ID: 1095402645

View in Genome Browser
Species Human (GRCh38)
Location 12:41832820-41832842
Sequence ATTATGTACACAGCCCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095402645_1095402650 14 Left 1095402645 12:41832820-41832842 CCCAAAGGGGCTGTGTACATAAT No data
Right 1095402650 12:41832857-41832879 GGTTAAGCCTCATAGAATATGGG No data
1095402645_1095402649 13 Left 1095402645 12:41832820-41832842 CCCAAAGGGGCTGTGTACATAAT No data
Right 1095402649 12:41832856-41832878 CGGTTAAGCCTCATAGAATATGG No data
1095402645_1095402647 -7 Left 1095402645 12:41832820-41832842 CCCAAAGGGGCTGTGTACATAAT No data
Right 1095402647 12:41832836-41832858 ACATAATCCAGAAGTGTATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095402645 Original CRISPR ATTATGTACACAGCCCCTTT GGG (reversed) Intergenic
No off target data available for this crispr