ID: 1095437406

View in Genome Browser
Species Human (GRCh38)
Location 12:42205835-42205857
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095437406 Original CRISPR GGATGCACAAAAATGGTACT TGG (reversed) Intronic