ID: 1095419976

View in Genome Browser
Species Human (GRCh38)
Location 12:42015350-42015372
Sequence GGGAACAGCACCAAGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095419976_1095419985 22 Left 1095419976 12:42015350-42015372 CCAGACTCCTTGGTGCTGTTCCC No data
Right 1095419985 12:42015395-42015417 TAGAATTCAGGATTCACTTTTGG No data
1095419976_1095419983 10 Left 1095419976 12:42015350-42015372 CCAGACTCCTTGGTGCTGTTCCC No data
Right 1095419983 12:42015383-42015405 GCTCATTTCCTGTAGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095419976 Original CRISPR GGGAACAGCACCAAGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr