ID: 1095392580

View in Genome Browser
Species Human (GRCh38)
Location 12:41726705-41726727
Sequence CTCAAACCAAGGCTTCGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095392580_1095392587 23 Left 1095392580 12:41726705-41726727 CCCCACCGAAGCCTTGGTTTGAG No data
Right 1095392587 12:41726751-41726773 AAATTAAAATTGTCTGACAGAGG No data
1095392580_1095392588 27 Left 1095392580 12:41726705-41726727 CCCCACCGAAGCCTTGGTTTGAG No data
Right 1095392588 12:41726755-41726777 TAAAATTGTCTGACAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095392580 Original CRISPR CTCAAACCAAGGCTTCGGTG GGG (reversed) Intergenic
No off target data available for this crispr