ID: 1095381778

View in Genome Browser
Species Human (GRCh38)
Location 12:41603555-41603577
Sequence TTTTGAGGTCGCAAACTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095381778_1095381780 -9 Left 1095381778 12:41603555-41603577 CCACCTAGTTTGCGACCTCAAAA No data
Right 1095381780 12:41603569-41603591 ACCTCAAAAATGTAATGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095381778 Original CRISPR TTTTGAGGTCGCAAACTAGG TGG (reversed) Intergenic
No off target data available for this crispr