ID: 1095372389

View in Genome Browser
Species Human (GRCh38)
Location 12:41484702-41484724
Sequence TGTTAAGTTTACAGCAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095372389_1095372391 -10 Left 1095372389 12:41484702-41484724 CCAGATTTGCTGTAAACTTAACA 0: 1
1: 0
2: 2
3: 17
4: 209
Right 1095372391 12:41484715-41484737 AAACTTAACAGTGTATCTTTGGG 0: 1
1: 0
2: 1
3: 23
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095372389 Original CRISPR TGTTAAGTTTACAGCAAATC TGG (reversed) Intronic
901479187 1:9512642-9512664 TTTTAAGTTGCTAGCAAATCAGG + Intergenic
904571222 1:31467053-31467075 TTTTAAGTTTTTAGCCAATCAGG + Intergenic
906506696 1:46385321-46385343 TGTCAAGTTCACAGAAAAACTGG + Intergenic
912407361 1:109451825-109451847 TGTTAAGTTCACATCAAAATTGG - Intergenic
914786725 1:150839884-150839906 TGTGAAGTTTCCAGGAAATAGGG - Intronic
915665848 1:157444247-157444269 TGTTCAATTTACAGAAAAGCTGG + Intergenic
918035074 1:180862095-180862117 TGTTAAATTTTCAGAAACTCTGG - Intronic
918887688 1:190217592-190217614 TCTTAAGTTTACAGCAAAGTAGG + Intronic
918945754 1:191062328-191062350 TGTTAATCTTACTGCAAAACAGG - Intergenic
919867106 1:201790675-201790697 TCTTCCTTTTACAGCAAATCCGG + Exonic
919941165 1:202287322-202287344 TGTTAAGTTTAAAAGAACTCAGG - Intronic
920102208 1:203524166-203524188 TGGTAAGTTTACAGAGAAACAGG - Intergenic
921259816 1:213376129-213376151 TGTAAAGTTTCCAGAAAAGCTGG + Intergenic
922364423 1:224850818-224850840 TGTTAAGCTGAGAGCAAATCTGG + Intergenic
922516971 1:226214981-226215003 TGTTAAATTTACTCCAAATGAGG - Intergenic
922680877 1:227594458-227594480 TGTCCAGTTTACAGAAAAACTGG + Intronic
922690064 1:227681656-227681678 TGTCCAGTTTACAGAAAATCTGG - Intergenic
923247392 1:232145715-232145737 AGCAATGTTTACAGCAAATCAGG - Intergenic
924377193 1:243424234-243424256 TTTTAGGTTCACAGCAAAACTGG + Intronic
1062924126 10:1301798-1301820 TTTTAAGTTCAAAGCAAAACTGG + Intronic
1065338992 10:24685470-24685492 TGGGAAGTTAACAGCAAATCAGG - Intronic
1065930908 10:30478121-30478143 TGTCCAGTTTACAGAAAAACTGG - Intergenic
1068566116 10:58577363-58577385 TTTTAAATTTGTAGCAAATCTGG - Intronic
1068671885 10:59731532-59731554 TGTCCAGTTCACAGCAAAACTGG + Intronic
1068675893 10:59769085-59769107 TGTCCAGTTTACAGAAAAACTGG + Intergenic
1070473303 10:76806273-76806295 TGTTAATTTTTCAACAAAACAGG + Intergenic
1070938684 10:80323180-80323202 TGTTAAGCTTTCTGCAAATGAGG - Intergenic
1071911176 10:90235388-90235410 TATAAATTTTACAGCCAATCTGG + Intergenic
1072334661 10:94387220-94387242 TGTCCAGTTTACAGAAAAACTGG - Intergenic
1072536515 10:96368506-96368528 TGTAAAGTTTACATAAGATCTGG - Intronic
1074520355 10:114215351-114215373 TGTGAACATTACAGCATATCTGG + Intronic
1075048470 10:119164866-119164888 TGTTACCTTCACAGCACATCTGG - Intronic
1079794806 11:24788108-24788130 TGTTAAATTTACAGAATTTCAGG - Intronic
1083089798 11:60188111-60188133 TGTTCAGTTCACAGAAAAACTGG - Intergenic
1087684423 11:101247142-101247164 TGTCCAGTTTACAGAAAAACTGG - Intergenic
1088393451 11:109341510-109341532 TGTTAAATTTCCAGGAAATGGGG - Intergenic
1090728114 11:129545680-129545702 TGTTAAGTTCAAAGCAGCTCTGG - Intergenic
1092501022 12:9047826-9047848 TGTTAAGTATACAAAAACTCAGG - Intergenic
1093386586 12:18563291-18563313 TGTTTGGTTTACATAAAATCGGG + Intronic
1093424967 12:19018507-19018529 TGTCAAGTTAAAAACAAATCTGG + Intergenic
1095342552 12:41108643-41108665 TCTCAAGTTTGCAGCAATTCAGG - Intergenic
1095372389 12:41484702-41484724 TGTTAAGTTTACAGCAAATCTGG - Intronic
1095425434 12:42069870-42069892 TGTTAAGTTTCCATAAAATCAGG + Intergenic
1096207621 12:49736454-49736476 TGTCCAGTTTACAGAAAAACTGG - Intronic
1097276160 12:57814901-57814923 TGTTAAATATACTGCAAATCTGG + Intronic
1097793153 12:63835904-63835926 TTTTAAGTTTACAGAAAAATTGG - Intergenic
1097814149 12:64053556-64053578 TGTTAATTTCACAACAAATAAGG + Intronic
1098005092 12:65988155-65988177 TGTTCAATTTACAGAAAAACTGG + Intergenic
1098097645 12:66976187-66976209 GGTTAAGTTTTAAGGAAATCAGG - Intergenic
1098328643 12:69329399-69329421 TGTCTAGTTTACAGAAAAACTGG + Intergenic
1099250894 12:80252393-80252415 TGTAAAGTTTCCAGGAAATTTGG + Intronic
1100528672 12:95444073-95444095 TGTCTAGTTTACAGAAAAACTGG + Intergenic
1101383270 12:104232951-104232973 TTTTAAGTTTTTAGCCAATCAGG - Intronic
1105382192 13:19897841-19897863 TGTTAAGTTTACTTCATATAAGG - Intergenic
1105555179 13:21440926-21440948 TTTTAAGTTCACAGCAAAATTGG + Intronic
1107222224 13:37996652-37996674 TGCTAAGTATTCAGCAAAACAGG - Intergenic
1107619325 13:42209646-42209668 TTTTAGGTTTACAGAAAAACTGG + Intronic
1107858815 13:44641770-44641792 TGTTATGTTTAAAGCACTTCAGG - Intergenic
1107966131 13:45599826-45599848 TGTTAGGATTAAAGCAACTCTGG + Intronic
1109502240 13:63253056-63253078 TGATGTGTCTACAGCAAATCTGG - Intergenic
1110653803 13:77973473-77973495 TGTCCAGTTTACAGAAAAACTGG + Intergenic
1110662241 13:78070228-78070250 TGTTAGGGTTACAGCAAAATTGG - Intergenic
1111865209 13:93759642-93759664 TATTAGGTTCACATCAAATCAGG - Intronic
1112226393 13:97544840-97544862 TTTTAGGTTCACAGCAAAACTGG + Intergenic
1112527952 13:100170367-100170389 GTTTAAGTTTAGAACAAATCTGG - Intronic
1114190871 14:20438500-20438522 TATTGAGCATACAGCAAATCTGG - Intergenic
1114212708 14:20628937-20628959 TTTTAAGTTTACAGCAAAATTGG + Intergenic
1116789336 14:49323490-49323512 TGACAAGTTTACAACAAAGCAGG - Intergenic
1117023131 14:51592736-51592758 TCTTTAGATTACAGCAAATAGGG + Intronic
1117450364 14:55844222-55844244 TGTTCAGTTTATAACAAACCGGG + Intergenic
1117725248 14:58666875-58666897 TGTTGAGTTTAAAGCAATTAAGG - Intergenic
1119539674 14:75429575-75429597 TTTTACCTTTCCAGCAAATCTGG + Intronic
1120022486 14:79546303-79546325 TGTTATGTTTACATAAAATAAGG + Intronic
1121223240 14:92302115-92302137 TGTGAAGTTTATAGCCAAGCAGG - Intergenic
1124656145 15:31509193-31509215 TGTTTAGTTTACAGAAAAATTGG + Intronic
1125270258 15:37930937-37930959 TATTAAGTTGATAGCAATTCTGG - Intronic
1125327111 15:38547346-38547368 TGTTAAGTTTGCAGCACATTTGG - Intronic
1127711159 15:61599572-61599594 TGTTCAGGTTACAGCCATTCAGG + Intergenic
1131567419 15:93499013-93499035 TGTAAATTTCACAGCAAATTTGG - Intergenic
1137062426 16:35803361-35803383 TGTCTAGTTTACAGAAAAACTGG - Intergenic
1138465184 16:57185315-57185337 TCTTAAGTTTTCTGCAAAACGGG + Intronic
1139143332 16:64294728-64294750 TGTCAAATTTACAGCACATATGG - Intergenic
1141347783 16:83263347-83263369 TGTTTTGTTTTCAGAAAATCAGG + Intronic
1146352644 17:32108540-32108562 GGTGAAATTTACAGCAAACCTGG + Intergenic
1148286904 17:46401870-46401892 TGTTAATTTTACTGAAAATACGG + Intergenic
1148309073 17:46619460-46619482 TGTTAATTTTACTGAAAATACGG + Intronic
1148582066 17:48751155-48751177 TGTTCAGTTTACACTAACTCAGG - Intergenic
1149670242 17:58401668-58401690 TTTTAAGCTTACATCAACTCAGG + Intronic
1153586932 18:6631633-6631655 TTTAAAGTTTTCAACAAATCTGG + Intergenic
1154014241 18:10602468-10602490 TGTCCAGTTTACAGCAAAACTGG + Intergenic
1154307093 18:13238657-13238679 TGTGAGGTTTGCACCAAATCTGG + Intronic
1155397295 18:25400226-25400248 TTTTTTGTTTACAGCAAATCTGG - Intergenic
1155746289 18:29359624-29359646 TGTTCAGTTCACAGAAAAACTGG + Intergenic
1155776734 18:29773063-29773085 TATTAATGTTACAGGAAATCAGG + Intergenic
1158686946 18:59623159-59623181 TTTTAGATTTACAGCAAAACTGG - Intronic
1159907802 18:74113563-74113585 TTTTAGGTTCACAGCAAAACTGG - Intronic
1160402493 18:78621154-78621176 TGTTGAGTTCAGAGTAAATCAGG - Intergenic
1162008600 19:7796725-7796747 TGTTTAGTTTATAGAAAAACTGG + Intergenic
1162806896 19:13142088-13142110 TGTCAATTTTACAGCAACACTGG + Intergenic
1167825136 19:51965969-51965991 TGTTGAGTTTACTGGAAATGGGG - Exonic
1168627529 19:57931069-57931091 TGTTAAGAGTACAGCATAGCCGG - Intronic
925079218 2:1049016-1049038 TTTTAGGTTTACAGCAAAATGGG + Intronic
925532339 2:4877767-4877789 TGTTAAGGCTGCAGCAAATGTGG + Intergenic
927356180 2:22176161-22176183 TGTAAAGTTTACTGCAAATCTGG + Intergenic
927662981 2:25008589-25008611 AGTTAAGGTTACAGCAAACCAGG - Intergenic
929208963 2:39332084-39332106 AGTTAATTTTACAGCAATACGGG + Intronic
933007891 2:77019067-77019089 TGTGAAGTGTACAGCAGATTGGG - Intronic
933318939 2:80747565-80747587 TGTTTAGTTTAGAGCAAATAAGG - Intergenic
933471463 2:82730935-82730957 TGTTAATTTTCCCACAAATCTGG + Intergenic
936002313 2:108845500-108845522 TTTTAAGTTTTTACCAAATCTGG + Intronic
938420640 2:131143501-131143523 TGTTAATATTACATTAAATCTGG + Intronic
939063268 2:137450063-137450085 TGTTGAATTTTCAGTAAATCGGG + Intronic
939812245 2:146848551-146848573 TGTTAATTTTTCAGCAAAAAAGG - Intergenic
940881234 2:158948881-158948903 TGTTCACTTTAAACCAAATCTGG - Intergenic
942488229 2:176461929-176461951 TGTTAAGATTACAGCCTTTCTGG - Intergenic
943408006 2:187513216-187513238 TGTTTAGTTCACAGAAAAACTGG - Intronic
943666211 2:190611537-190611559 TGTTCAATTTACAGAAAAACTGG + Intergenic
944166855 2:196732026-196732048 TGTTCAGATAACAGCTAATCTGG + Exonic
945360664 2:208892508-208892530 TGTTAATTTTTCACAAAATCAGG + Intergenic
946496969 2:220204680-220204702 TGTTAAGAGTACAGGGAATCAGG + Intergenic
947092813 2:226531757-226531779 TGTTAAGATTAAAGAACATCAGG + Intergenic
947114408 2:226753280-226753302 TTATAAGTTTAAAGCAAAACAGG - Intronic
948018871 2:234713907-234713929 TATTAAGTTTACAGCATAGTGGG - Intergenic
948527751 2:238582673-238582695 TGATAAGTTTTCAGCTCATCTGG + Intergenic
1169688200 20:8300780-8300802 TGTTAAGTGTTCAGTAAATGTGG + Intronic
1172745051 20:37200578-37200600 CTTTAAGTTTACAGAAAATCTGG - Intronic
1172822501 20:37750093-37750115 TCTTAAGGTTACAACAAACCAGG - Intronic
1172946153 20:38691083-38691105 TGAAAAGTTGACAGCAAAGCTGG + Intergenic
1174177347 20:48653340-48653362 TGGTAAGTTTACTGGAAACCGGG - Exonic
1175707548 20:61191880-61191902 TGTCCAGTTTACAGAAAAACTGG + Intergenic
1176914843 21:14612311-14612333 TTTTTACTTTACAGCAAATAGGG - Intronic
1178797915 21:35762614-35762636 TGTTAATTTCACAGAAAATGTGG - Intronic
1179094683 21:38302270-38302292 GGTATAGATTACAGCAAATCTGG + Exonic
1180110622 21:45647192-45647214 GGTTAAGTGTACAACAAATGGGG - Intronic
1181668554 22:24414707-24414729 TGTAAAGCTTCCAGCAACTCTGG + Exonic
1182464848 22:30508320-30508342 TTTTAAGTTCACATCAAAACTGG + Intergenic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
950594487 3:13966917-13966939 TGTCCAATTTACAGCAAAACTGG + Intronic
951854440 3:27179627-27179649 TGTTAAGAATACAGAAGATCTGG + Intronic
956004122 3:64760899-64760921 TGTTGAATTTCCAGCAAACCTGG - Intergenic
957327143 3:78710939-78710961 TGTTAAGTATACAGATTATCAGG - Intronic
957804272 3:85126598-85126620 TGTTAAGTTTTAACCATATCTGG + Intronic
958000012 3:87738635-87738657 TGTCCAGTTTACAGAAAAACTGG + Intergenic
960099423 3:113724606-113724628 TGTTTCGTTTCCAGCAACTCTGG - Intronic
963812764 3:149795675-149795697 TGTTAGGTTCACAGCAAAATTGG + Intronic
964045893 3:152326253-152326275 TTTTCAGTTTACAGAAAATAAGG - Intronic
970556353 4:17237005-17237027 TTTTAAGATTACTGCAGATCTGG - Intergenic
970560008 4:17273421-17273443 TTTTAAGATAAGAGCAAATCAGG + Intergenic
972154894 4:36147714-36147736 TGTTAAGTTTTCAGCAAATAAGG + Exonic
972991424 4:44825962-44825984 TGTTCAGTTCACAGAAAAACTGG + Intergenic
977059311 4:92237586-92237608 TGTGAAGTTTACAGAGATTCAGG + Intergenic
977530371 4:98193807-98193829 TTTTAAGTTTTTAGCTAATCGGG - Intergenic
978362076 4:107941389-107941411 TGTTAAGGGTACAGAAAATTTGG + Intronic
978367516 4:107997785-107997807 TGTTATTTTTACAACAAATGAGG - Intronic
980633192 4:135465111-135465133 TGTTTAATGTACAGCAGATCAGG + Intergenic
980838037 4:138221514-138221536 TGTTAAATTTACATTAAATGCGG + Intronic
981980237 4:150783029-150783051 TGTTAAGTATAAAGCCTATCAGG + Intronic
984049684 4:174849031-174849053 TTTTAAGTTCACAGCAAAATTGG + Intronic
984259439 4:177427175-177427197 TTTTAAGTTCACAGCAAAATTGG + Intergenic
984606514 4:181791358-181791380 TGTTATGATTAAAGCAAAGCAGG - Intergenic
987273216 5:16335057-16335079 TTTTAAGTTTACAGAAAAATTGG - Intergenic
988212248 5:28218860-28218882 TGTTAAATTTACAGTAAATATGG + Intergenic
989397485 5:40973610-40973632 TGATAACTTAACAGCACATCAGG - Intronic
992326644 5:75666364-75666386 TATTAAGGATACAGCCAATCTGG + Intronic
996755418 5:126930136-126930158 TCTTAAGTATACAGAAGATCTGG + Intronic
997186100 5:131883906-131883928 TGTCAAGTGGAAAGCAAATCTGG + Intronic
997912251 5:137887568-137887590 TGTGAAGCCTACAGGAAATCTGG + Exonic
998574097 5:143294425-143294447 TTTTAAGTTCACAGCAAAATTGG + Intronic
1000712140 5:164593681-164593703 TCCTAAGTTTAGAGCAACTCTGG + Intergenic
1003414241 6:5893829-5893851 TTTTAGGTTTACAGCAAAATTGG + Intergenic
1004170556 6:13292650-13292672 AGTTAACTTTAAAGCAAGTCCGG + Intronic
1008370582 6:50725830-50725852 TGTAGAGTTTACAGCAACTTGGG - Intronic
1009268197 6:61583608-61583630 TTGTAGGTTTATAGCAAATCTGG + Intergenic
1010326223 6:74565702-74565724 TTTTATATTTACAGCAAATTTGG + Intergenic
1010448916 6:75980233-75980255 AGTTTAATTTACAGTAAATCAGG - Intronic
1011656743 6:89558859-89558881 TTTTAAGTTTACAGAAAAATTGG - Intronic
1012247090 6:96938192-96938214 TGGTAAATATACAGCAAATTTGG - Intronic
1012471246 6:99574996-99575018 TTTTAAATTTAGAACAAATCTGG + Intergenic
1012707682 6:102552811-102552833 TTTTATGTTTTCAGCAAATTGGG + Intergenic
1013502833 6:110769649-110769671 TTTTAGGTTTACAGAAAACCTGG - Intronic
1013573703 6:111456789-111456811 TATTAAATTTACATCAATTCAGG - Intronic
1015171834 6:130262881-130262903 TGTCCAGTTTACAGAAAAACTGG - Intronic
1015496332 6:133887805-133887827 TGTTTAGTTTACAGCATAGGGGG + Intergenic
1015579068 6:134703816-134703838 TGTTCACTTTATAGCAAATTGGG + Intergenic
1017297100 6:152810847-152810869 TTTTAGGTTTACAGCAAAATTGG + Intergenic
1018281869 6:162195095-162195117 TGTTAAATCTACAGCGAAGCTGG - Intronic
1020494644 7:8834128-8834150 TCTTAAGTTGAAAGCCAATCTGG - Intergenic
1023436442 7:40145055-40145077 TGTCCAGTTTACAGAAAAGCTGG + Intronic
1024607659 7:51035733-51035755 TGTAAAATATACATCAAATCTGG - Intronic
1024725039 7:52184336-52184358 TTTTAAGTTTTTAGCCAATCGGG + Intergenic
1024854747 7:53765047-53765069 TTTTAGGTTCACAGCAAAACTGG + Intergenic
1025725755 7:64057961-64057983 TGTTAATTTTCCAACAAAGCTGG + Intronic
1028320392 7:89452314-89452336 TGTTAAGTTTACAGTTTCTCAGG - Intergenic
1030273622 7:107696056-107696078 TGTTCTGTTTATAGGAAATCTGG - Intronic
1031522930 7:122788494-122788516 TGGTAAGTTTAAGGCAAAGCAGG - Intronic
1031686562 7:124737215-124737237 TTTTAAGTTCACAGCAAATTTGG + Intergenic
1034210079 7:149355848-149355870 TGTTGAGTTGGCAGCAAGTCAGG - Intergenic
1034698789 7:153078486-153078508 TGTTTGGTTTATAGCAAATAAGG + Intergenic
1039876869 8:41594186-41594208 TGTTCAGTTTACAGAAAAACTGG + Intronic
1040370362 8:46764861-46764883 TGTGAAGCTGACAGCAAAGCAGG - Intergenic
1041224449 8:55684883-55684905 TGTTAAATTAATAGCAGATCTGG + Intergenic
1042660703 8:71151341-71151363 TTTTAGGTTCACAGCAAATAAGG + Intergenic
1042828767 8:73004746-73004768 TTTTGAGTTTAAAGCAAAGCAGG - Intergenic
1043322802 8:79010827-79010849 TGTTGACATTACAGTAAATCTGG - Intergenic
1050824163 9:9923181-9923203 TGTTAACTCTACAGATAATCTGG + Intronic
1051469062 9:17414398-17414420 TGTTAATTTGATACCAAATCTGG + Intronic
1051989033 9:23129038-23129060 TGTTAATTTTTTAGGAAATCTGG + Intergenic
1053573328 9:39332375-39332397 TTATAACTTCACAGCAAATCTGG + Intergenic
1053892479 9:42707705-42707727 TTATAACTTCACAGCAAATCTGG + Intergenic
1054094894 9:60891081-60891103 TTATAACTTCACAGCAAATCTGG + Intergenic
1054116364 9:61166985-61167007 TTATAACTTCACAGCAAATCTGG + Intergenic
1054123816 9:61286636-61286658 TTATAACTTCACAGCAAATCTGG - Intergenic
1054591394 9:67015559-67015581 TTATAACTTCACAGCAAATCTGG - Intergenic
1055288965 9:74762541-74762563 TGTTCAGTTGCCAGCACATCTGG + Exonic
1059643606 9:116241774-116241796 TGGAAAGTTTACCCCAAATCAGG + Intronic
1061763429 9:132866415-132866437 TGTTAAATTTGCATAAAATCTGG + Intronic
1062002030 9:134221009-134221031 GTTTAGGTTTACAGCAAAACTGG - Intergenic
1186083891 X:5965074-5965096 TGCTAAGTTTAAAGAAAAGCTGG + Intronic
1188192618 X:27191155-27191177 TCTTTATTTTACAGCAATTCTGG + Intergenic
1188195939 X:27233742-27233764 TCTGAAGTTTACAGGAAATATGG + Intergenic
1192438694 X:71158849-71158871 TGTGAAGTAATCAGCAAATCAGG - Intronic
1194204990 X:91002100-91002122 GGTTAATTTTACAGGATATCTGG + Intergenic
1194896555 X:99448429-99448451 TTTTAGGTTCACAGCAAAACTGG - Intergenic
1196874479 X:120145135-120145157 TGTTCAGTTCACAGCAAAACTGG - Intergenic
1199141618 X:144320317-144320339 TGTCAAGGCTACAGTAAATCAGG + Intergenic
1200550814 Y:4577243-4577265 GGTTAATTTTACAGGATATCTGG + Intergenic
1201308817 Y:12575838-12575860 TGTTCAGTTGACAGAAAAGCTGG - Intergenic
1201863850 Y:18628646-18628668 TCTTAAGTTTACAGCAACCAAGG - Intergenic
1201869472 Y:18691732-18691754 TCTTAAGTTTACAGCAACCAAGG + Intergenic