ID: 1095404016

View in Genome Browser
Species Human (GRCh38)
Location 12:41847370-41847392
Sequence ATTCTCTTCTGTTCCATCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095404016_1095404019 26 Left 1095404016 12:41847370-41847392 CCGTTGATGGAACAGAAGAGAAT No data
Right 1095404019 12:41847419-41847441 TTTCTTCTAGCTGACCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095404016 Original CRISPR ATTCTCTTCTGTTCCATCAA CGG (reversed) Intergenic
No off target data available for this crispr