ID: 1095373303

View in Genome Browser
Species Human (GRCh38)
Location 12:41495945-41495967
Sequence CAGCTCTGCAAGAGCACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095373303_1095373307 11 Left 1095373303 12:41495945-41495967 CCCTTTGTGCTCTTGCAGAGCTG 0: 1
1: 0
2: 3
3: 16
4: 228
Right 1095373307 12:41495979-41496001 CTTTCAGCTTTTTATGAGTTTGG 0: 1
1: 0
2: 1
3: 29
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095373303 Original CRISPR CAGCTCTGCAAGAGCACAAA GGG (reversed) Intronic
900972901 1:6001249-6001271 CAGGGCTCCAAGAGCACCAAGGG - Intronic
903319136 1:22531536-22531558 CAGTTCTGGAGGAGCACAGATGG + Intergenic
909128507 1:71706652-71706674 CAGCTCAGCAACAGCAGAATAGG + Intronic
909235017 1:73141761-73141783 AAAGTCTGAAAGAGCACAAATGG - Intergenic
909926730 1:81446373-81446395 CAGTTCTTCCAGATCACAAACGG + Intronic
910142032 1:84036879-84036901 AAAGTCTGAAAGAGCACAAATGG - Intergenic
912626964 1:111213309-111213331 ATTCTCTGCAGGAGCACAAAGGG - Intronic
913180781 1:116319115-116319137 CAGCCATTCCAGAGCACAAATGG + Intergenic
914213514 1:145603590-145603612 CTGCTCTGCCTGAGCACAGACGG + Intergenic
915146017 1:153796166-153796188 CAGCTCTGCAGGTGCCCAAGTGG + Intergenic
920126829 1:203700191-203700213 CAGATCACCTAGAGCACAAAGGG - Exonic
921992124 1:221378322-221378344 CAGTTCTGCAAAAGCACCATGGG - Intergenic
922570205 1:226630103-226630125 CAGGTTTGCAAGGACACAAACGG + Intergenic
922988965 1:229888791-229888813 CAGCTCTGGGAGAGCCCAGAGGG + Intergenic
924428664 1:243977665-243977687 CAGCAGTGAAAGAGCATAAAAGG + Intergenic
924490861 1:244536099-244536121 CAGCTCAGCCACAGCAGAAAGGG - Intronic
1062913282 10:1228403-1228425 CAGTTCTGAAAGAGCCCAGATGG - Intronic
1064851472 10:19713892-19713914 ATGCTCTGCAAGAGCAATAAAGG - Intronic
1068191792 10:53661480-53661502 TGGGTATGCAAGAGCACAAAAGG + Intergenic
1069623739 10:69853945-69853967 CAGCTCTGTAAGAACATTAAAGG - Intronic
1069841283 10:71340972-71340994 CAGCTTTGCAGCAGCACACACGG + Intronic
1070588184 10:77781791-77781813 CAGCTCTTCACCAGCACCAACGG - Intergenic
1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG + Intergenic
1074401259 10:113142656-113142678 CAGTCCTGCACCAGCACAAAGGG - Intronic
1074713560 10:116198053-116198075 CTCCTCTGCAAGAGCTAAAAGGG + Intronic
1075086701 10:119418623-119418645 CAGCTGTGCAAGGCCACAAGGGG + Intronic
1075638400 10:124046402-124046424 CAGCTCCGAAAGAAAACAAAAGG + Exonic
1075861912 10:125684260-125684282 CAGCTCTGCAACACCAAAAGAGG - Intergenic
1075904866 10:126072335-126072357 CAGCCCTTCTAGAGCACAGAAGG - Intronic
1077026001 11:440242-440264 CAGCTTTGCAGAAGCATAAAGGG + Intronic
1077596247 11:3534262-3534284 CAGCTCTGCATGAGAAGAAGGGG - Intergenic
1077912601 11:6586620-6586642 CAGCTGTGCAACAGCACCAGGGG - Intronic
1081873791 11:46395551-46395573 CAACTCTTCAAGAGCTCTAATGG - Intergenic
1083875844 11:65524291-65524313 CAGGTCTGGAAGAGGCCAAAGGG - Intergenic
1084252153 11:67908241-67908263 CAGCTCTGCATGAGAAGAAGGGG - Intergenic
1084820693 11:71687793-71687815 CAGCTCTGCATGAGAAGAAGGGG + Intergenic
1085708667 11:78809753-78809775 AAGCTCTGCAAGGGGAAAAAAGG - Intronic
1088979136 11:114845931-114845953 CAGCTTTGCAAAAGCACAGATGG + Intergenic
1089600902 11:119614288-119614310 CAGCCATGCAAGGGCACAGATGG - Intergenic
1089689593 11:120179062-120179084 GAGCTCTGCAAGAGAACAAAAGG + Intronic
1091058438 11:132440173-132440195 CAGTTATGCAACAGCAGAAATGG + Intronic
1091640357 12:2231553-2231575 GAGCTATCCAAGATCACAAATGG + Intronic
1091973478 12:4807763-4807785 CAGCTGTGCAAGCACAGAAAGGG + Intronic
1092422419 12:8343034-8343056 CAGCTCTGCATGAGAAGAAGGGG - Intergenic
1093125509 12:15323038-15323060 CAGCGATAAAAGAGCACAAAGGG - Intronic
1093227601 12:16504286-16504308 CAGCTCTTGAAAATCACAAAAGG + Intronic
1095373303 12:41495945-41495967 CAGCTCTGCAAGAGCACAAAGGG - Intronic
1097187958 12:57205593-57205615 CAGCTCTGCAACAACACCAAGGG + Exonic
1099036162 12:77589870-77589892 CAGCTAGGGAAGAGCAGAAATGG - Intergenic
1100351192 12:93784592-93784614 CAGCTCTGACACAGAACAAAGGG - Intronic
1100484964 12:95016377-95016399 CAGCATTGTAAGAGCAAAAAAGG - Intergenic
1104062303 12:125278958-125278980 CACCTCTGCTCCAGCACAAATGG + Intronic
1107752136 13:43579391-43579413 TAGCACTGCAAGAGTAGAAAGGG - Intronic
1108688431 13:52841033-52841055 CAGCTATGCAATAACTCAAAAGG - Intergenic
1109236797 13:59831589-59831611 CAGCTCAGTAAGAGGTCAAATGG + Intronic
1109386005 13:61629542-61629564 CCACTGTGCCAGAGCACAAAGGG + Intergenic
1109506789 13:63312188-63312210 CAGCTCAGCAGCAGCACAATAGG + Intergenic
1109924716 13:69121213-69121235 AAAGTCTGAAAGAGCACAAATGG + Intergenic
1112327742 13:98454461-98454483 CATCTCTCCCAGAGAACAAATGG + Intronic
1112891541 13:104239445-104239467 CAGGAAAGCAAGAGCACAAATGG - Intergenic
1114486029 14:23062219-23062241 CAGCTCTGCACGGGGTCAAATGG - Exonic
1114995643 14:28348709-28348731 CAGCTGTTAAAGAGTACAAAGGG - Intergenic
1116497085 14:45574291-45574313 AAGATCTGCAACAGCAAAAAAGG + Intergenic
1117317596 14:54588483-54588505 AAAGTCTGAAAGAGCACAAATGG - Intronic
1117372567 14:55092166-55092188 CAGCTATTCAAGAGCACAGGAGG - Intergenic
1117555673 14:56880636-56880658 CAGTTCTGAAAGACTACAAATGG - Intergenic
1118065128 14:62182403-62182425 CAGCAATGCAGGGGCACAAAAGG - Intergenic
1118657201 14:67965386-67965408 CAGCTCTCCAAGAACTGAAATGG - Intronic
1119634527 14:76263217-76263239 CAGCTCTCCCAGAACTCAAATGG - Intergenic
1121714098 14:96060360-96060382 CATCTCTGCAACAGTAAAAATGG + Intronic
1122183218 14:99971010-99971032 CAGCTCAACAAGAGCCCACACGG - Intergenic
1125252166 15:37717542-37717564 GAGCTCTCCAAGACCACATAGGG + Intergenic
1125584197 15:40808752-40808774 CATCTCTGCAAGAGCAGAGGAGG + Intronic
1126709491 15:51441460-51441482 CAGCCCAGCAAGAGCACAATAGG - Intergenic
1126844212 15:52744125-52744147 CATCTATGCAGGAGCTCAAATGG - Intergenic
1128369283 15:67028182-67028204 CAGCTATGCTAGGACACAAATGG - Intergenic
1129301611 15:74628814-74628836 CAGGTCTGCAGGGGCACACAGGG - Intronic
1129459378 15:75692817-75692839 CAGGGCTGTCAGAGCACAAAGGG + Intronic
1129927638 15:79379950-79379972 CAAATCTGAAAGATCACAAAAGG + Intronic
1132495583 16:261744-261766 CAACACTGCAACAGCACAAATGG - Intronic
1133187483 16:4110293-4110315 CAGCTCTGCAGGAGCAGTCATGG - Intronic
1133375860 16:5286565-5286587 CAGCTCTGCATGAGAAGAAGGGG + Intergenic
1135617593 16:23925346-23925368 CAGGTCTGAAAGAGCCCCAATGG - Intronic
1138826435 16:60326217-60326239 CAACAGTGCAAAAGCACAAATGG + Intergenic
1139852160 16:69957813-69957835 CAGCTTGGAAATAGCACAAATGG - Intronic
1139881131 16:70180717-70180739 CAGCTTGGAAATAGCACAAATGG - Intronic
1140371374 16:74414801-74414823 CAGCTTGGAAATAGCACAAATGG + Intronic
1140834453 16:78780397-78780419 CAGCTCTGCAAGACATCCAAAGG - Intronic
1141338208 16:83177366-83177388 CAGGTCTGCTACAGCACAAAGGG + Intronic
1142236512 16:88925038-88925060 CAGCTCTGCACCAGCCCAAGGGG + Intronic
1144125331 17:12197635-12197657 CTGCTCTGCAAGAGCAGTGAAGG + Intergenic
1146534304 17:33636919-33636941 CAGCTTTGAAAGAGAAAAAAGGG + Intronic
1146908764 17:36634434-36634456 CAGCTCTGCACCAGCACAGGGGG - Intergenic
1149160539 17:53687336-53687358 CAGGTCTGCAACAGCAGGAATGG + Intergenic
1153425336 18:4956757-4956779 AAACTCTGAAAGAGCACAAATGG + Intergenic
1155398716 18:25415428-25415450 TAGCCCTGCAAGAGCAAATAGGG - Intergenic
1156608419 18:38696845-38696867 CAACACTGCTAGAGCAGAAATGG + Intergenic
1160057742 18:75500984-75501006 CATATATGCAAGAGCACTAATGG + Intergenic
1161516420 19:4699225-4699247 CATTTTTGCAAGAGCACACAAGG + Intronic
1161947094 19:7444186-7444208 CAGCTCTGCAGGGACACAGACGG - Exonic
1162319539 19:9963017-9963039 GAGCTCTGCCAGTGCACAATGGG + Intronic
1165100031 19:33433740-33433762 TAATTCTGCAAGTGCACAAATGG + Intronic
1166318553 19:42002641-42002663 CAGGGGTGCAAGAGCACGAATGG + Intronic
926567101 2:14488192-14488214 CAGCTCTGCTACAACACAATGGG + Intergenic
927105926 2:19825415-19825437 CTGCTCTGCAAGAGCAGTCATGG + Intergenic
927355494 2:22168181-22168203 AAGGTCTGAAAGAGCACAAACGG + Intergenic
929675969 2:43930067-43930089 CAGATCTGGAAAAGAACAAAAGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932097196 2:68861543-68861565 CAGTTCTGCAAGCTCACATATGG - Intergenic
934302413 2:91786248-91786270 CTGCTCTGCAAGAGAAGAGAAGG + Intergenic
938175343 2:129121446-129121468 GAAGTCTGAAAGAGCACAAACGG - Intergenic
939639947 2:144628111-144628133 CATCTCTGCAAGTTCCCAAAGGG - Intergenic
940856057 2:158729569-158729591 CAGCTTTGCAGGAGCAGAAAGGG + Intergenic
941655058 2:168134398-168134420 CAGCTCTGCTTGAGGTCAAAGGG - Intronic
942285777 2:174414365-174414387 CATCTCTGGAAGAACACATAAGG - Intronic
942750020 2:179276763-179276785 CAGCTCAGCCAGAGCAGAATAGG + Intergenic
943570631 2:189569552-189569574 TAACTCTGCAATAGCAGAAATGG + Intronic
944537391 2:200724687-200724709 AAGCTCTGTATGAGAACAAAAGG - Intergenic
946696038 2:222360220-222360242 CAGCTGTGCAAGAGAGCAAACGG - Intergenic
947457332 2:230266936-230266958 CAGCTCTGCCATATCACATAAGG + Intronic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
1170109407 20:12788787-12788809 CTGCTCTGCAAGAGAACATGGGG + Intergenic
1173311470 20:41899898-41899920 CATCCCTGCAAGAGAGCAAAGGG - Intergenic
1174209531 20:48866554-48866576 CAGCTCAGCCAGAGGATAAATGG + Intergenic
1174493160 20:50918091-50918113 CAGTTCTGCAAGATTAAAAAAGG + Intronic
1174520082 20:51122629-51122651 GAGGTCTGCAAGAGCCCAGAAGG + Intergenic
1175169935 20:57073125-57073147 CAGACCTGGAAGAGGACAAACGG + Intergenic
1176906339 21:14506116-14506138 AAGGTCTGAAAGAGCCCAAATGG + Intronic
1177960554 21:27660910-27660932 CAGCTCTGCCAAAGCACAGGAGG - Intergenic
1179287554 21:39991152-39991174 CAGCTTAGCAAGAGCACCAAAGG - Intergenic
1179993450 21:44960423-44960445 CAGCTCTGCAGGTGCCCACACGG - Intronic
1182752768 22:32654926-32654948 CAGCTCTTCTAGAGCAGGAAAGG + Intronic
1182891889 22:33826087-33826109 CACGTCTGCTATAGCACAAACGG + Intronic
1184356404 22:43983126-43983148 CAGGTCTGCAACAGCACAAAGGG - Intronic
1184762951 22:46555417-46555439 CAGCGCTGCAGGAGAGCAAATGG - Intergenic
952357351 3:32596904-32596926 CCTCTCTGAGAGAGCACAAATGG + Intergenic
952915004 3:38230409-38230431 CATTTCTGAAAGAGCAAAAAAGG + Exonic
954298549 3:49687172-49687194 CAGCTCTGGAAGCGCACAGCAGG + Exonic
955455649 3:59118513-59118535 CAGCACTCCAAGAGCTTAAAGGG + Intergenic
956511082 3:69994095-69994117 CAGCCCTGGAATAGCAAAAATGG - Intergenic
957066213 3:75524627-75524649 CAGCTCTGCATGAGAAGAAGGGG - Intergenic
957425832 3:80037699-80037721 TAGCTCTCCATGACCACAAACGG + Intergenic
958974641 3:100653839-100653861 CAGAACTCCAGGAGCACAAAAGG + Intronic
960929078 3:122825931-122825953 AAGGTCAGCAAGAGAACAAATGG + Intronic
961286928 3:125813412-125813434 CAGCTCTGCATGAGAAGAAGGGG + Intergenic
962983772 3:140515466-140515488 TAAGTCTGAAAGAGCACAAATGG - Intronic
965015518 3:163152394-163152416 AAAGTCTGAAAGAGCACAAATGG - Intergenic
965716851 3:171614026-171614048 CAGCCCTACCAGAGCTCAAATGG + Intronic
966252973 3:177887579-177887601 CAGGGCTGCAAGAGGAAAAATGG - Intergenic
967472009 3:189872687-189872709 CGGGTCTGAAAGACCACAAAAGG + Intronic
969465628 4:7354594-7354616 CACCTCTGCAAAAGCACCAGAGG + Intronic
969802622 4:9581278-9581300 CAGCTCTGCATGAGAAGAAGGGG + Intergenic
970399895 4:15707092-15707114 CAGCTCTGGAAGAAGAGAAAGGG + Intronic
971156386 4:24087700-24087722 CAGCTCTGGGAGAGCACTCAGGG - Intergenic
974096202 4:57367233-57367255 CTGCACTGTAAGAGAACAAAAGG + Intergenic
974436565 4:61863971-61863993 TAGTTCTGCAAGAGAATAAAAGG + Intronic
974854866 4:67448681-67448703 CAACTTTTCAACAGCACAAAAGG + Intergenic
976805205 4:89038124-89038146 CAGCTCTGCGAGGGCCCAAGGGG + Intronic
981004554 4:139861684-139861706 CAGCTGTGCAAGAGCCCGACAGG - Intronic
982513760 4:156318362-156318384 TAACTTTGCAAGAGCACAGAAGG - Intergenic
982535788 4:156604923-156604945 CATCTCTACAGGAGCTCAAATGG - Intergenic
983754891 4:171322793-171322815 AAATTCTGAAAGAGCACAAAGGG + Intergenic
984325242 4:178242329-178242351 CAGCTCTCAGAGAGCACAGAGGG - Intergenic
984648711 4:182246405-182246427 CCGCTCTGAAAGAGCACAGGAGG + Intronic
986657632 5:10030927-10030949 CAGCTCAGCTAGAGCAGAATAGG - Intergenic
987071587 5:14342093-14342115 CAGCTCTGCAAGGGGAAAAGAGG + Intronic
987440381 5:17948893-17948915 AAAATCTGAAAGAGCACAAATGG - Intergenic
987702918 5:21424954-21424976 CAGCTTTGAAAGTGAACAAAGGG + Intergenic
992639372 5:78755597-78755619 CATCTGTTGAAGAGCACAAATGG - Intronic
992898883 5:81272978-81273000 AAAGTCTGAAAGAGCACAAATGG + Intergenic
994378814 5:99045573-99045595 CAGCTTTGTAGAAGCACAAAAGG - Intergenic
996279670 5:121713704-121713726 AAAGTCTGAAAGAGCACAAATGG + Intergenic
996388080 5:122929931-122929953 CAGATATGCAGAAGCACAAATGG - Intronic
1001036731 5:168302185-168302207 CAGCTCTCAAACAGCGCAAAAGG - Intronic
1001881536 5:175248893-175248915 AAGCTCTGTAAGAGCAGGAATGG - Intergenic
1002856445 6:1042244-1042266 AAAGTCTGGAAGAGCACAAATGG - Intergenic
1006514282 6:34537465-34537487 CTGCTCTGCAACAGAGCAAAAGG + Intergenic
1007378756 6:41473228-41473250 CAGCTCACCCAGAGCACACAGGG - Intergenic
1007593375 6:43036921-43036943 CAGCTCTGCAAGGACAGAGAAGG + Intergenic
1013043269 6:106457812-106457834 CAGCACTGATAGAGCACATAGGG - Intergenic
1013407542 6:109856823-109856845 CATCTATACAAGAGCTCAAATGG + Intergenic
1013464855 6:110409135-110409157 CACCTCTGCCAGAGCACATGGGG + Intronic
1014581620 6:123144634-123144656 AAAGTCTGAAAGAGCACAAATGG + Intergenic
1015629036 6:135212688-135212710 CATGTCTGCAAGAGCACCATGGG + Intronic
1017114337 6:150962839-150962861 CTGCTCTGCATTAGCACAACAGG + Intronic
1018003164 6:159597422-159597444 CAGGGCTGCAAGATCAGAAAGGG - Intergenic
1018782379 6:167079957-167079979 AAGCACAGCAACAGCACAAATGG - Intergenic
1018842278 6:167526101-167526123 CAGCTCTCAAAGAGCATTAAAGG + Intergenic
1019777718 7:2922460-2922482 CAGGTCTGGGAGAGCACACAGGG - Intronic
1022471742 7:30685782-30685804 CATCTCTGCAGCAGCCCAAATGG + Intronic
1022564919 7:31389437-31389459 AAAGTCTGAAAGAGCACAAATGG - Intergenic
1022810560 7:33864032-33864054 CATCACTGCAAGAGACCAAAGGG - Intergenic
1023072656 7:36452133-36452155 CTTCTCTGCAAGAGCACCTAAGG - Intronic
1024620352 7:51151794-51151816 CATTTCTTCAAGAGCAGAAAGGG + Intronic
1025552190 7:62264466-62264488 CTGCTCTGCAAGAGAAGAGAAGG - Intergenic
1025863002 7:65350547-65350569 CAGCTTTTCAAAAGCAGAAAAGG - Intergenic
1027299091 7:76810624-76810646 CAGCTCTGCCATACAACAAAAGG + Intergenic
1027358550 7:77384435-77384457 CAGCTCTGCAAAAGCACTCAAGG + Intronic
1028028489 7:85877424-85877446 AAATTCTGAAAGAGCACAAATGG + Intergenic
1028146353 7:87323858-87323880 CAGCTCAGAAAGTGCAAAAAGGG - Intergenic
1029070105 7:97888718-97888740 CAGCTCTGCATGAGAAGAAGGGG - Intergenic
1030827259 7:114173905-114173927 CAGGTCTGCAAATGCAAAAATGG - Intronic
1031547685 7:123069605-123069627 CAGCTCTGAAAGATGACTAACGG + Intergenic
1032198419 7:129802824-129802846 GTGCTCTGCAGGAGCCCAAATGG + Intergenic
1033259916 7:139834356-139834378 AAAGTCTGAAAGAGCACAAACGG + Intronic
1033898658 7:146108602-146108624 CAGCTCTGCAAAAGTAAAAGAGG + Intergenic
1034682943 7:152944407-152944429 AAAGTCTGAAAGAGCACAAACGG - Intergenic
1034908427 7:154971899-154971921 CAGCAATGCAAGAGAACATAAGG - Intronic
1035547353 8:493431-493453 CAGCTCCGCCAGAGCACGAAGGG + Intronic
1036248451 8:7140970-7140992 CAGCTCTGCATGAGAAGAAGGGG + Intergenic
1037632281 8:20669066-20669088 CAACTCTGCATGAGCCCAAAAGG - Intergenic
1037834529 8:22208331-22208353 CCGCTCTGCGAGAGGACTAAGGG + Intronic
1039450251 8:37667736-37667758 CAGCTAAGCAAGAGAAAAAATGG + Intergenic
1042840931 8:73123057-73123079 AAGCTCTGAGAGAGCACACAAGG - Intronic
1043153279 8:76745144-76745166 CAGCTCTGCTGGAGCACCATGGG + Intronic
1043803245 8:84638351-84638373 AAAGTCTGAAAGAGCACAAATGG + Intronic
1044387621 8:91608264-91608286 CAGTTTTGCAAAAGCACAATGGG - Intergenic
1045012465 8:97970080-97970102 CTGCTCTGCAAGAGCAGTCATGG - Intronic
1045242959 8:100418299-100418321 CAGCTCTGCTACAGCACAGCTGG - Intergenic
1046724904 8:117663692-117663714 CAGCTGTGACAGAGCAGAAAGGG - Intergenic
1047128123 8:121985862-121985884 CAGCTCTTTAAGAGCAGAAATGG + Intergenic
1047320453 8:123775544-123775566 CAGTACTACAACAGCACAAAGGG - Intronic
1048087365 8:131198009-131198031 CAGATCTGAAAGAGCTCAAGGGG - Intergenic
1048881287 8:138874776-138874798 CAGCCATGCAAGAGCAGATACGG + Intronic
1049319429 8:141988108-141988130 CAGCTGTGCAGGGTCACAAAAGG - Intergenic
1049868426 8:144954958-144954980 CATCTCTACAGGAGCTCAAATGG + Intergenic
1051351106 9:16198649-16198671 CAGCTGTGGAAGAGCAGAAAAGG - Intergenic
1053058405 9:35008329-35008351 CATCTATACAAGAGCTCAAATGG - Intergenic
1055010491 9:71560051-71560073 CAGCTATGGAAGAACACAGAAGG + Intergenic
1056667584 9:88593256-88593278 CAGCTCAGCAGGAGCAACAATGG + Intergenic
1057198596 9:93128529-93128551 CAGCTTCGCAAGAGCAGAACTGG - Intronic
1057933357 9:99215235-99215257 GAGCTCTGCAAAAGCTCTAAAGG + Intergenic
1059344714 9:113620390-113620412 CTGGGCTGCAGGAGCACAAAGGG - Intergenic
1059803034 9:117770288-117770310 CAGCTCTGAAAGAGGACAAAGGG + Intergenic
1060850127 9:126868190-126868212 CTGCTCTGCAACAACACACAAGG - Intronic
1061085101 9:128393746-128393768 GAGCTCTCCAAGAGCACCCAGGG + Intergenic
1061619437 9:131801953-131801975 CCGGTCTGCTAGAGAACAAAGGG + Intergenic
1061899285 9:133664807-133664829 CAGCCCTGCAGGTGCACACATGG - Intronic
1062149494 9:135010278-135010300 CAGCTCTGCAGGAGCAGTCACGG - Intergenic
1189284627 X:39842599-39842621 CAGCTCTTCAGGAGGAGAAAGGG + Intergenic
1191045563 X:56132528-56132550 AAAATCTGAAAGAGCACAAATGG + Intergenic
1191787403 X:64931449-64931471 AAAGTCTGAAAGAGCACAAATGG - Intronic
1192249731 X:69401774-69401796 CTTCTTTGCAAGAGCGCAAAAGG - Intergenic
1192895257 X:75436432-75436454 AAAGTCTGAAAGAGCACAAATGG - Intronic
1194889777 X:99364372-99364394 CAGCTCAGCCACAGCACAATAGG + Intergenic
1196497246 X:116335764-116335786 CATCTATACAAGAGCTCAAATGG - Intergenic
1199268581 X:145856490-145856512 CATCTCTGCATGAGCACAGAAGG - Intergenic
1201372197 Y:13278038-13278060 CAGCTCTGCCAGAGTAGAACAGG + Intronic