ID: 1095437406

View in Genome Browser
Species Human (GRCh38)
Location 12:42205835-42205857
Sequence GGATGCACAAAAATGGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095437406 Original CRISPR GGATGCACAAAAATGGTACT TGG (reversed) Intronic
900004239 1:34203-34225 GCATACACAAAAATGGTAAAAGG + Intergenic
900023967 1:204719-204741 GCATACACAAAAATGGTAAAAGG + Intergenic
904230865 1:29070282-29070304 AAATGCTCAAAAATGATACTTGG - Intronic
904375468 1:30078938-30078960 GGATGCAACAAAACAGTACTTGG + Intergenic
907532117 1:55109577-55109599 GGATCCACAAAAATAGCAATTGG - Intronic
909258977 1:73462744-73462766 GGATGCACAAAAATATTACAGGG + Intergenic
909741576 1:79036301-79036323 TGATACAGAAAATTGGTACTAGG + Intergenic
912249038 1:107991822-107991844 TGATTCACACAAATGGTATTTGG + Intergenic
913433081 1:118816946-118816968 GGATGCAGAAAAAGGCTAATTGG - Intergenic
916125343 1:161565536-161565558 GGATGCTGGAAAATGGTCCTGGG - Intergenic
916135229 1:161646926-161646948 GGATGCTGGAAAATGGTCCTGGG - Intronic
916574150 1:166052254-166052276 GGATGAAAAAAAATGGTACCTGG - Intergenic
920421308 1:205835780-205835802 GGAGGTACAAGAATGGAACTAGG + Intronic
1063944544 10:11164266-11164288 GGGGGCACAAAAAGGGTACATGG + Intronic
1073004150 10:100309055-100309077 ACATGCACAAAAATGATACCTGG + Intronic
1073887227 10:108053681-108053703 GGATGAACAAAATTGGAAGTAGG - Intergenic
1075933510 10:126320018-126320040 GGATGAGCAAAATTGGTACTAGG + Intronic
1080572481 11:33568775-33568797 GAATGCACAAAAATGGTAAGGGG - Intronic
1080706941 11:34704274-34704296 GGATGCAGCAAAACAGTACTAGG - Intergenic
1081138091 11:39464200-39464222 GGATGCAGAAAAATGGTACTAGG + Intergenic
1081270642 11:41078353-41078375 TGATACAGAAAATTGGTACTAGG - Intronic
1087279152 11:96191163-96191185 GGAAGCATAAGAATGGAACTAGG + Intronic
1088459198 11:110064765-110064787 GGATGCACAACCATGGCAGTAGG - Intergenic
1089149218 11:116351912-116351934 GGATGCACACAAATGGGAAGTGG + Intergenic
1089597459 11:119589949-119589971 GGATGCTCAGTAATGGTGCTTGG - Intergenic
1090018064 11:123103320-123103342 GTATGCACTAAATTGGTGCTGGG - Intronic
1090882991 11:130850672-130850694 GGATGCACAAACATATAACTAGG + Intergenic
1091377663 12:36251-36273 GCATACACAAAAATGGTAAAAGG + Intergenic
1094364663 12:29667594-29667616 TGATGCCCAGAAATGTTACTTGG + Intronic
1095437406 12:42205835-42205857 GGATGCACAAAAATGGTACTTGG - Intronic
1098736314 12:74110364-74110386 GGATGCACAGTATTGATACTGGG - Intergenic
1100230436 12:92601197-92601219 TAATGCAGAAAATTGGTACTAGG - Intergenic
1104427413 12:128689564-128689586 AGATGCACAAAAACCATACTAGG + Intronic
1107743389 13:43479090-43479112 GCATGCATAAAGATGGAACTGGG + Intronic
1108722237 13:53144055-53144077 GGAGGAACAAAAATGGCTCTTGG + Intergenic
1112500092 13:99936196-99936218 GGATGAATAAAAGTGGTACTAGG - Intergenic
1115929979 14:38480230-38480252 GGCTGCATAAGAATGGAACTTGG - Intergenic
1116878212 14:50135980-50136002 GCATATATAAAAATGGTACTAGG + Intronic
1120748285 14:88173223-88173245 GAAAGGACATAAATGGTACTGGG + Intergenic
1120774041 14:88412625-88412647 GGATGCAAAGTATTGGTACTGGG - Intronic
1121660361 14:95630787-95630809 GAATGCAGAAAAACTGTACTGGG + Intergenic
1126564015 15:50075908-50075930 GAAAGCAAAAAAATGTTACTGGG + Intronic
1128493646 15:68176821-68176843 TAATGCACCAAAAGGGTACTTGG + Intronic
1129715269 15:77844552-77844574 TAATGCAGAAAATTGGTACTGGG + Intergenic
1132449265 15:101956741-101956763 GCATACACAAAAATGGTAAAAGG - Intergenic
1138820921 16:60258277-60258299 GTCTTCACAAAAATGGTACAAGG + Intergenic
1140887149 16:79254469-79254491 GTATTCACAAAGATGCTACTTGG - Intergenic
1141000370 16:80302031-80302053 GAATGCACAAAAATGGCATGAGG - Intergenic
1146913394 17:36662595-36662617 GGCTGCACAAACAAGGGACTTGG - Intergenic
1147704020 17:42413698-42413720 GGAAGCCCAAGAATGGGACTGGG - Intronic
1150322902 17:64231344-64231366 TGAAGCACATATATGGTACTTGG - Intronic
1153087189 18:1301808-1301830 GGAAGAACAAAAATGGAGCTTGG + Intergenic
1154928386 18:20964399-20964421 AGATGCTCAAAAATGGTCCCTGG - Intronic
1156511840 18:37643440-37643462 GGATGCAGAGAAAAGGAACTGGG - Intergenic
1157129745 18:44995712-44995734 GGATGCACCAAGAAGGTCCTTGG - Intronic
1158751271 18:60264043-60264065 GTATGAACAGAAATGGAACTTGG + Intergenic
1160635991 19:75812-75834 GCATACACAAAAATGGTAAAAGG + Intergenic
1164676637 19:30105552-30105574 GGATGCACAGACATGGTCCCTGG + Intergenic
930886200 2:56329983-56330005 GAATGCACAAAAAAGGAAATTGG - Intronic
931438054 2:62266093-62266115 GGCTGCACAAAGAGGGTATTTGG + Intergenic
935136219 2:100305129-100305151 AGCTGCACAAAAACAGTACTGGG - Intronic
936565489 2:113579240-113579262 GCATACACAAAAATGGTAAAAGG - Intergenic
937943472 2:127309551-127309573 GGATCCAGAAAAATGATATTAGG - Intronic
938254969 2:129850536-129850558 GGATGAGCAAAAATGCCACTAGG - Intergenic
939280918 2:140063874-140063896 TGATGGACAAAAAAAGTACTTGG + Intergenic
940485758 2:154293490-154293512 GGATGAAGTAAAATGATACTTGG - Intronic
942901252 2:181121806-181121828 GGATGCACCCAAATGGTAGAAGG + Intergenic
944160902 2:196658265-196658287 GTATGCTCGAATATGGTACTGGG + Intronic
944437467 2:199705789-199705811 AGATGCACAAAAGATGTACTTGG + Intergenic
945200320 2:207274776-207274798 AAATCCACAAAAATTGTACTAGG + Intergenic
947375582 2:229491656-229491678 GGATGAAGAAAAATGGGAATAGG - Intronic
1170086479 20:12538205-12538227 GGATACAGAAAGATGGTGCTAGG + Intergenic
1172265124 20:33605136-33605158 TGAAGCATAAAAATGGTATTTGG + Intronic
1178102688 21:29286806-29286828 AGGTGCACAAAAATGGTAAAAGG + Intronic
1178503326 21:33143624-33143646 GGATGCACAAAAGTGTGACTTGG + Intergenic
950177213 3:10883090-10883112 GGATCCACAATAAAGGTCCTCGG - Intronic
950990343 3:17430493-17430515 AGGTGCAAAAAAATGGTAATAGG + Intronic
951540187 3:23775271-23775293 GGGTGCACCAAAATGGTAAAGGG - Intergenic
952528267 3:34236606-34236628 GCATGTAGAAAAATGATACTTGG + Intergenic
952666705 3:35915156-35915178 GAATGTACAAAAATGCTCCTGGG - Intergenic
953221872 3:40979154-40979176 GGCTGGACAAGAATGGAACTGGG + Intergenic
953774801 3:45807298-45807320 GGCTGCACAGAACTGGCACTGGG + Intergenic
953859058 3:46526839-46526861 GGATGGACAAAAATGGTCTCAGG + Intronic
954593421 3:51803796-51803818 GGAGACAGAAAAATGGTAATAGG + Intergenic
954946001 3:54424882-54424904 GGATGCAGAAACGTGGTAATCGG - Intronic
955867423 3:63399733-63399755 GGATGTACAATTATGCTACTTGG - Intronic
956873896 3:73443376-73443398 GAATGCACAAATATGGAAGTGGG - Intronic
956895263 3:73653314-73653336 GTGTGCACAAAAATGGTAAAGGG + Intergenic
957660586 3:83146720-83146742 GGATGCACAAAAAAGACACCAGG - Intergenic
960475433 3:118118694-118118716 GGATGAAGAAAAATTGTCCTGGG - Intergenic
960970920 3:123139605-123139627 GGAGGCGCAAAGATGGTAGTGGG + Intronic
964857256 3:161159842-161159864 GGATGCATAAAAATGTTCCAAGG + Intronic
965264630 3:166526004-166526026 AGATGCTAAAAAATGGTAGTTGG + Intergenic
966087559 3:176087292-176087314 GAATGCAAAGAAATGGTTCTTGG - Intergenic
966717085 3:183023922-183023944 GGATGCCCTAAAAGGGTATTAGG - Intronic
967772611 3:193351204-193351226 GCAGGCACAAAAATGGCATTTGG + Intronic
972466138 4:39358869-39358891 GTATGTACATAAGTGGTACTGGG - Intronic
976386039 4:84459872-84459894 GGATGAACAAGAATTATACTGGG - Intergenic
976712984 4:88093135-88093157 AGTTGCACAAAAATGGTATCAGG - Intronic
977038639 4:91985417-91985439 GGATGCACAAAAGGGGGAATGGG + Intergenic
977155583 4:93568900-93568922 GAAAGCACAAAAATGGTAACAGG - Intronic
979449763 4:120856791-120856813 AGATGCTGAAACATGGTACTAGG - Intronic
979499693 4:121425818-121425840 GGATGCACTCAAGTGGAACTGGG - Intergenic
981275323 4:142892705-142892727 TAATGCAGAAAATTGGTACTGGG + Intergenic
986212143 5:5683988-5684010 GGAAGACCTAAAATGGTACTTGG - Intergenic
986329307 5:6705729-6705751 GGATGCACAGAATAGGTACACGG + Intergenic
986528797 5:8711810-8711832 GGTTGCCAAAAAATGGTAATGGG + Intergenic
986959047 5:13191264-13191286 GAATGCATAGAAATTGTACTAGG + Intergenic
986975001 5:13383439-13383461 GGAGGCACAAAGATGGTAGATGG + Intergenic
988724501 5:33912686-33912708 GGTTGCACAAGCATGGCACTAGG + Intergenic
994445825 5:99872428-99872450 AGATGCACAGCAATGGCACTAGG - Intergenic
994504556 5:100625708-100625730 GGCAGAACAAAAGTGGTACTTGG - Intergenic
1000156926 5:158561498-158561520 GAATTCACAAAACTGGCACTGGG - Intergenic
1000575311 5:162968931-162968953 GAATACAGAAAATTGGTACTGGG + Intergenic
1001007495 5:168066422-168066444 GGATGCACACAAAGGCCACTAGG - Intronic
1001727770 5:173921496-173921518 GGAAGCTCCAAAATGCTACTTGG - Intronic
1004076962 6:12352511-12352533 TAATACAGAAAAATGGTACTGGG - Intergenic
1004216682 6:13710927-13710949 GGGTGCACTACAAAGGTACTGGG - Exonic
1004321993 6:14639157-14639179 GGACTCACAGAAAGGGTACTCGG + Intergenic
1006023648 6:31133143-31133165 GTAGGCACAAAAATGGTAAAGGG + Intronic
1007095534 6:39210437-39210459 GGAGGCACAAAAATGTAGCTGGG + Intronic
1007266929 6:40603638-40603660 GGAAGCACCAAGAGGGTACTGGG - Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008414398 6:51223062-51223084 GAATACACACAAATGGTACAGGG - Intergenic
1008812403 6:55519304-55519326 GGTAGAAAAAAAATGGTACTGGG + Intronic
1009873634 6:69478702-69478724 ATATGCACAAAATTGCTACTTGG - Intergenic
1010260524 6:73810616-73810638 GGATCTACAGAAATGCTACTAGG + Intronic
1010735208 6:79436281-79436303 GAATGCACAAACATGGAATTGGG - Intergenic
1011210943 6:84955963-84955985 GGATACCCAAAAATGGAACTGGG + Intergenic
1012939008 6:105398017-105398039 GGATGGACAAAAATGCTAATTGG + Intronic
1013061458 6:106638204-106638226 GGAAGAACAAAGATGGTAGTAGG - Intronic
1023131405 7:37006576-37006598 GAGGGCACAAAAATGGTTCTTGG + Intronic
1028445543 7:90918422-90918444 GGATGCTCAAACATGGTGTTTGG - Intronic
1028741726 7:94283078-94283100 GGATGCACAACAATGGCACAGGG - Intergenic
1028935314 7:96457462-96457484 GGATGCACAATATTGATCCTGGG + Intergenic
1038983665 8:32785948-32785970 GGATGGAAAATAATGGTACTAGG + Intergenic
1043621529 8:82198552-82198574 TGAAGCAGAAAATTGGTACTGGG - Intergenic
1043913674 8:85894989-85895011 GCATTTACAACAATGGTACTAGG + Intergenic
1044797730 8:95921293-95921315 GGATGAAAAAAAAAGTTACTGGG + Intergenic
1046313597 8:112471293-112471315 AGATGCAAAAAAATGTTACATGG - Intronic
1047235769 8:123040934-123040956 GGATGCACAAATCTGGAAATAGG + Intronic
1049886936 9:33986-34008 GCATACACAAAAATGGTAAAAGG + Intergenic
1049985274 9:944738-944760 GGGTGCACAAATATAGTATTTGG - Intronic
1051949053 9:22608565-22608587 TGATGTATAAAAGTGGTACTGGG + Intergenic
1055147189 9:72950110-72950132 GGATTCAGAAAAATAGGACTAGG + Intronic
1055891316 9:81127012-81127034 GTCTCCACAAAAATGGAACTGGG - Intergenic
1057350585 9:94293736-94293758 TGATGCACAAAAAAGCTACCAGG - Intronic
1195133604 X:101879860-101879882 AGATGCTCAAAAATGGTTTTTGG + Intergenic
1198690921 X:139283500-139283522 TTATGCACAAAAATATTACTGGG + Intergenic