ID: 1095434416

View in Genome Browser
Species Human (GRCh38)
Location 12:42171456-42171478
Sequence TAGCCACTGGCATTTCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095434413_1095434416 22 Left 1095434413 12:42171411-42171433 CCAGGAGTTAGAGGGGCTGCAGT 0: 1
1: 2
2: 6
3: 39
4: 351
Right 1095434416 12:42171456-42171478 TAGCCACTGGCATTTCAGACTGG 0: 1
1: 0
2: 1
3: 20
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095434416 Original CRISPR TAGCCACTGGCATTTCAGAC TGG Intronic
901322207 1:8346608-8346630 GAGGAAGTGGCATTTCAGACAGG - Intergenic
901536572 1:9886263-9886285 GTGCCGCTGACATTTCAGACTGG + Intronic
902753245 1:18532094-18532116 AAGACACTGGCCTTGCAGACTGG + Intergenic
902996645 1:20230529-20230551 CAGCCAGTGGCACTTCAGGCAGG + Intergenic
904489285 1:30848243-30848265 TAGCCAGTGGCATGTCAGACTGG - Intergenic
905894545 1:41536606-41536628 TAGCCACTGCCCCTTCAGAGAGG - Intronic
907501300 1:54883516-54883538 TAGCCAAGGGCATTGCAGAGTGG - Intronic
908356954 1:63331131-63331153 CAGCTACTGGTATTTCAGGCTGG - Intergenic
908394640 1:63714298-63714320 AAGCCACTGAGATTTCAGAGTGG - Intergenic
908761447 1:67516126-67516148 TATTCACTGTCATTTGAGACAGG + Intergenic
913103164 1:115588209-115588231 TAGCCTCTGCCATTTCACAATGG + Intergenic
918163377 1:181921109-181921131 AAGCCTCTGGAAGTTCAGACTGG + Intergenic
921336089 1:214087961-214087983 TAGGCAAGGGCATTACAGACTGG - Intergenic
921428293 1:215031260-215031282 TAGCCACTGGGATTTTGGTCAGG + Intronic
1064080535 10:12304465-12304487 TTGGCACTTGGATTTCAGACAGG + Intergenic
1065010525 10:21416748-21416770 GTGCCACTTGCATTTCAGCCTGG + Intergenic
1066707473 10:38197256-38197278 TACTCACAGGCATTTCTGACTGG + Intergenic
1067372424 10:45697835-45697857 TACTCACGGGCATTTCTGACTGG + Intergenic
1067387354 10:45828293-45828315 TACTCACGGGCATTTCTGACTGG - Intronic
1067418771 10:46128960-46128982 TACTCACGGGCATTTCTGACTGG + Intergenic
1067504125 10:46835537-46835559 TACTCACGGGCATTTCTGACTGG + Intergenic
1067875909 10:50007790-50007812 TACTCACGGGCATTTCTGACTGG + Intronic
1069807371 10:71134347-71134369 TTGCCAGTGGGATGTCAGACAGG - Intergenic
1070565961 10:77604052-77604074 GAGCCACTGGCATCTGAGGCTGG + Intronic
1073411417 10:103345257-103345279 TAGCCAATGTCATTAAAGACAGG - Intronic
1073818384 10:107232922-107232944 GAGCTACTGGCATCTCATACTGG + Intergenic
1074583675 10:114745516-114745538 ACGCCACTGGCATTTCAGCCTGG + Intergenic
1078887007 11:15510821-15510843 TAGCCACAGTAATATCAGACAGG - Intergenic
1079237706 11:18701626-18701648 CAGCCACTGGCTCTTCGGACAGG + Exonic
1079669958 11:23156465-23156487 TAGACACTGGCAACTCAGAAGGG + Intergenic
1079698377 11:23513132-23513154 TACACACTGGCATTTGAAACAGG - Intergenic
1082120318 11:48373035-48373057 TAACCACTGGCATTTTGGACTGG + Intergenic
1082253980 11:50012183-50012205 TAACCACTGGCATTTTGGACTGG - Intergenic
1083158597 11:60840974-60840996 AAACCACTGGAATGTCAGACGGG + Intergenic
1083686472 11:64379078-64379100 CAGCCACTGGAATTGCCGACGGG + Intergenic
1084716831 11:70879647-70879669 TAGCCACTGGCATTGGAGTCAGG - Intronic
1085980243 11:81715904-81715926 TAGTCACTGGTCTTTCAGAAGGG + Intergenic
1087963394 11:104380477-104380499 TGGCCACTGGTATAGCAGACTGG + Intergenic
1088201287 11:107338099-107338121 TAGCCACTGGTACTTCAGCCTGG - Intronic
1088359731 11:108977826-108977848 GAGCCACTGGCTATTCACACGGG - Intergenic
1089116640 11:116100552-116100574 TAGCCACTGGTATTTTAGTAAGG - Intergenic
1091650676 12:2306883-2306905 CAGCCACTGGCAGTGCAAACAGG - Intronic
1092505281 12:9092384-9092406 TAGCCACTGGCATTGCTCAAAGG - Intronic
1093082066 12:14823860-14823882 TAGTGACTGACATTTCAAACAGG - Exonic
1095434416 12:42171456-42171478 TAGCCACTGGCATTTCAGACTGG + Intronic
1101115751 12:101529734-101529756 TAGGAGATGGCATTTCAGACAGG - Intergenic
1102529484 12:113535807-113535829 GCCCCACTGGCATTTCAGGCTGG + Intergenic
1103999472 12:124851256-124851278 AAGCCACTGGCAAGTGAGACTGG + Intronic
1106027144 13:25966326-25966348 TAGCCACTGGCATGTCACTTAGG - Intronic
1110715064 13:78692867-78692889 TTGCCACTGCTATTTCAGAGTGG + Intergenic
1112958211 13:105088029-105088051 TGGCCACTGGCGTCTCAGGCTGG - Intergenic
1115439220 14:33412594-33412616 TAGTCACAGGCAATTCAAACTGG - Intronic
1116599338 14:46899361-46899383 TAGCCTTTGGCATTGCAGACTGG - Intronic
1118242089 14:64069778-64069800 CAGCCTCTGGCATGTCTGACTGG + Intronic
1119249673 14:73140969-73140991 TAGCCACTGCCCCTTCAGCCTGG - Intronic
1119303894 14:73591804-73591826 AAGCCCCTGGGACTTCAGACCGG - Exonic
1120488544 14:85146926-85146948 TAGCCAGTGGGATTCCAGACTGG - Intergenic
1121072732 14:91039260-91039282 TATCCACTGGGATCTCAGAGTGG - Intronic
1122823920 14:104360475-104360497 CAGCCCCTGGGATCTCAGACTGG + Intergenic
1123441153 15:20292849-20292871 TGGCCACTGGCGATTCAGTCAGG + Intergenic
1127625326 15:60774694-60774716 TGGCCACTGGTATTTCTGAATGG + Intronic
1131426442 15:92348938-92348960 TGGCCTCTGGGATTTCAGACAGG - Intergenic
1133983598 16:10651453-10651475 TAGGCACTGGGAATTCAGAAGGG - Intronic
1134226428 16:12394646-12394668 TATCCACTGGGACTTCAGATGGG + Intronic
1136031812 16:27508605-27508627 TAGCCACTCGGATTTCAGCTTGG + Exonic
1137950826 16:52781864-52781886 TAGCCACTGGCCTTAAAGAAAGG + Intergenic
1138130355 16:54474165-54474187 TAACCACCATCATTTCAGACTGG + Intergenic
1138960138 16:62019318-62019340 TGGCCACTGGCATTTCCAACAGG + Intronic
1140251859 16:73301393-73301415 GATCTACTGACATTTCAGACAGG + Intergenic
1141151713 16:81568806-81568828 CACCCACTCGCCTTTCAGACTGG - Intronic
1141350001 16:83286045-83286067 TAGAGACTTGCATTTGAGACAGG - Intronic
1141815467 16:86406519-86406541 TAGCCTCTGGCTTATCAGATAGG - Intergenic
1143297007 17:5878647-5878669 TGGCCCCAAGCATTTCAGACAGG + Intronic
1145091896 17:19993071-19993093 CAGCCACTGGCACTCCAGCCTGG + Intergenic
1147663086 17:42128080-42128102 AAGGCACTGGGATTACAGACAGG + Intronic
1149513868 17:57265128-57265150 TGGCCACCGGGATTTCAGACTGG + Intronic
1150009838 17:61493393-61493415 CAACCACTGGCTTTTCAGTCTGG - Intergenic
1150127030 17:62643628-62643650 TAGCCACTGGCATTTCCTCTTGG - Intronic
1151730707 17:75909567-75909589 TACTCACTGTCATTTCAGGCAGG + Exonic
1153692042 18:7603654-7603676 TACCAACTGGCATTACAGAAAGG - Intronic
1153911061 18:9707343-9707365 AATTCACTGGCATTTCAGATGGG - Intergenic
1154402634 18:14056201-14056223 TCCCCTCTGACATTTCAGACAGG - Intergenic
1156188367 18:34689910-34689932 AAGCCACTGGGAGTTCAGACTGG - Intronic
1157166708 18:45364034-45364056 GAGGCACTGGCATTTGAAACTGG - Intronic
1158499302 18:57985623-57985645 TTGCCACTTGCATTCCAGCCTGG + Intergenic
1159382727 18:67683562-67683584 TAGACACTGGAATCTCAGAAAGG + Intergenic
1159450109 18:68589881-68589903 TAGAAAATGGCATTTCAGGCAGG + Intergenic
1160083425 18:75752895-75752917 TAGCCACAGGCACTTCCGGCTGG - Intergenic
1162134837 19:8548991-8549013 GCGCCACTGGCATTCCAGCCTGG - Intronic
1168222386 19:54969928-54969950 CAGGAACTGGCATTTGAGACAGG + Intronic
931166935 2:59758439-59758461 GAGCCACTGACATTTCAAATGGG - Intergenic
932089946 2:68797547-68797569 CAGCCACTGGCATTGCAACCAGG - Intronic
934150368 2:89142676-89142698 GGGCCACTGGCATCCCAGACAGG - Intergenic
934216925 2:90039355-90039377 GGGCCACTGGCATCCCAGACAGG + Intergenic
934716290 2:96546579-96546601 GAGCCACAGGCAGTTCAGCCAGG + Intronic
938623527 2:133083200-133083222 TGGCCACTTGCATATTAGACAGG + Intronic
938961995 2:136352365-136352387 AAGCCACTGGGCTTCCAGACTGG - Intergenic
938967020 2:136397666-136397688 TAGACTCTGGGATTTCAGAGAGG + Intergenic
943102639 2:183507298-183507320 TAGCCACTGGCGTTACAGAGAGG + Intergenic
948272825 2:236687425-236687447 TCCCCACTGGCATTTGGGACCGG - Intergenic
949058251 2:241941651-241941673 CAGCCACTTGCATTTCTGAATGG + Intergenic
1169993991 20:11536021-11536043 TGGCCACTGGAATTTCACAATGG - Intergenic
1170355406 20:15487032-15487054 TAACTACTGCCCTTTCAGACAGG - Intronic
1173184930 20:40833355-40833377 AAGCCATTGGGATTTCAGCCAGG - Intergenic
1174232239 20:49055207-49055229 TAGCCTCAGGCAGTTCAGGCTGG + Intronic
1175568176 20:59997510-59997532 TGGCCACTGGTTTTTCAAACTGG + Intronic
1175667345 20:60871621-60871643 TGGCCGTTGGCATTTCAGGCAGG - Intergenic
1175813775 20:61873120-61873142 GGGCCGCTGGCATTTCAGAGGGG - Intronic
1183520018 22:38291466-38291488 CAGCCACTGTCATCTCAGAGTGG + Exonic
1184645579 22:45892984-45893006 AAGCCAGTGGCATTTCAGGCTGG + Intergenic
1184801237 22:46761591-46761613 CAGGGACTGTCATTTCAGACTGG - Intergenic
950306331 3:11917534-11917556 TAGCAGCTGTCATTTCACACAGG + Intergenic
953344837 3:42166507-42166529 GAGCCACTGGCCTTTCTGTCTGG + Intronic
954995128 3:54874356-54874378 TCTACACTGGCAATTCAGACTGG - Intronic
956582532 3:70830521-70830543 TAGCCACTAGAATTTCTCACAGG + Intergenic
956830344 3:73040624-73040646 CAGCTACTGGAATTACAGACAGG - Intronic
959444198 3:106417729-106417751 TCACCAGTGGCATTTCATACTGG - Intergenic
963171072 3:142251791-142251813 CAGCCAGTGGAATTTCAGAGGGG + Intergenic
964919540 3:161879672-161879694 TAGTAATAGGCATTTCAGACTGG - Intergenic
969390911 4:6890799-6890821 GGGCCACTGCCATTTCAGAGAGG + Intergenic
970096982 4:12475176-12475198 TGGCTGCTGGCATTTCAGAAGGG + Intergenic
971147498 4:23994788-23994810 TAGTCACTGTCATTTCTGATAGG - Intergenic
971478743 4:27095664-27095686 AAGCCACTGGCCATTCAGAAGGG - Intergenic
972422175 4:38898378-38898400 TAAACACTGTCATTTCTGACCGG - Intronic
972585879 4:40436738-40436760 TAGCCACCTGCAATTAAGACTGG - Intronic
974522987 4:63009537-63009559 TAGCCAATTGAATTTCAGAAAGG - Intergenic
976901661 4:90184864-90184886 CAGTCACTGTCATTTCAGGCTGG - Intronic
980711909 4:136580021-136580043 TAGCCACTGGGCTACCAGACTGG + Intergenic
984526040 4:180860500-180860522 AAGCCCCTGGAAGTTCAGACTGG - Intergenic
985472845 5:56575-56597 GAGCCTCTGGCATTTCAGCGGGG + Intergenic
986156158 5:5178342-5178364 TAACCACTGGAATGTCAGGCGGG - Intronic
988520583 5:31941888-31941910 TTGCCACTGGGATTTCAAAATGG + Intronic
990610047 5:57447860-57447882 TAGCCTCAAGAATTTCAGACAGG + Intergenic
991971518 5:72146379-72146401 TAGCCAGTGCCATTTGAGTCCGG + Intronic
996388428 5:122933787-122933809 TTGCCTCTGGAATTTCAGACTGG - Intronic
998672268 5:144367210-144367232 TAGCCACTTGAACTTCAGACAGG + Intronic
998989853 5:147803445-147803467 TTGCCACTGGCATGTAAGAAGGG + Intergenic
1000656856 5:163889707-163889729 TGGCAGCTGGCATTTCACACTGG - Intergenic
1000785662 5:165540543-165540565 TTGCCATTGGCATTCCAGCCTGG - Intergenic
1003417004 6:5918582-5918604 TAGTCAATGGCATTTCAGCCTGG - Intergenic
1004585116 6:16991835-16991857 TACCCACTGACATGTCAGCCAGG + Intergenic
1005823739 6:29619362-29619384 TCCCCACTGGCATTTTAGGCTGG + Intronic
1008030256 6:46687573-46687595 TAGCCAGTGGCGTTCCCGACGGG - Intergenic
1008407579 6:51136208-51136230 AAGCCCCTGGAAGTTCAGACTGG - Intergenic
1009919912 6:70044691-70044713 CTGCCACTGGCATTTCAGAAAGG - Intronic
1015612543 6:135040392-135040414 ACGCCACTGGCATTCCAGCCTGG - Intronic
1016008833 6:139117231-139117253 TAGACACTCACATCTCAGACAGG + Intergenic
1018566445 6:165159685-165159707 GAGGCACTGGCATATCAGCCTGG - Intergenic
1018643991 6:165930871-165930893 CAGGAACTGGCATTTCAGCCTGG + Intronic
1019826750 7:3290886-3290908 GTGCCACTGGCACTTCAGCCTGG - Intergenic
1020978507 7:15038362-15038384 TAGCCACTGGCTTTGAAGACAGG + Intergenic
1021206511 7:17787145-17787167 TATCAACTGGCATCTCAGTCAGG - Intergenic
1023296787 7:38723346-38723368 TAGCCAAAGGGATTTCATACTGG - Exonic
1026153153 7:67804869-67804891 TAGCCAGTGGCATAACAAACAGG + Intergenic
1028309198 7:89309150-89309172 TAGACACTGGGATTTCAAAGTGG - Intronic
1031615972 7:123879932-123879954 CAGCAACTGGGATTACAGACTGG - Intergenic
1032069246 7:128793650-128793672 GAGCCACTGGCACTCCAGCCTGG - Intronic
1032856426 7:135837390-135837412 TAGCCACTGGGATGTCCCACAGG - Intergenic
1039502507 8:38029295-38029317 TAGCCAGTGGAGTTTCAGAATGG - Intergenic
1041858107 8:62480981-62481003 TAGTCACTGGCAGTTCAGGAAGG - Intronic
1042030860 8:64474036-64474058 TAGCCACAGGAAATTCAGCCAGG + Intergenic
1042727947 8:71899367-71899389 TAGGCAGTGGCATTTCAGTGTGG - Intronic
1042909862 8:73815328-73815350 TAGCCCATGGCACTTCAGCCTGG + Intronic
1046319345 8:112551781-112551803 TATACAATGGAATTTCAGACAGG - Intronic
1048049228 8:130801685-130801707 TGCCCACTGGCATCTCAGACTGG + Intronic
1052244873 9:26322195-26322217 TGCCCACTGGCATTTCTCACTGG - Intergenic
1052297676 9:26916235-26916257 TATCCACTGGCCTTGCAGACTGG - Intronic
1052929094 9:34041660-34041682 GTGCCACTGGCATTCCAGCCTGG + Intronic
1052978683 9:34431012-34431034 GAGCCAGTGGCATTTAAGATAGG - Intronic
1060304162 9:122395177-122395199 TAGGCACTTGCATTTAAGAGAGG - Exonic
1186881496 X:13871226-13871248 TAGCCACTGGGATTTCTGTGTGG - Intronic
1186948373 X:14594849-14594871 CAGCCACTGGGATTTTAGTCAGG + Intronic
1187158713 X:16744921-16744943 ACGCCACTGGCATTCCAGCCTGG + Intronic
1189236820 X:39493477-39493499 TAGCCATTGCTATTTCAGCCAGG + Intergenic
1192078318 X:68022713-68022735 GAGGCACTGGCATATCAGAGTGG + Intergenic
1193144528 X:78063436-78063458 TAGACACTGGCATTACATAGAGG + Intergenic
1194565261 X:95479174-95479196 ACGCCACTGGCACTCCAGACTGG - Intergenic
1196898047 X:120357403-120357425 GAGCCACTGTGATTTCTGACTGG + Intergenic
1197980451 X:132213083-132213105 TGGCAACAGGCATTTCAGATTGG - Intronic