ID: 1095391686

View in Genome Browser
Species Human (GRCh38)
Location 12:41714659-41714681
Sequence TTGCTTTGGTGTCAGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095391684_1095391686 5 Left 1095391684 12:41714631-41714653 CCTTTGTAAGAAAGGATAATTAT No data
Right 1095391686 12:41714659-41714681 TTGCTTTGGTGTCAGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095391686 Original CRISPR TTGCTTTGGTGTCAGTGTGC AGG Intergenic
No off target data available for this crispr