGCCAAGGAATTGG - Intergenic
1190182497 X:48205031-48205053 GGGATTTATAGTCAAGGAGTAGG + Intronic
1191730857 X:64334008-64334030 AGGAAGAAGAGCCAAGGGGTGGG - Intronic
1192360183 X:70434361-70434383 GGGAAGTAGAACTAAGGAGTCGG + Intergenic
1193122221 X:77835576-77835598 TGGGTGTATACCCAAGCAGTGGG - Intronic
1195203375 X:102571394-102571416 AGGAAGTAAAGAAAAGGAGTTGG - Intergenic
1195573055 X:106417912-106417934 TGGGCGTAAAGCCAAGGACTTGG + Intergenic
1197449034 X:126588323-126588345 TGAAATTATAGTCAAGGAGCAGG - Intergenic
1198112727 X:133515869-133515891 TTGCAGTTTAGCCAAGGAATAGG - Intergenic
1199706013 X:150426061-150426083 TGTCAGTATAGCCAAGGCTTTGG - Intronic
1200403585 Y:2785347-2785369 GGGATTTATAGCCAAGGAGCAGG + Intergenic