ID: 1095444391

View in Genome Browser
Species Human (GRCh38)
Location 12:42269756-42269778
Sequence TTCACTGTGTTCTCACATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1215
Summary {0: 1, 1: 7, 2: 60, 3: 287, 4: 860}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095444391_1095444393 -2 Left 1095444391 12:42269756-42269778 CCACTATGTGAGAACACAGTGAA 0: 1
1: 7
2: 60
3: 287
4: 860
Right 1095444393 12:42269777-42269799 AAAAGGTGCCATCTGCAAACCGG 0: 1
1: 0
2: 1
3: 54
4: 682
1095444391_1095444395 6 Left 1095444391 12:42269756-42269778 CCACTATGTGAGAACACAGTGAA 0: 1
1: 7
2: 60
3: 287
4: 860
Right 1095444395 12:42269785-42269807 CCATCTGCAAACCGGAAAGCAGG 0: 1
1: 0
2: 35
3: 132
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095444391 Original CRISPR TTCACTGTGTTCTCACATAG TGG (reversed) Intronic
900720924 1:4175250-4175272 CTCATTGTGTCCTCACATGGTGG - Intergenic
900765405 1:4501618-4501640 CTCACTGTGTTTTCCCATGGTGG + Intergenic
900874170 1:5329792-5329814 CTCACTGTATCCTCACATGGTGG + Intergenic
901184536 1:7364394-7364416 TTCTATGTGTCCTCACATGGTGG + Intronic
901359830 1:8687776-8687798 TTTACTGTGGTCTGACATAAGGG - Intronic
901376275 1:8841844-8841866 TTCTATGTGTCCTCACATGGTGG - Intergenic
901558765 1:10052935-10052957 CTCACTGTGTCCTCACTTGGAGG + Intronic
902899752 1:19506774-19506796 CTCACTGTGTCCCCACATGGTGG + Intergenic
903528750 1:24013333-24013355 CTCACTGTGTCCTCACATGTTGG - Intergenic
904869878 1:33610009-33610031 CTCACTGCGTCCTCACATGGTGG - Intronic
905757000 1:40518804-40518826 CTCACTGTGTCCTCACATGATGG - Intergenic
906679564 1:47716522-47716544 TTCCCTTTGTTCTCTCACAGGGG - Intergenic
907201326 1:52729146-52729168 TTCACTGTTTTCACACATGGTGG + Intronic
907329493 1:53661833-53661855 TTCACTGAGTTCTCATCTGGTGG - Intronic
907599587 1:55753877-55753899 CTCACTGTGTCCTCACATGGTGG - Intergenic
907627188 1:56041734-56041756 TTTTATGTGTTCTCACATAGTGG + Intergenic
907773575 1:57490039-57490061 CTTGCTGTGTTCTCACATGGTGG - Intronic
907778720 1:57544535-57544557 CACACTCTGTTCCCACATAGCGG + Intronic
908089598 1:60671823-60671845 TTCGCTGTGTCTTCACATGGTGG - Intergenic
908211506 1:61905247-61905269 CTCTCTGTGTCCTCACATAGTGG + Intronic
908267362 1:62392589-62392611 TTCACTGTGTCCTCAAATGGTGG - Intergenic
908900544 1:68951386-68951408 CTCACTGTATCCTCACATTGTGG - Intergenic
908971510 1:69839715-69839737 TTCCCTCTGTTCTCAAATAATGG + Intronic
909167688 1:72249183-72249205 CTAGCTGTGTTCTCACATGGTGG - Intronic
909198328 1:72655780-72655802 CTTGCTGTGTTCTCACATGGTGG - Intergenic
909354892 1:74697123-74697145 CTCATTGTGTCCTCACATGGTGG - Intergenic
909552001 1:76908321-76908343 CTCACTATGTCCTCACATAGTGG + Intronic
909757317 1:79242643-79242665 TTCACTGTGCCTTCACATGGTGG - Intergenic
909802878 1:79835279-79835301 CATACTGTGTTCTCACATGGTGG + Intergenic
909870198 1:80729336-80729358 CTAGCTGTGTTCTCACATAGTGG + Intergenic
910041388 1:82855863-82855885 CTCACTGTATTCCCACATGGTGG - Intergenic
910846020 1:91605432-91605454 TTCTATGTTTCCTCACATAGTGG - Intergenic
910984209 1:92989827-92989849 AACACTGTGTCCTCACATAGAGG + Intergenic
911154573 1:94625521-94625543 CTCGCTGTGTCCTCACAGAGTGG + Intergenic
911709994 1:101060762-101060784 CTCACTGTGTCCTTACATAGTGG + Intergenic
911834103 1:102594089-102594111 CTCACTGTGTTCTCAAATGATGG - Intergenic
911929747 1:103886845-103886867 TTCACTGTGTTCTGAGAGTGTGG - Intergenic
912165146 1:107034683-107034705 CTCAATGTGTTCTTACATAGTGG + Intergenic
912269707 1:108196717-108196739 CTCACTGTGTCCTCACATGGTGG + Intronic
912720890 1:112019018-112019040 TTTGCTGTGTCCTCACATGGTGG - Intergenic
912941207 1:114046745-114046767 CTCACTGTGTCCTTGCATAGTGG - Intergenic
913138824 1:115919596-115919618 CTTGCTGTGTCCTCACATAGTGG + Intergenic
913162922 1:116161672-116161694 GTTACTGTGTCCTCACATGGTGG - Intergenic
913173109 1:116249967-116249989 CTCACTGTGTCCTCACATGGCGG - Intergenic
913415585 1:118602978-118603000 TTTACTATGTCCTCACATGGTGG - Intergenic
914077491 1:144369062-144369084 TTTGCTGTGTCCTCACATGGAGG + Intergenic
914101688 1:144597443-144597465 TTTGCTGTGTCCTCACATGGAGG - Intergenic
914172398 1:145237602-145237624 TTTGCTGTGTCCTCACATGGTGG + Intergenic
914297276 1:146340068-146340090 TTTGCTGTGTCCTCACATGGTGG + Intergenic
914527043 1:148478605-148478627 TTTGCTGTGTCCTCACATGGTGG + Intergenic
914639355 1:149588530-149588552 TTTGCTGTGTCCTCACATGGTGG - Intergenic
915083893 1:153371322-153371344 AGCACTGTGTCCTCACATGGTGG + Intergenic
915647523 1:157284356-157284378 AACACTGTGTCCTCACATGGTGG + Intergenic
915647573 1:157284663-157284685 AACACTGTGTCCTCACATGGTGG + Intergenic
915647579 1:157284694-157284716 AACACTGTATTCTCACATGGTGG + Intergenic
915663138 1:157420193-157420215 AACACTGTGTCCTCACATGGTGG - Intergenic
916118615 1:161509127-161509149 CTTACTGTGTCCTCACATGGCGG - Intronic
916232131 1:162550874-162550896 TTCACTGCATTCTCACCTGGAGG + Intergenic
916269032 1:162920055-162920077 CTCACTGTTTTCTCACAGTGCGG + Intergenic
916396740 1:164398562-164398584 TTTGCTGTATTTTCACATAGTGG - Intergenic
916406892 1:164506761-164506783 CTCATTGTGTTCTCACATGGCGG - Intergenic
916513072 1:165490435-165490457 GTCACTGTGTTCTCACAGCCAGG + Intergenic
916717293 1:167456055-167456077 GTCTCTCCGTTCTCACATAGGGG + Intronic
917354430 1:174111504-174111526 AACACTGTGTCCTCACATGGTGG - Intergenic
917403663 1:174680358-174680380 TTCATTGTCTCCTCACATAGTGG - Intronic
917509712 1:175660072-175660094 GTCACTGTATTCTCCCATAGAGG - Intronic
917685954 1:177416272-177416294 CTCACTGTGTCCTCACATGGTGG - Intergenic
918095142 1:181328229-181328251 CTCGCTGTGTCCTCACATGGTGG + Intergenic
918281449 1:183010306-183010328 TTTACTGTGTCCTCACATGGTGG + Intergenic
918520409 1:185408652-185408674 TTCAATTTGTTCCCTCATAGTGG + Intergenic
918746006 1:188200671-188200693 TTCTATGTGTCCTCACATGGTGG - Intergenic
918775220 1:188620188-188620210 TTCCATGTGTTTTCACATAGTGG - Intergenic
918819041 1:189226768-189226790 ATTACTGTGTACTCACATGGTGG - Intergenic
919001555 1:191838284-191838306 CTCACTGTGTCTTCACATGGTGG - Intergenic
919461851 1:197885987-197886009 TTCTATGTGTCCTCACATGGTGG + Intergenic
919687718 1:200499645-200499667 CTCAGTGTGTTGTCACATGGTGG - Intergenic
920157239 1:203963885-203963907 TGCACTGTGTTCTCTCAAAGAGG - Intergenic
920717343 1:208352809-208352831 CTCTCTGTGTTCTCACATGGAGG + Intergenic
922360121 1:224813477-224813499 TTTGCTGTGTCCTCACATGGTGG - Intergenic
922689323 1:227675246-227675268 CTCACTGTGTTCTCACAGGATGG - Intronic
922821794 1:228489729-228489751 CTCACTGTGTCCTCACATGGTGG + Intronic
922824637 1:228509132-228509154 CTCACTGTGTCCTCACATGGTGG - Intergenic
922969423 1:229722804-229722826 CTCCCTGTGTCCTCACATAGTGG - Intergenic
923257735 1:232235576-232235598 TTCTCTGTGTCCTCATATGGTGG + Intergenic
923394973 1:233552794-233552816 CTCGCTGTGTCCTCACATGGTGG - Intergenic
923411437 1:233713783-233713805 CTCACTGTGTCATCACATGGTGG - Intergenic
923476884 1:234342322-234342344 ATCACTGTGTCCTCACATGGTGG - Intergenic
923625812 1:235612946-235612968 CTCACTGTGTCCTCACATGAGGG + Intronic
923899716 1:238312390-238312412 CTCGCTGTGTCCTCACATGGTGG + Intergenic
923961371 1:239088042-239088064 CTCACTGAGTTCTCACATGGGGG + Intergenic
923965005 1:239127634-239127656 CTCACTGTGTCCTCACAGAGTGG - Intergenic
924047538 1:240047278-240047300 CTCACTGTGTCTTCACATGGTGG - Intronic
924122909 1:240820662-240820684 CTCGCTGTGTCCTCACATCGTGG - Intronic
924330462 1:242935975-242935997 CTCTCTGTGTCCTCACATGGTGG - Intergenic
924798934 1:247313073-247313095 TTCATTGTGTTCTCACATGGTGG + Intronic
1062988744 10:1795340-1795362 CTCACTGTGTCCTCACATGGTGG - Intergenic
1063089053 10:2845408-2845430 CTCACTGTGTCCTCACATGGCGG + Intergenic
1063089619 10:2850752-2850774 CTCACTGTGTCCTCACATGGTGG + Intergenic
1063133619 10:3198484-3198506 CTCACTGTATCCTCACATGGGGG + Intergenic
1063168787 10:3487273-3487295 CTCACTGTGTCCTCACATGGTGG - Intergenic
1063175008 10:3543465-3543487 CTCACTGTGTCCTCACATGGAGG - Intergenic
1063210852 10:3880052-3880074 CTCACGGTGTCCTCACATAGTGG + Intergenic
1063266307 10:4454777-4454799 ATTACTGTGCCCTCACATAGTGG - Intergenic
1063586230 10:7355472-7355494 TTCACACTGTTCTCACATATGGG - Intronic
1063874245 10:10455658-10455680 TTCTCTGCGTTCTCACAGAGAGG - Intergenic
1064131305 10:12712560-12712582 CTCACTGTGTTCTCACATGGTGG + Intronic
1064796737 10:19020521-19020543 TTTGCTGTGTCCTCACATGGTGG + Intergenic
1065008545 10:21401734-21401756 CTCACTGTGTCCTCACATAGGGG + Intergenic
1065333282 10:24626465-24626487 TTCACTGTGTCTTCACTTGGTGG - Intronic
1065350949 10:24795228-24795250 GCCACTGTGTTCTCACACGGTGG - Intergenic
1065662976 10:28025453-28025475 CTCACTGTGTCCTCACATGGTGG + Intergenic
1065737369 10:28766354-28766376 TTTGCTTTGTCCTCACATAGTGG + Intergenic
1065801209 10:29354393-29354415 TTCAATGTGTCCTCACACAAAGG - Intergenic
1065834357 10:29643453-29643475 GTCTCTGTCTTCTCCCATAGAGG - Intronic
1065941875 10:30572251-30572273 CTCACTGTGTCTTCACATGGTGG - Intergenic
1065993859 10:31037968-31037990 CTCACTGTGTCCTCACATTGTGG - Intergenic
1066034451 10:31467734-31467756 TTCCCTGTGTTCTGACAGTGGGG - Intronic
1066262521 10:33743174-33743196 TCCACTGAGTTCTTTCATAGAGG + Intergenic
1066539387 10:36428886-36428908 TTCCATGTGTCCTCACATGGTGG - Intergenic
1066645994 10:37609687-37609709 TTCCATGTGTCCTCACATGGTGG - Intergenic
1067364541 10:45612895-45612917 TTCAATGTGTACACACAAAGTGG - Intergenic
1067534733 10:47100669-47100691 TTCTATGTGTCCTCACATGGTGG - Intergenic
1067549783 10:47226229-47226251 CTCACTGTGTCCTCACATGTGGG + Intergenic
1067940679 10:50652711-50652733 CTCACTGTGTTCTCAAAGGGTGG - Intergenic
1068661212 10:59625228-59625250 TACCGTGTGTTCTCACATATGGG + Intergenic
1069164785 10:65140452-65140474 CTCACTGTGTCCTCACATGGCGG + Intergenic
1069211529 10:65767258-65767280 CCAACTGTGTCCTCACATAGCGG - Intergenic
1069225098 10:65933319-65933341 TTTACTGTTTTCTCACAAATTGG + Intronic
1070052024 10:72898747-72898769 TTCACATGGTTGTCACATAGAGG - Exonic
1070578921 10:77704079-77704101 CTGGCTGTGTCCTCACATAGTGG - Intergenic
1070963392 10:80514915-80514937 CTCACTGTGTCTTCACACAGTGG - Intronic
1071860237 10:89664838-89664860 CTCCCTGTGTCCTCACATGGTGG - Intergenic
1071919957 10:90338458-90338480 CTCACTGTGTACTCACATGTTGG + Intergenic
1072000428 10:91190162-91190184 ATCCCTGTGACCTCACATAGTGG + Intronic
1072028081 10:91484898-91484920 TTCTGTGTGTTCTCTCTTAGGGG - Intronic
1072458988 10:95602528-95602550 CTCACTGTGTCCTCACATGAAGG + Intergenic
1072642374 10:97221616-97221638 TTCACTGTAACCTCACATGGTGG - Intronic
1072897572 10:99379971-99379993 CTCATTGTATTCTCACATGGTGG + Intronic
1074079702 10:110157786-110157808 TTCGCTCTGTCCTCACATGGTGG + Intergenic
1074682302 10:115919828-115919850 CTCACTGTGTTCTCACGTGGTGG + Intronic
1074983266 10:118636420-118636442 CTCTCTGTGTCCTCACATAGTGG + Intergenic
1075002281 10:118807703-118807725 GTCACTGTGTCCTCACATGAGGG - Intergenic
1075222332 10:120596063-120596085 TTTACTGTGTCCTCACATGGTGG + Intergenic
1076079943 10:127570235-127570257 TACACTGTGTTCACACAGAAGGG - Intergenic
1076087205 10:127644151-127644173 AACACTGTGTCCTCACATGGTGG - Intergenic
1077475050 11:2782803-2782825 TTCACTGTTTTCCCCCTTAGTGG + Intronic
1077977505 11:7263306-7263328 CTCTCTGTGTCCTCACATGGTGG + Intronic
1078417131 11:11175005-11175027 ACCACTGTGTTTTCAAATAGTGG - Intergenic
1078499016 11:11850880-11850902 CTCGCTGTGTCCTCACATGGTGG + Intronic
1078534762 11:12163916-12163938 TGCACTGTGTTCTCTCACAGAGG + Intronic
1079403727 11:20127258-20127280 TGCTCTGTGTCCTCACACAGTGG - Intergenic
1079519118 11:21303910-21303932 ATCACTGCGTCCTCACATGGTGG + Intronic
1079916927 11:26380524-26380546 TTCTTTATGTTCTCACATGGTGG + Intronic
1080195488 11:29603635-29603657 ATCTCTGTGTCCTCACATGGTGG - Intergenic
1080294089 11:30705270-30705292 CTCGCTGTGTCCTCACATGGTGG + Intergenic
1080359952 11:31501445-31501467 CTTGCTGTGTTATCACATAGTGG - Intronic
1080708593 11:34723235-34723257 TTGTCTGTGTTCTCACATACTGG - Intergenic
1080878050 11:36294660-36294682 CTCACTGTGTCCTCAAATGGTGG + Intergenic
1081238239 11:40672222-40672244 CTCACTGTGTCCTCTCATGGTGG + Intronic
1081387531 11:42489691-42489713 TTTGCTGTGTTCTAAGATAGGGG - Intergenic
1081426476 11:42931550-42931572 CTCACTGTGTCCTTACATGGTGG - Intergenic
1081953483 11:47067609-47067631 CTCACTGTGTCCTCACGTGGAGG - Intronic
1082943148 11:58729125-58729147 TCCACTGTGGTCTTACATGGTGG - Intronic
1085074571 11:73579049-73579071 CTCACTGTATCCTCACATAGTGG + Intronic
1085923938 11:80991838-80991860 TTCTCTGTGTCCTCATATGGTGG + Intergenic
1086219774 11:84428556-84428578 TTCTCTGTGTCCTCACACAGTGG + Intronic
1086536512 11:87853389-87853411 CTCACTGTGTTCTCCCATGGTGG - Intergenic
1086744732 11:90410838-90410860 TTGTCTGTGTTTTCACATGGTGG + Intergenic
1086776590 11:90842760-90842782 CTCACTGTGTCCTCACATGGAGG - Intergenic
1086859969 11:91914667-91914689 TTCACTCTGTTGTCATATGGTGG + Intergenic
1087123761 11:94601973-94601995 TTCAATGTATTCTCACATTTTGG - Exonic
1087137582 11:94736221-94736243 TTCATTTTCTTCCCACATAGAGG - Intronic
1087678450 11:101189947-101189969 TTTACTGTGTCCTCACATGGTGG - Intergenic
1087723363 11:101691818-101691840 CTCACTGTGTTCTCACATTGTGG - Intronic
1087947813 11:104185457-104185479 CTCACTGTGTCCTCACATAGTGG - Intergenic
1087970787 11:104479907-104479929 CTCACTGTGTCCTCACTTGGTGG - Intergenic
1088427736 11:109723437-109723459 TTTTCTGTGTCCTCACATAGTGG + Intergenic
1088657315 11:112013138-112013160 GTCTCTGTGTCCTCACATGGGGG + Intronic
1088799307 11:113290758-113290780 CTCACTGTGTCCTCACATGGTGG - Intergenic
1088823943 11:113477989-113478011 CTCACTGTGTTCACACATGGTGG + Intergenic
1089731090 11:120519429-120519451 CTCACTGTGTGCTCACACGGTGG - Intronic
1089998435 11:122930996-122931018 CTCACTGTGTCCTCACACAATGG + Intronic
1090261193 11:125321900-125321922 TTCTATGTGTCCTCACACAGGGG + Intronic
1090302935 11:125662273-125662295 TTTACTGTGTCCCCACATAGTGG + Intronic
1090405200 11:126472397-126472419 CTCACTGTGTCCTCACAATGTGG + Intronic
1090687150 11:129134827-129134849 TTTTATGTGTTCTCACATGGTGG - Intronic
1090882948 11:130850212-130850234 CTCACTGTGTCCTCACATGGTGG - Intergenic
1090912387 11:131132773-131132795 CTCGCTGTGTCCTCACATGGTGG + Intergenic
1090918558 11:131188093-131188115 CTCACTGTGTCCTCACATGGTGG + Intergenic
1091009701 11:131988104-131988126 CTTGCTGTGTCCTCACATAGTGG + Intronic
1091022088 11:132109366-132109388 CTCGCTGTGTCCTCACATGGTGG - Intronic
1091637162 12:2205867-2205889 CTCACTGTGTCCTCATATAGTGG + Intronic
1091991480 12:4959591-4959613 TCCACTGTGTCCTCCCATGGAGG + Intergenic
1093051818 12:14512842-14512864 CTCTCTGTGACCTCACATAGTGG - Intronic
1093207585 12:16269019-16269041 CTCACTGTGTCTTCACATAGTGG - Intronic
1093378569 12:18461703-18461725 TTAGCTGTGGCCTCACATAGTGG - Intronic
1093523958 12:20085055-20085077 CACACTGTATTCTCACATGGAGG + Intergenic
1093909292 12:24727301-24727323 CTCACTGTGTCCTCACATGGTGG - Intergenic
1094214761 12:27929073-27929095 CTCACTGTGTCCTCACATGGTGG + Intergenic
1094342384 12:29427536-29427558 CTCACTGGGTCCTCACATGGAGG - Intronic
1094478558 12:30861650-30861672 CTAACTGTGTTCTCACATGGCGG + Intergenic
1094722873 12:33083207-33083229 TTCACTGTATCCTCACTTGGAGG - Intergenic
1094770238 12:33649442-33649464 TTCTGTGTGTCCTCACATGGTGG - Intergenic
1095251635 12:39986037-39986059 ATCACTGTGTCCTCACATGACGG + Intronic
1095354648 12:41257302-41257324 TTCATTGTTTCCTCACATGGTGG + Intronic
1095444391 12:42269756-42269778 TTCACTGTGTTCTCACATAGTGG - Intronic
1095547508 12:43388904-43388926 CTCACTGTGTTCTCATATGGAGG + Intronic
1095570157 12:43675358-43675380 TTCTCTGTGTTCTGACAGTGGGG - Intergenic
1095671521 12:44866106-44866128 TTCTTTGTGTCTTCACATAGTGG - Intronic
1096005314 12:48165790-48165812 CTCACTGTGTCCTCATATGGTGG - Intronic
1096038178 12:48491279-48491301 TTCACTGTGTCCTCACATGGAGG + Intronic
1096384546 12:51186383-51186405 TTCACTGTAACCTCACATGGTGG - Intergenic
1096671301 12:53199697-53199719 CTCGCTGTGTCCTCACATAGTGG - Intronic
1097314751 12:58159968-58159990 TTCACACTGTTCTCAGCTAGTGG - Intergenic
1097477441 12:60075530-60075552 TTCTCTGTATTCTATCATAGTGG - Intergenic
1097533605 12:60837408-60837430 CTCTTTGTGTTCTCACATGGTGG - Intergenic
1097644866 12:62224439-62224461 CTCACTGTGTCCTTACATGGTGG + Intronic
1097833026 12:64245539-64245561 CTCACTGTGTCTTCATATAGTGG - Intergenic
1097901734 12:64880488-64880510 CTCACTGTGTCCTCACACAATGG + Intronic
1098235525 12:68414551-68414573 CTCTCTGTGGTCTCACATGGTGG - Intergenic
1098369996 12:69748431-69748453 TTAACTATGTTGTCAGATAGTGG - Intronic
1098484436 12:71004402-71004424 TACGCTGTGTCCTCAAATAGCGG - Intergenic
1098660795 12:73091111-73091133 CTCACTGTGTCCTTACATGGCGG + Intergenic
1098709645 12:73739312-73739334 CTCATTGTGTTCTCACATGAGGG - Intergenic
1098718339 12:73861066-73861088 TTCTCTTTGTTCTCACATAGTGG - Intergenic
1098854196 12:75633617-75633639 CTCACTGTGTCCTCACATGGTGG - Intergenic
1099115484 12:78619231-78619253 TTCACTGTGTACTCACATAGTGG + Intergenic
1099387222 12:82029246-82029268 TTCACTGTAAGCTCACATGGTGG - Intergenic
1099506932 12:83489679-83489701 TTCATTGTATCCTCACATGGAGG + Intergenic
1099673861 12:85731614-85731636 CTCTCTGTGTCCTCACATGGTGG + Intergenic
1099838996 12:87942536-87942558 TTAACTGTCTCCTCACATGGTGG - Intergenic
1099925221 12:89008876-89008898 CTCACTGTGTCCTCACATGGTGG + Intergenic
1100116794 12:91315542-91315564 ATTGCTGTGTCCTCACATAGTGG + Intergenic
1100119569 12:91353189-91353211 CTCACTGTGTTCTCAGATGGTGG + Intergenic
1100121310 12:91372544-91372566 TTCATTGTGTCCCCACATGGTGG + Intergenic
1100223736 12:92535246-92535268 CTCTCTGTGTCCTCACATGGTGG + Intergenic
1100428181 12:94507037-94507059 TTCCCTGTCTTCTCACAAGGAGG + Intergenic
1100600084 12:96105351-96105373 CTCCCTGTGTCCTCACATAATGG - Intergenic
1100913084 12:99387649-99387671 TTCTCTGTGTTCTCACACAGTGG - Intronic
1101400715 12:104384337-104384359 CTCACTGTGTCCTCACGTGGTGG - Intergenic
1101734570 12:107453459-107453481 CTTTCTGTGTTCTCACATGGTGG - Intronic
1101786839 12:107891642-107891664 CTCTTTGTGTCCTCACATAGGGG - Intergenic
1102414326 12:112747315-112747337 TTCACTGTGTCCTCACATGGTGG - Intronic
1102812906 12:115839785-115839807 CTCACTGTGTCCTCACGTGGTGG + Intergenic
1103093321 12:118113117-118113139 TTCACTGTATCTTCACATGGTGG - Intronic
1103448335 12:121009598-121009620 CCTACTGTGTCCTCACATAGTGG - Intronic
1104128779 12:125872803-125872825 CTCGCTGTGTCCTCACATGGTGG - Intergenic
1104128955 12:125874277-125874299 CGCACTGTGTCCTCACATGGTGG + Intergenic
1104236361 12:126941748-126941770 CTTACTGTGTCCTCACATGGTGG + Intergenic
1105810331 13:23989870-23989892 CTCACTGCATCCTCACATAGTGG - Intronic
1106195667 13:27491996-27492018 AACACTGTGTCCTCACACAGTGG - Intergenic
1106484225 13:30158446-30158468 TTCCATGTGTCCTCACATGGTGG + Intergenic
1106551132 13:30772047-30772069 CTCGCTGTGTTCTCACATGGTGG - Intergenic
1106643131 13:31607002-31607024 TTTACTGTATCCTCACATGGGGG - Intergenic
1106732195 13:32552825-32552847 TTAGCTGTGTCCTCACATGGTGG - Intergenic
1106820279 13:33456743-33456765 GTCCCTGTATTCCCACATAGTGG - Intergenic
1107065388 13:36209513-36209535 TTATTTGTGTTCTCACATGGTGG + Intronic
1107600129 13:42004621-42004643 TCCACTGTGTCCTCACATGGTGG - Intergenic
1107634101 13:42374594-42374616 AGCACTGTGTCCTCACATGGAGG + Intergenic
1107948822 13:45443939-45443961 AACACTGTGTCCTCACATGGTGG - Intergenic
1107999504 13:45893465-45893487 TTCGATGTGTCCTCACATGGTGG + Intergenic
1108254177 13:48594657-48594679 CTCACTGTGCCCTCACATGGAGG - Intergenic
1108334728 13:49427879-49427901 TTCGCTGTATCCTCACATAGTGG + Intronic
1108374181 13:49797946-49797968 AACACTGTGTCCTCACATGGTGG - Intergenic
1108432430 13:50367665-50367687 CTGACTGTGTCCTCACATAGGGG + Intronic
1108677602 13:52750690-52750712 CTCACTGTGTCCTCACATGGTGG - Intergenic
1108829690 13:54462214-54462236 TTCTCTTTCTTCTCACCTAGGGG - Intergenic
1108931739 13:55832653-55832675 TTCCTTGTGTTTTCACATGGTGG - Intergenic
1109117480 13:58406956-58406978 CTCATTGTGTCCTCACATAGTGG - Intergenic
1109478093 13:62911502-62911524 TTAACTGTGTCCTCACATGGTGG + Intergenic
1109502639 13:63257236-63257258 TTCACTGTGTCCCCACATGTTGG + Intergenic
1109517852 13:63467559-63467581 CTAGCTGTGTTCTCACATAGTGG + Intergenic
1109650174 13:65313977-65313999 TTCTCTGTGTTCTAACACAGGGG - Intergenic
1109926534 13:69148426-69148448 CTCGCTGTGTTCTCACATGGTGG + Intergenic
1110262529 13:73501440-73501462 CTCACTGTGTCCTCACAAGGTGG - Intergenic
1110479702 13:75960129-75960151 GTCCCTGGATTCTCACATAGAGG - Intergenic
1110559524 13:76896021-76896043 CTCTCTATGTCCTCACATAGTGG + Intergenic
1110970615 13:81756741-81756763 CTCACTGAGTTCTCACATGGTGG - Intergenic
1111045740 13:82811478-82811500 TGCTCTGTGTTCTCAGAAAGAGG + Intergenic
1111513675 13:89298762-89298784 AATACTGTGATCTCACATAGCGG - Intergenic
1111588283 13:90310175-90310197 TTCACTGTGTCCGCACATGGTGG - Intergenic
1111802498 13:92997684-92997706 TTCACTGTGTCCTCACATGGTGG + Intergenic
1111883485 13:93988597-93988619 TTTTCTGTGTTCTCATATGGCGG + Intronic
1111969769 13:94899937-94899959 GTTGCTGTGTTTTCACATAGTGG + Intergenic
1112187101 13:97137998-97138020 TTCTCTGTGTCCTCATATATGGG + Intergenic
1112574888 13:100626993-100627015 CTCACTGTGTCCTCACGTGGCGG - Intronic
1112669305 13:101615858-101615880 CTCACTGTGTCCTCACATGGTGG - Intronic
1112821193 13:103338201-103338223 CTCACTGTGTGCTCACACGGTGG + Intergenic
1112841504 13:103584883-103584905 TTCACTGTGTGCTCACAGAGTGG + Intergenic
1112977089 13:105333730-105333752 CTCACTGTGTTCTCACAGAGTGG + Intergenic
1113284455 13:108831028-108831050 TTCACAGTGTCCTCACATGGTGG + Intronic
1113479934 13:110613342-110613364 TTCACTCTGTTATCAGAAAGGGG + Intergenic
1113539018 13:111092412-111092434 CTCACTGTGTCCTCACAGAGGGG - Intergenic
1113601961 13:111575836-111575858 TTCACTGTGTCCTCATATGGGGG + Intergenic
1114247571 14:20928830-20928852 ACCACTGTGTCCTCAGATAGTGG + Intergenic
1114899021 14:27033008-27033030 CTCACTGTGTCCTCACATGTTGG - Intergenic
1115146723 14:30235373-30235395 TTCACTGTTGTCCCATATAGTGG - Intergenic
1115588030 14:34834898-34834920 TCCACTGTGTTCTCAAATAATGG - Intronic
1115863650 14:37717976-37717998 CTTACTGTGTCCTCACATGGTGG - Intronic
1115895435 14:38081330-38081352 TTCTCTGTGTCCTCTCACAGTGG + Intergenic
1116254860 14:42539331-42539353 CTCACTGTGTCTTCACATATTGG + Intergenic
1116338925 14:43697039-43697061 TTCTCTGTGTCCTCATATGGTGG - Intergenic
1116710083 14:48357296-48357318 TTTGCTGTGTTCTCACATGGTGG + Intergenic
1117087600 14:52217895-52217917 AACACTGTGTCCTCACATGGTGG + Intergenic
1117157702 14:52957188-52957210 CTCGCTGTGTCCTCACATGGTGG - Intergenic
1117173815 14:53128436-53128458 CTCACTGTGCCCTCACATGGTGG + Intronic
1117180398 14:53185492-53185514 CTTGCTGTGTACTCACATAGTGG + Intergenic
1117581097 14:57152579-57152601 TGAAATGTGTTCTAACATAGGGG + Intergenic
1117833917 14:59782079-59782101 TTCACTGCATCCTCACATTGTGG - Intronic
1118068286 14:62216426-62216448 TTCACTGCGTCTTCACATGGTGG - Intergenic
1118125347 14:62896289-62896311 TTCACTGTGTTAACATATATAGG - Intronic
1118367949 14:65111454-65111476 CTCACTGCATCCTCACATAGTGG - Intergenic
1118386713 14:65261781-65261803 CTCACTGTGTCCTCACATTGTGG + Intergenic
1118979442 14:70704365-70704387 CTCTCTGCGTCCTCACATAGTGG - Intergenic
1119502277 14:75140037-75140059 CTCACTGTGTTCTCACATGGAGG - Intronic
1119552720 14:75526761-75526783 TTCACTGTGTCCCCACATTCTGG + Intronic
1119685877 14:76630792-76630814 CTCGCTGTGTTCTCACATGATGG - Intergenic
1120322618 14:82984361-82984383 CTCACTGTGTCCTTACATGGTGG + Intergenic
1120353393 14:83394066-83394088 TTTACTGTGTCCTCACATGTTGG + Intergenic
1120484036 14:85087598-85087620 CTCACTGTGTTCTCGCTTAGTGG + Intergenic
1120585645 14:86308785-86308807 CTCATTGTGTCCTCACATGGTGG - Intergenic
1120614821 14:86690276-86690298 CTCACTGTGTCCTCACATAGAGG - Intergenic
1121303551 14:92890524-92890546 CTCACAGTGTCCTCACATGGTGG - Intergenic
1121427305 14:93861629-93861651 GACACTGTGTTCTCACATGGTGG - Intergenic
1121806716 14:96833060-96833082 TGCACTGTGTTCTATCATATCGG + Intronic
1121841020 14:97133902-97133924 CTTGCTGTGTTCTCACATGGTGG + Intergenic
1121844634 14:97162021-97162043 CTCACTGTGTCCTCACATGGCGG + Intergenic
1121886547 14:97548234-97548256 TTCTGTGTGTCCTCACATGGTGG + Intergenic
1122045875 14:99022985-99023007 CTCATTGTGTCCTCACATGGTGG - Intergenic
1122368719 14:101215197-101215219 CTTGCTGTGTTCTCACATGGTGG - Intergenic
1122495841 14:102154361-102154383 CTCACTGTGTCCTCACATGGTGG + Intronic
1122622046 14:103064479-103064501 TTCAATGTCTTCTCACTTAGTGG - Intergenic
1122833500 14:104417751-104417773 TTCTCTGTGTCCTCACTTGGTGG - Intergenic
1122913652 14:104845786-104845808 CTCACTGTGTCCTCACATGGTGG - Intergenic
1123060724 14:105593050-105593072 TTCGCTGCGTCCTCACATGGTGG + Intergenic
1123085197 14:105714027-105714049 TTCACTGCGTCCTCACGTGGTGG + Intergenic
1123775169 15:23572534-23572556 TTCTTAGTGTCCTCACATAGTGG + Intronic
1123779634 15:23613632-23613654 TACGCTGTGTCCTCACATGGAGG - Intronic
1123985847 15:25645207-25645229 CTCACTGGGTCCTCACATAGGGG - Intergenic
1124193099 15:27597596-27597618 CTCACTGTGTCCTCACACAGTGG + Intergenic
1124347669 15:28933337-28933359 CTCACTCTGTCCTCACATGGTGG - Intronic
1124395955 15:29301837-29301859 CTCGCTGTGTCCTCACATGGTGG - Intronic
1124599334 15:31118730-31118752 CTCATTGTATCCTCACATAGTGG + Intronic
1124706753 15:31973001-31973023 CTCCCTGTGTCCTCACATACTGG + Intergenic
1124719209 15:32097457-32097479 TTCACTGTGTCCTCGCATGGTGG - Intronic
1124888960 15:33713799-33713821 CTCACTTTGTTCTCACATGGTGG + Intronic
1126369869 15:47934234-47934256 AACACTGTGTCCTCACATGGCGG + Intergenic
1126541164 15:49825578-49825600 CTCACTGTGTTCTCACATGGTGG - Intergenic
1127590418 15:60416626-60416648 CTTACTGTGTCCTCACATGGTGG + Intergenic
1127726310 15:61753500-61753522 CTCACTGTGTTCTCACAATGGGG + Intergenic
1128145571 15:65330761-65330783 TCCACTGGGTCCTCACATCGTGG - Intronic
1128301625 15:66569752-66569774 AACACTGTGTCCTCACATGGGGG - Intergenic
1128405468 15:67333047-67333069 TTCTCTGTGTCCTCACATGGTGG + Intronic
1128696477 15:69767704-69767726 CTCCCTGTGTTCTCACATGATGG + Intergenic
1128877108 15:71211410-71211432 CTCCCTGTGTTCTCATATGGTGG + Intronic
1129049457 15:72767840-72767862 TTTCCTGTTTTCTCATATAGGGG - Intronic
1130757378 15:86779212-86779234 CTCCCTGTGTCCTCACATGGTGG - Intronic
1130949811 15:88576901-88576923 CTCACTGTGTCCTCATATGGTGG - Intergenic
1131610650 15:93957996-93958018 CCCACTGTGTTTTCACATGGTGG + Intergenic
1131642275 15:94305235-94305257 CTCACTGTGTCCTCACATGGTGG - Intronic
1131902088 15:97099015-97099037 CTCATTGTATCCTCACATAGGGG - Intergenic
1132025258 15:98399652-98399674 CTTACTGTGTGCTCACATGGAGG - Intergenic
1132075686 15:98818019-98818041 CTCACTGTATCCTCATATAGTGG + Intronic
1132115909 15:99136520-99136542 CTCACTGTGTCCTCACATGGTGG + Exonic
1132119409 15:99163770-99163792 TTCACTGTGTCCTCACAGGGTGG - Intronic
1132129362 15:99261502-99261524 TTTGCTGTATTCTCACATGGTGG + Intronic
1133397145 16:5457094-5457116 CTCACTGTGTCCTCACATGGTGG + Intergenic
1133707622 16:8370187-8370209 TTCACTGTGCCCTCACATGGTGG + Intergenic
1135260540 16:20976779-20976801 TTTGCTGTGTCCTCACACAGTGG - Intronic
1135299657 16:21314615-21314637 TTCTTTGTGTCCTCACATGGTGG + Intergenic
1135352881 16:21744627-21744649 CTCACTGTGTCCTCACATGGTGG + Intronic
1135451367 16:22560750-22560772 CTCACTGTGTCCTCACATGGTGG + Intergenic
1135845186 16:25912358-25912380 TTGACTGTGTTCTCTCATCCTGG + Intronic
1136019891 16:27433605-27433627 TTCGCTGTGTTCTAAAACAGGGG - Intronic
1137390920 16:48080996-48081018 TTCTATGTGTCCTCACATGGAGG + Intergenic
1137466363 16:48713442-48713464 CTCACTGTGTCCTAACATGGTGG - Intergenic
1137475806 16:48809605-48809627 TTATATGTGTTCTCACACAGTGG + Intergenic
1137626092 16:49909716-49909738 CTCGCTGTGTCCTCACACAGTGG + Intergenic
1137672292 16:50285991-50286013 CTCACAGTGTTGTCACAAAGGGG + Intronic
1138215771 16:55204014-55204036 CTCACTGTGTCCTCACATGGTGG - Intergenic
1138310410 16:56018772-56018794 TTCACTGTGTCCTCATTTGGTGG - Intergenic
1138730000 16:59184094-59184116 TTCACTGTGTCCTCACATGGTGG + Intergenic
1138730273 16:59186431-59186453 TTGCCATTGTTCTCACATAGTGG + Intergenic
1139148412 16:64350635-64350657 TTCACTGTGTCTTCACATTGTGG - Intergenic
1139314527 16:66056932-66056954 CTCACTGTGTCCTCACATGGTGG - Intergenic
1140047481 16:71451570-71451592 CTCACTGTATCCTCACATGGTGG - Intronic
1140144954 16:72297664-72297686 CTCACTGTGTCTTCACATAGTGG - Intergenic
1140293770 16:73688512-73688534 TGCACTGTGTCCTTACATGGTGG - Intergenic
1140521813 16:75588324-75588346 CTCATTGTGTCCTCACATGGCGG + Intergenic
1143337860 17:6186956-6186978 TTTGCTGTGTCCTCTCATAGAGG - Intergenic
1144147931 17:12416178-12416200 CTCACTGTGTCCTCACATGGTGG + Intergenic
1145837524 17:27965852-27965874 CTCACTGTGTCCTCACATGGTGG + Intergenic
1146296316 17:31653404-31653426 TTAGCTGTGTTCTCACATGGTGG - Intergenic
1146303105 17:31706638-31706660 CTTACTGTGTCCTCACATGGTGG - Intergenic
1146684165 17:34829212-34829234 CTTTCTGTGTCCTCACATAGTGG - Intergenic
1146755126 17:35423865-35423887 ATTGCTGTGTTCTCACATAGTGG - Intronic
1146993395 17:37296253-37296275 CTCATTGTGTCCTCACAGAGTGG + Intronic
1147872375 17:43596670-43596692 TTCTCTGGGCTCTCACATGGTGG + Intergenic
1148534115 17:48424171-48424193 TTAACTGTGTCCTCACATAGTGG + Intronic
1149619656 17:58033888-58033910 CTAGCTGTGTTCTCACATGGTGG - Intergenic
1150907395 17:69352266-69352288 TTCACTGTGTCCTCATATGGTGG - Intergenic
1151268528 17:72975506-72975528 CTCACTGTGTCCTTACATGGCGG - Intronic
1151446994 17:74173266-74173288 CTCACAGTGTTCTCAAAGAGAGG - Intergenic
1153100915 18:1468603-1468625 CTCACTGTGTCCTCACATGGTGG - Intergenic
1153405340 18:4732530-4732552 CTCACTGTGTCCTCACATGATGG - Intergenic
1153433911 18:5048510-5048532 TTTATTGTATTCTCACATGGTGG - Intergenic
1153658864 18:7308797-7308819 TTCATTGTGTCCTCACCTGGTGG - Intergenic
1153850372 18:9088627-9088649 AACACTGTGTCCTCACATAACGG + Intergenic
1154254457 18:12770401-12770423 TTCACTGTCTTCACCCATGGAGG - Intergenic
1154495932 18:14961159-14961181 GTCACTGTGTCCCCACATGGAGG + Intergenic
1155266481 18:24099303-24099325 CTCACTGTGTCCTCAGATGGTGG + Intronic
1156059803 18:33060623-33060645 TTCACTGTATTCACCAATAGCGG - Intronic
1156195460 18:34769678-34769700 TTCACTGTGTCCTCTCATGGTGG + Intronic
1156241340 18:35257497-35257519 TTCACTGTGTCCTCACGTGGTGG - Intronic
1156507038 18:37603775-37603797 CTTGCTGTGTCCTCACATAGTGG - Intergenic
1156524777 18:37756552-37756574 CTCACTCTGTCCTTACATAGTGG - Intergenic
1156640957 18:39098151-39098173 TACACTGAGTCCTCACATGGTGG + Intergenic
1156708519 18:39913132-39913154 CTCACTGTGTCCTCACATGATGG - Intergenic
1157103552 18:44751914-44751936 CTCATTGTGTCCTCACATGGTGG + Intronic
1157111926 18:44828843-44828865 CTCCCTGTGTCCTCACATGGTGG - Intronic
1157216689 18:45789604-45789626 CTTGCTGTGTCCTCACATAGCGG - Intergenic
1157512598 18:48288716-48288738 CTCACTTTGTCCTCACAGAGTGG - Intronic
1157818872 18:50750952-50750974 CTCAGTGTGTCCTCACATGGTGG - Intergenic
1157889880 18:51405402-51405424 CTTGCTGTGTCCTCACATAGGGG - Intergenic
1158259628 18:55592397-55592419 CTCACTGAATTCTCACATAGTGG + Intronic
1159003955 18:62996503-62996525 TTTCCTGTGTCCTCACACAGTGG - Intergenic
1159376334 18:67598294-67598316 CCCACTGTATTCTCACATGGTGG + Intergenic
1159407781 18:68027758-68027780 GTCCCTGTGTCCTCACATGGTGG + Intergenic
1159502755 18:69295013-69295035 TTGGCTGTGTCCTCACATATTGG + Intergenic
1159809456 18:72999118-72999140 TTCCCTGTGTTCACACAGGGTGG + Intergenic
1162010613 19:7811715-7811737 CTTGCTGTGTTCTCACATGGTGG - Intergenic
1162411389 19:10507941-10507963 CTCACTGTGTTCCCACATGTTGG - Intergenic
1163338241 19:16687645-16687667 CTCACTGTGTCCTCGCATGGTGG + Intronic
1164744479 19:30601078-30601100 TTCCCTGTGTTCCCACAGTGAGG + Intronic
1164852044 19:31492131-31492153 TTCTATGTGTTCTCAGATAGTGG + Intergenic
1164864318 19:31591201-31591223 CTTGCTGTGTTCTCACATGGTGG - Intergenic
1165882805 19:39055551-39055573 CTCCCTGTGTTCTTACAGAGTGG + Intergenic
1166156040 19:40911804-40911826 ATCACTGCGTTCTCACATGGTGG + Intergenic
1166459440 19:42973258-42973280 CTCCCTGTGTTCTCCCATGGTGG + Intronic
1166476762 19:43133303-43133325 CTCCCTGTGTTCTCCCATGGTGG + Intronic
1168510910 19:56972962-56972984 CTCCCTGTGTCCTCACATGGTGG + Intergenic
925016878 2:534693-534715 CTTGCTGTGTTCTCACATGGTGG + Intergenic
925043964 2:756807-756829 CTCACTGTGTTCTCACAGTGGGG - Intergenic
925067582 2:940548-940570 CTCACTGTGTCCACACATGGTGG + Intergenic
925144399 2:1571322-1571344 CTCACTGTGTCCTCACGTGGTGG + Intergenic
925164882 2:1709813-1709835 CTCTCTGTGTCCTCACATGGTGG - Intronic
925410903 2:3639563-3639585 TTCTCTTTATTCTCACAGAGAGG - Intronic
925483365 2:4301420-4301442 TTCTCTGTGTCCTCACATGGTGG - Intergenic
925556055 2:5132681-5132703 CTGACTGTGTCCTCACATGGGGG - Intergenic
925588999 2:5491675-5491697 CTTGCTGTGTTCTTACATAGAGG - Intergenic
925676128 2:6362830-6362852 CTTACTGAGTTCTCACATGGTGG + Intergenic
925729353 2:6906700-6906722 GTCCCTGTGTTCTCACATGGAGG + Intergenic
925799350 2:7582937-7582959 TTCTCTGCGTCCTCACATGGTGG + Intergenic
925833795 2:7923106-7923128 TTCACTTTGTCCTCACATGGTGG + Intergenic
926041746 2:9679227-9679249 CTCATTGTGTTCTCACATGGTGG - Intergenic
926696832 2:15775952-15775974 TTCTCTGTGTCCTCACATGATGG - Intergenic
926961869 2:18365823-18365845 TTCACTGCATCCTCACATGGTGG - Intergenic
927050512 2:19323634-19323656 CTCACTGTGTCCTCACATTGTGG + Intergenic
927416581 2:22886635-22886657 CTCACTGTGTCCTCATATGGTGG - Intergenic
929022619 2:37568497-37568519 CTCACTGTGTTCTCACATGGTGG - Intergenic
929228113 2:39531619-39531641 TTCACTGTGTCCTCACATGGTGG + Intergenic
929674533 2:43912556-43912578 TTGTCTGTTTTCTCTCATAGGGG - Exonic
929815980 2:45231971-45231993 CTCACTGCGTCCTCACATTGCGG + Intergenic
930001501 2:46864784-46864806 TTCTCTGTGTCCTCACACAGTGG + Intergenic
930107177 2:47649478-47649500 TGCACTGTGTCCTCACATGGTGG - Intergenic
930157725 2:48122967-48122989 CTCACTGTGTTCTCACTTGCTGG - Intergenic
930170639 2:48247727-48247749 CTCACTGTTTCCTCACATGGTGG - Intergenic
930202587 2:48559394-48559416 TTCTATGTGTTCTCAGATGGCGG + Intronic
930472627 2:51839081-51839103 TTTACTGTGATCTGACATACAGG - Intergenic
930485171 2:52002358-52002380 CTAGCTGTGTTCTCACATAGTGG + Intergenic
930557678 2:52919816-52919838 TTTGCTGTGTTCTCACAGAGTGG - Intergenic
930851750 2:55968481-55968503 CTCGCTGTGTCCTCACATGGTGG - Intergenic
930867490 2:56136232-56136254 CTCACTCTAATCTCACATAGTGG + Intergenic
930871807 2:56178688-56178710 CTTACTGTGTCCTCACATGGTGG + Intergenic
930912847 2:56650788-56650810 TTCTCTCTGTTCTCACATGGTGG - Intergenic
931007873 2:57873074-57873096 TTTCCTGTGTCCTCACATGGTGG - Intergenic
931112764 2:59130458-59130480 TCCACTGGGTCCTTACATAGGGG + Intergenic
931645403 2:64417394-64417416 ATCACTGTGTCCTCACATAGTGG + Intergenic
932869419 2:75382101-75382123 CTCACTGTGTCATCACATGGGGG - Intergenic
932876195 2:75455166-75455188 CTCACTTTGTTCTTACATGGTGG + Intergenic
933075151 2:77915117-77915139 TTCACTATGTTGTCACACATGGG + Intergenic
933092888 2:78144141-78144163 CTTACTGTGTTCTCACATGGTGG + Intergenic
933593022 2:84253556-84253578 TTAGCTGTGTCCTCACATAGTGG - Intergenic
933843896 2:86309670-86309692 TTGGCTGTGTCCTCACATGGTGG + Intronic
934056717 2:88257433-88257455 CTCATTGTGTCCTCACGTAGAGG - Intergenic
934064356 2:88326496-88326518 GTCCCTGTGTTCTCACATAGTGG - Intergenic
934070652 2:88380877-88380899 AACACTGTGTCCTCACATGGTGG - Intergenic
934897206 2:98129160-98129182 CTCACTCTGTTCTCACACGGTGG + Intronic
934992916 2:98933961-98933983 CTCACAGTGTCCTCACATGGTGG + Intronic
935180624 2:100687375-100687397 CTCCCTGTGTCCTCACATGGAGG - Intergenic
935488766 2:103691684-103691706 TCCACTGGGTTCTCACAATGCGG + Intergenic
935537151 2:104308112-104308134 CTCACTGTGTCCTCACACAGAGG + Intergenic
935636985 2:105256578-105256600 TTGACTGTGTACTCATATAAAGG - Intergenic
935730521 2:106061552-106061574 CTCACTGTGCTCTCACATGTCGG + Intergenic
935809653 2:106785190-106785212 CTCGCTGTGTCCTCACATTGTGG + Intergenic
935868569 2:107419467-107419489 CTCACTGTGTACTCACATAGTGG + Intergenic
935978893 2:108607152-108607174 CTCACTGTGTCCTCACATGCAGG - Intronic
936619456 2:114080410-114080432 CTCACTGTGTCATCACATGGTGG + Intergenic
936875950 2:117189438-117189460 TTCACAGTGAGGTCACATAGAGG - Intergenic
936896371 2:117432502-117432524 CTCACTGTGTCCTCAGATAGTGG + Intergenic
936930624 2:117784876-117784898 CTCCCTGTGTCCTCACATGGTGG - Intergenic
936966722 2:118134409-118134431 TTCTGTGTGTTCCCACATATTGG + Intergenic
937139150 2:119583826-119583848 TTCACTGTGTCTTCGCATAATGG - Intronic
937211140 2:120272171-120272193 CTCAGTGTGTCCTCACATGGTGG + Intronic
937494181 2:122400509-122400531 CTCACTGTGTCTTCACATGGCGG - Intergenic
937772134 2:125731977-125731999 TTTACTGTCTTCTCACATGCTGG + Intergenic
937795938 2:126020100-126020122 TTAGCTGTGTTCTCACATAGTGG - Intergenic
938079371 2:128361460-128361482 CTCACTGTATCCTCACATGGTGG - Intergenic
938556851 2:132432266-132432288 CTCGCTGTGTCCTCACATGGTGG + Intronic
939286642 2:140139929-140139951 CTCACTGTGTCCTCCCATTGTGG - Intergenic
939463331 2:142526277-142526299 TTCACTATGTTCTCTTATGGCGG - Intergenic
939557671 2:143695919-143695941 TGCACTATGATCTCACATTGGGG - Intronic
939741506 2:145913405-145913427 TTCAATTTGTTATTACATAGTGG - Intergenic
939795026 2:146632648-146632670 CTCACTGTGTTCTCACATGTTGG + Intergenic
939877767 2:147597428-147597450 TTCACTGTGTCTTCACATGGTGG - Intergenic
940254626 2:151715596-151715618 CTCATTGTGTTCTCACACATTGG - Intronic
940307245 2:152239688-152239710 CTCCCTGTGTCCTCACATACTGG - Intergenic
940465936 2:154026599-154026621 TTCTCTGTGTTCTCACATGCAGG + Intronic
940570181 2:155422155-155422177 TTTGCTGTGTTCTCACATGGTGG + Intergenic
940672984 2:156693641-156693663 TTCTCTGTGCTCTCACATGGTGG - Intergenic
940771618 2:157844873-157844895 CTTGCTGTGTTCTCACATGGTGG - Intronic
941230284 2:162903691-162903713 CTCACTGTGTCCTCACATCATGG - Intergenic
941349855 2:164418764-164418786 TTCCCTGTATCCTCACATGGTGG + Intergenic
941709438 2:168696677-168696699 CTCACTGTGTCCTCACATGGTGG + Intronic
942207513 2:173635104-173635126 CGCACTGTGTTCTTACATGGTGG + Intergenic
943184989 2:184597272-184597294 TGCAGTTTGTTCTGACATAGGGG + Intergenic
943432601 2:187823545-187823567 CTCACTGTGTTCTCACATGTTGG - Intergenic
943728611 2:191278253-191278275 CTAACTGTGTCCTCACATGGTGG + Intronic
943812907 2:192211905-192211927 CTAGCTGTGTTCTCACATGGTGG + Intergenic
943940376 2:193986665-193986687 CTCACTGTGTTCTTATATGGTGG - Intergenic
944007471 2:194927667-194927689 CTCACTGTGTTCTCACAGGATGG + Intergenic
944029452 2:195216607-195216629 CTCACTGTATACTCACATAAAGG + Intergenic
944151776 2:196567120-196567142 TTCCCTCTGTTCTCACAGACTGG + Intronic
944224618 2:197337614-197337636 AACACTGTGTCCTCACATGGCGG - Intergenic
944440458 2:199738023-199738045 TTCACTGGGTTCTCACAGGTTGG + Intergenic
944900917 2:204215230-204215252 CTCTCTGTGTCCTCACACAGTGG + Intergenic
944919493 2:204396699-204396721 TTTGTTGTGTTCTCACATGGTGG + Intergenic
944995827 2:205292294-205292316 CTCATTGTGTCCTCACATGGTGG - Intronic
945145464 2:206733474-206733496 TTCACTGTGTCTCCACATGGTGG - Intergenic
945370836 2:209015427-209015449 CTTGATGTGTTCTCACATAGTGG - Intergenic
946113259 2:217438508-217438530 CTCACTGTGTCCTCACATGGTGG - Intronic
946637471 2:221745497-221745519 TTCACTCTGTTCTCATCTCGAGG + Intergenic
947108015 2:226688088-226688110 CTCACTGTGTCCTCACATGACGG + Intergenic
947337954 2:229106603-229106625 TTCTATGTGTCCTCACATGGTGG - Intronic
947361792 2:229352858-229352880 AACACTGTGTCCTCACATGGTGG - Intergenic
947814592 2:233027877-233027899 AACACTGTGTCCTCACATGGTGG + Intergenic
948027088 2:234786909-234786931 CTCACTGTGTCCTCACGTAGTGG + Intergenic
948516374 2:238506294-238506316 CTCACTGTGTCCTCACACAGCGG + Intergenic
948649580 2:239432456-239432478 CTCACTGTGTCTTCACATGGTGG + Intergenic
1169063602 20:2679644-2679666 CTCATTGTGTCCTCACATAGTGG + Intergenic
1169606272 20:7323124-7323146 ATCACTGTATCCTCACATGGTGG + Intergenic
1169696828 20:8398536-8398558 CTCATTGAGTCCTCACATAGGGG + Intronic
1170040379 20:12033944-12033966 GTTGCTGTGTGCTCACATAGTGG - Intergenic
1170796933 20:19556041-19556063 TTTGCTGTGTCCTCACATGGTGG + Intronic
1170833543 20:19863912-19863934 TTCACTGTGCTCTCACAGCCTGG - Intergenic
1171336060 20:24386617-24386639 CTCACTGTGTCCTCATATGGTGG - Intergenic
1171381762 20:24738769-24738791 TTCCATGTGTCCTCACATGGTGG - Intergenic
1171726252 20:28623880-28623902 AACACTGTGTCCTCACATGGTGG + Intergenic
1171790446 20:29518375-29518397 AACACTGTGTCCTCACATGGTGG + Intergenic
1171857266 20:30358460-30358482 AACACTGTGTCCTCACATGGTGG - Intergenic
1172822371 20:37748741-37748763 CTCACTGCGTCCTCACATGGTGG + Intronic
1174316459 20:49706310-49706332 TTCATTTTGTTTTCAAATAGAGG - Intronic
1175552382 20:59825950-59825972 CTCACTGTGTCCTCACATGGTGG - Intronic
1175630972 20:60536144-60536166 CTCACTGTGTCCTCACATGGTGG - Intergenic
1175774590 20:61644985-61645007 CTCTCTGTGTGCTCACATGGCGG + Intronic
1176880508 21:14186791-14186813 TTCACTGTGTCCTCACATGGTGG - Intronic
1177223780 21:18227086-18227108 CTTACTGTGTCCTCACATAGTGG + Intronic
1177302830 21:19272138-19272160 CTAGCTGTGTTCTCACATGGTGG + Intergenic
1177535305 21:22419546-22419568 TTCCCTGTATTCTCACATGGTGG - Intergenic
1177737004 21:25103537-25103559 CTCACTGTGTCCTTACATGGAGG - Intergenic
1177774164 21:25549737-25549759 TACACTGTGTGCTCACATGGAGG - Intergenic
1177851374 21:26352893-26352915 CTCACTGTGTCCTCACGTTGTGG + Intergenic
1177930661 21:27278999-27279021 CTCACTATGTCCTCACATGGTGG + Intergenic
1178255156 21:31045459-31045481 CTCACTGTGTTCTCTCATGGTGG + Intergenic
1178291207 21:31370027-31370049 TTCACTGTGTCCTCATGTGGTGG - Intronic
1178352763 21:31884643-31884665 TTCACTGAGTCCTCATATGGTGG - Intronic
1178522832 21:33300726-33300748 TTCTCTGTGTCCTCACATGGTGG - Intergenic
1178524008 21:33310040-33310062 CTCACTGTGTCCTCATATGGTGG - Intergenic
1178846540 21:36178483-36178505 CTCACTGTGTCCTCACATGGTGG - Intronic
1179058814 21:37960551-37960573 TTCACTATGATCTCACCTGGTGG + Intronic
1179429907 21:41314192-41314214 CTCACTGTGTCCTCACATGGTGG - Intronic
1179533931 21:42039314-42039336 CTCACTGTGTCCCCACATGGTGG + Intergenic
1179954672 21:44731921-44731943 TTCACTGTGTCCTCACACAGTGG + Intergenic
1180913874 22:19471937-19471959 TGCACTGTGCTCTCACAGAGGGG - Intronic
1181886317 22:26024962-26024984 CTCACTGTGTCATCACACAGTGG + Intronic
1182108347 22:27705032-27705054 CTCACTGTGTCCTCACCTGGTGG + Intergenic
1182483484 22:30625340-30625362 CTGGCTGTGTTCTCACATGGTGG + Intronic
1182931143 22:34175478-34175500 TTCACTGTGTCCTCACATGGTGG + Intergenic
1182970117 22:34565963-34565985 CTCACTGTGTCCTCACATAGTGG + Intergenic
1183004344 22:34888659-34888681 CTCACTGTGTCCTCACATGGTGG + Intergenic
1183031123 22:35105663-35105685 TTCACTATGTTCTCACCGAATGG + Intergenic
1183039145 22:35163303-35163325 CTCACTGTGTCCTCACACAGTGG + Intergenic
1183785621 22:40027604-40027626 TTCCCTGAGTGCTCACATATTGG - Intronic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1184912264 22:47543924-47543946 TTCTCTGTGTCCTCACATGGTGG - Intergenic
1185005074 22:48271052-48271074 CTGACTGTGTCCTCACATGGTGG + Intergenic
1185188494 22:49417814-49417836 TTCACTGTGTTATCCTACAGGGG + Intronic
1185201813 22:49511499-49511521 CTCTCTGTGTCCTCATATAGTGG - Intronic
949256556 3:2054055-2054077 TTTACTGTGTCCTCACATGGTGG - Intergenic
949372718 3:3352961-3352983 CTCACTGTGTCCTCACATGGTGG - Intergenic
949591165 3:5495831-5495853 GTCATTATGTTCTCACATGGTGG - Intergenic
949604383 3:5637257-5637279 AACACTGTGTCCTCACATGGTGG + Intergenic
949714722 3:6916592-6916614 TTCTATGTGTCCTCACATGGTGG + Intronic
949793519 3:7820350-7820372 CTCACTGTGTCCTCACATAGTGG + Intergenic
949806031 3:7956819-7956841 CTTGCTGTGTCCTCACATAGAGG + Intergenic
950155606 3:10719389-10719411 TTCACTGTGTCCTCACATGATGG + Intergenic
950588504 3:13916234-13916256 CTCACTGTGTCTTCACATAGTGG + Intergenic
950598666 3:14010545-14010567 CTCACTGTGTCTTCACATGGTGG + Intronic
950923999 3:16722002-16722024 TTCCCTGTGTTTCCAAATAGGGG - Intergenic
951185642 3:19709734-19709756 CTCTCTGTGTCCTCACATAGTGG + Intergenic
951347463 3:21563203-21563225 TTCACTGTATTTTCACATGGTGG - Intronic
951681095 3:25295368-25295390 CTCACTGCATCCTCACATAGTGG - Intronic
951748188 3:26002928-26002950 CTCACTGTGTCCTCACATAATGG + Intergenic
951794708 3:26525416-26525438 CTAGCTGTGTCCTCACATAGTGG + Intergenic
952434324 3:33257118-33257140 TTCACTGTGTCCTCACATGGTGG - Intergenic
952581545 3:34838971-34838993 GTCTCTGTGTCCTCACATGGTGG + Intergenic
953120042 3:40031192-40031214 CTCTCTGTGTCCTCACATCGTGG + Intronic
953126689 3:40097279-40097301 TTGCCTGTGGTCTCACAGAGAGG + Intronic
953154386 3:40355788-40355810 CTCAATGAATTCTCACATAGAGG + Intergenic
953206705 3:40837678-40837700 AACACTGTGTTCTCATATGGTGG + Intergenic
953242337 3:41160667-41160689 TTTATTGTGTTCTCACATGGTGG - Intergenic
953953683 3:47213581-47213603 CTCATTGTGTTCTCACATGGTGG + Intergenic
954169419 3:48788705-48788727 CTCTGTGTGTTCTCACATGGTGG - Intronic
954483810 3:50827394-50827416 TTTGGTGTGTCCTCACATAGAGG + Intronic
954954664 3:54508577-54508599 TTCACTTTGTTCTTGCACAGAGG + Intronic
955515648 3:59724022-59724044 CTCACTGTGTCCTCACATGGTGG + Intergenic
955525945 3:59819923-59819945 AACACTGTGTCCTCACATGGTGG - Intronic
955541443 3:59980696-59980718 CTCCCTGTGTCCTCACATGGTGG - Intronic
956571861 3:70705565-70705587 TTCACTGCATCCTCACATGGGGG + Intergenic
956747785 3:72323285-72323307 TTTGCTGTGTCCTCACAGAGTGG + Intergenic
956784660 3:72632543-72632565 CTCACTGTGTGCTCACATGGTGG + Intergenic
956864023 3:73351839-73351861 ATCACTGTGTGCTGACAAAGTGG + Intergenic
957005763 3:74944849-74944871 TGCCCTGTGTCCTCACATGGCGG - Intergenic
957192824 3:77031980-77032002 CTCACTGTGTCTTCACATGGTGG + Intronic
957239127 3:77635987-77636009 TTCATTGTATGATCACATAGCGG + Intronic
957439547 3:80225937-80225959 CTCACTGTGTCCTCCCATGGTGG - Intergenic
957620711 3:82590277-82590299 CTCACTGTGTCCTCACATGGTGG + Intergenic
957688284 3:83533470-83533492 CTCACTGAGTCTTCACATAGTGG + Intergenic
957791056 3:84941847-84941869 CTCACTGTGTCCTCACATGGTGG + Intergenic
957964995 3:87310746-87310768 TACACTGTGTACTCAGAGAGAGG - Intergenic
958836024 3:99146028-99146050 AACACTGTGTCCTCACATGGTGG - Intergenic
959224512 3:103562975-103562997 TCCACTGTGTCCTCACATGGTGG - Intergenic
959347256 3:105213483-105213505 ATCTCTGTGTCATCACATAGTGG - Intergenic
959420642 3:106124199-106124221 CTTACTGTGTCCTCACACAGGGG - Intergenic
959528375 3:107403210-107403232 TTCACTGTGTTTTCACATGGTGG - Intergenic
959784185 3:110273800-110273822 CTAGCTGCGTTCTCACATAGTGG + Intergenic
959877047 3:111395382-111395404 CTCACTGTGTCTTCACATGGTGG - Intronic
959910598 3:111759307-111759329 CTCACTGTGTCCTCACATGGTGG + Intronic
960004307 3:112766442-112766464 TTCTGTGTGTCCTCACATGGAGG - Intronic
960154667 3:114287104-114287126 TTAGCTGTGTTTTCACATGGTGG + Intronic
960461589 3:117942529-117942551 CTCACTGTATCCTCACATGGTGG - Intergenic
960641342 3:119826579-119826601 TTCATTGTATTCTCACTTTGAGG - Intronic
961251803 3:125513221-125513243 TTCACTGTGTCCTCACATGGTGG - Intronic
961360323 3:126363187-126363209 CTCGCTGTGTCCTCACATGGTGG - Intergenic
961521282 3:127468716-127468738 TCCTCTGTGTTCTCACCTTGGGG - Intergenic
961567298 3:127772861-127772883 CTCACTGTGTCCTCACATGGTGG - Intronic
961925845 3:130479204-130479226 TTCACTAAATTCTCACATGGTGG - Intronic
961990001 3:131179128-131179150 AACACTGTGTCCTCACATGGTGG - Intronic
962301240 3:134244929-134244951 CTCCCTGTGTTCTCACATGGTGG - Intronic
962924727 3:139981242-139981264 ATCACTGCGTTTTCACAAAGAGG - Intronic
962948289 3:140194272-140194294 TTCACTGTGTCCTTACATGGTGG + Intronic
963059706 3:141215335-141215357 TTCACTGCGTCCTCACATGGTGG + Intergenic
963412106 3:144941904-144941926 TTAGCTGTGTCCTCACATGGTGG + Intergenic
963840312 3:150098013-150098035 AACACTGTGTCCTCTCATAGTGG - Intergenic
964011229 3:151894368-151894390 CTCACTGTGTTGTCACATGATGG - Intergenic
964529739 3:157654672-157654694 ATCACTGTGTCCTCACATAGTGG + Intronic
964806526 3:160616341-160616363 TTAACTATGTTCTCCCAGAGTGG - Intergenic
964885139 3:161473359-161473381 TTTTCTGTGTACTCACATGGTGG + Intergenic
965279644 3:166733563-166733585 CTCACTGTGTCCTTACATAGTGG + Intergenic
965443454 3:168745603-168745625 CTCCCTGTGTCCTCACATGGTGG + Intergenic
965599844 3:170443683-170443705 TGCACTGTGTTTTCACATCTGGG + Intronic
965794909 3:172429402-172429424 CTTGCTGTGTTCTCACATGGTGG - Intergenic
966532140 3:180992927-180992949 CTCACTGTGTTCTCACAGGGTGG - Intergenic
966716653 3:183019471-183019493 TTCTCTGTGTCCTCACGTGGTGG - Intronic
967726100 3:192863794-192863816 TTCACTGTGTCCTCACCTGATGG - Intronic
968030700 3:195485285-195485307 TCCACTGTGATATCACACAGAGG - Intergenic
968031705 3:195503730-195503752 ATCACTGTGATATCATATAGAGG - Intergenic
968031715 3:195503947-195503969 ACCACTGTGATATCACATAGAGG - Intergenic
968031805 3:195505718-195505740 ATCACTGTGATATCATATAGGGG - Intergenic
968031820 3:195505908-195505930 ATCACTGTGATATCATATAGGGG - Intergenic
968046540 3:195626870-195626892 GTCACTGCGTCCTCACATGGGGG - Intergenic
968308113 3:197663171-197663193 GTCACTGCGTCCTCACATGGGGG + Intergenic
969075934 4:4577685-4577707 CTTGCTGTGTTCTCACATAGTGG + Intergenic
969177240 4:5407972-5407994 CTTGCTGTGTTCTCACATGGTGG - Intronic
969430941 4:7153981-7154003 TTCTCTGTGTCCCCACATTGGGG + Intergenic
969547955 4:7844311-7844333 CTCACTGTGTCCTCACATGGTGG - Intronic
969950403 4:10829746-10829768 TTGTCTGTGTCCTCACATAGTGG - Intergenic
969965158 4:10986478-10986500 CTCACTGTGTCTTCATATAGTGG - Intergenic
970069284 4:12138336-12138358 CTCACTGTGTCCTCACATTGTGG + Intergenic
970128731 4:12843246-12843268 ATGACTGTGTCTTCACATAGTGG + Intergenic
970550672 4:17177956-17177978 CTCACTGTGTCCTCACATGGAGG + Intergenic
970860521 4:20697792-20697814 TTCACTGTGTCCTCACATAGTGG + Intronic
970866246 4:20762188-20762210 CTAGCTGTGTTCCCACATAGTGG + Intronic
970988255 4:22183419-22183441 TTCACCGCGTGCTCACATGGTGG + Intergenic
971222085 4:24717563-24717585 CTCTCTGTGTCCTCACATGGTGG - Intergenic
971353886 4:25877054-25877076 TTCACTGTGTCCTCACATGGTGG - Intronic
971511324 4:27428790-27428812 CTCACTGTGTCCTCACATGGTGG + Intergenic
971592353 4:28484284-28484306 TTCACTGTGTCCTCACATGTTGG - Intergenic
971711065 4:30113230-30113252 CTCATTGTATTCTCATATAGAGG + Intergenic
971713360 4:30145811-30145833 TTCACTCTATTTTCACATAGTGG + Intergenic
971844626 4:31903574-31903596 TTCATTGTATCCTCACATTGTGG - Intergenic
972084579 4:35199953-35199975 TTCTCTCTGTCCTCACATTGTGG + Intergenic
972161376 4:36232021-36232043 TTCCCTGTGTCCTTACATAGAGG - Intronic
972226266 4:37016439-37016461 TTTGCTGTGTACTCACATAGTGG - Intergenic
972268394 4:37484753-37484775 CTCATTGTGTCCTCACATGGTGG - Intronic
972297134 4:37750638-37750660 AACACTGTGTCCTCACATGGTGG - Intergenic
972304097 4:37815087-37815109 CTCACTGTGTCCTCAAATGGTGG - Intergenic
972414104 4:38821729-38821751 TTCACTGTATCCTCACCTGGGGG - Intronic
972914020 4:43853605-43853627 CTCACTTTGTCCTCACATGGTGG + Intergenic
972969255 4:44552040-44552062 TTCAGTGTGTCGTCACATGGTGG + Intergenic
973551613 4:52040883-52040905 GTCACTGTGTCCTCACATGGTGG - Intergenic
973576399 4:52294161-52294183 CTCACTGTGTCCTCACAAGGTGG + Intergenic
973926825 4:55747458-55747480 CTCACTGTGTCCTCACAAGGTGG - Intergenic
974365584 4:60945183-60945205 CTCACTGTGTCCTCATATTGAGG + Intergenic
974394717 4:61320071-61320093 TTCACTGTGCCCTCATATGGAGG - Intronic
974604070 4:64126313-64126335 TTCACTGTGTCCTAATATTGTGG - Intergenic
974637380 4:64582640-64582662 CTCACTGTTTTCCCACATGGGGG + Intergenic
974750522 4:66134648-66134670 TTCTGTGTGTTCTCACATAGTGG + Intergenic
974757916 4:66236035-66236057 TTGACTGCGTTCTCTTATAGAGG - Intergenic
974821996 4:67078883-67078905 CTCACTGTGTCTTCACATGGTGG + Intergenic
975225485 4:71866404-71866426 CTCACTGTATTGTCACATGGTGG - Intergenic
975225603 4:71867726-71867748 CTCACTATATTCTCACATGGTGG - Intergenic
975409027 4:74026185-74026207 TTCACTGAGTTCTCACATGGTGG - Intergenic
975745317 4:77469463-77469485 TTCACCATGTTCTCACATGTTGG - Intergenic
976188614 4:82467924-82467946 CTCAGTGTGTCCTCACATGGTGG - Intergenic
976285014 4:83362890-83362912 CTCACTATGTCCTCACATGGTGG - Intergenic
976305197 4:83552920-83552942 CTCACTGTGTCCTCACATGATGG - Intronic
976327820 4:83793037-83793059 TTCACCGTGTCCTCACATGGTGG + Intergenic
976513965 4:85943407-85943429 TTCACTGTGCCCTCAGATGGTGG + Intronic
976764497 4:88585095-88585117 CTCACTGTGTCCTCACATGGTGG + Intronic
976989244 4:91344201-91344223 TTCTATGTGTTCTCACATGGAGG - Intronic
977553285 4:98464709-98464731 CTCGCTGTGTCCTCACATGGTGG + Intergenic
977603766 4:98961478-98961500 ATCACTGTGTCTTCACATGGAGG - Intergenic
977748970 4:100585416-100585438 TTTGTTGTGTTCTCACATGGTGG - Intronic
977991034 4:103442708-103442730 TGCACTGTATTCTCACATGACGG + Intergenic
978320737 4:107492323-107492345 CTCACAGTGTCCTCACATGGTGG + Intergenic
978768913 4:112433308-112433330 TTCTCTGTGTCCTCACATAGTGG + Intronic
978875560 4:113636665-113636687 GTCACTGTGAACTCAAATAGTGG + Intronic
978882949 4:113729824-113729846 TTCTCTGTGTTTTCATATGGTGG - Intronic
979021225 4:115501054-115501076 CTCACTGTATCCTCACATGGTGG - Intergenic
979087066 4:116426882-116426904 TTCACTATCTTCTCTCCTAGTGG + Intergenic
979308970 4:119179801-119179823 AACACTGTGTTCTCACATGATGG + Intronic
979727091 4:123975056-123975078 TTCACTGTGTCCTCACATGGTGG - Intergenic
979748355 4:124244795-124244817 GACACTGTGTCCTCACATGGTGG - Intergenic
980504175 4:133693338-133693360 TGCACTGTGTTCTGACAGTGTGG - Intergenic
980614589 4:135202336-135202358 CTCACTGTGTCCTCACATGGAGG - Intergenic
980727067 4:136776546-136776568 AACACTGTGTCCTCACATGGTGG - Intergenic
980903513 4:138927571-138927593 CTCATTGTGTCCTCACATGGTGG - Intergenic
981038739 4:140199910-140199932 TTCACTGTGTTCTCACATGGTGG + Intergenic
981190074 4:141852130-141852152 CTCACTGTTTTCTCACATGGTGG + Intergenic
981651023 4:147059260-147059282 AACACTGTGTCCTCACATAGTGG - Intergenic
982053005 4:151522146-151522168 TTCATTGTGTTCTTTCATGGAGG - Intronic
982115334 4:152094239-152094261 CTCGCTGTGTCCTCACATGGTGG - Intergenic
982492142 4:156042807-156042829 CTCACTGTGTCCTCACACAGTGG + Intergenic
982510296 4:156274576-156274598 CTCACTGTGTCCTCATATGGTGG + Intergenic
982882310 4:160734808-160734830 CTTGCTGTGTTCTCACATGGTGG - Intergenic
982924796 4:161321810-161321832 TTCGCTGTGTCCTCACAGAGTGG - Intergenic
983000197 4:162405061-162405083 TTCAAACTGTTCTCACATGGTGG + Intergenic
983162158 4:164429776-164429798 CTCACTGTGTCTTCACACAGTGG - Intergenic
983477065 4:168226429-168226451 TATGCTGTGTTCTCACATGGTGG - Intronic
983748680 4:171235191-171235213 CTTGCTGTGTCCTCACATAGTGG + Intergenic
983795315 4:171854730-171854752 CTCACTGTGTTCTTACATGGTGG + Intronic
983983415 4:174027241-174027263 CTTGCTGTGTTCTCACATAGTGG - Intergenic
984045732 4:174796191-174796213 TTCACTGTAACCTCACATGGTGG - Intronic
984476454 4:180241578-180241600 TTCATTGAATTCTCACATAGGGG + Intergenic
984489027 4:180408842-180408864 CTCACTGTGTTCTCACATGGTGG - Intergenic
984578924 4:181487495-181487517 TTTACTGTGTTCTCACATGGTGG + Intergenic
984600364 4:181719519-181719541 CTCACTGTGTCCTCACACGGTGG + Intergenic
984808472 4:183772919-183772941 CTCACTCTGTCCTCACATGGTGG + Intergenic
985080629 4:186260821-186260843 CTCACTGTGTGCTCATATACAGG + Intergenic
985434275 4:189913821-189913843 AACACTGTGTCCTCACATGGTGG - Intergenic
985606449 5:860698-860720 GACACTGTGTTCTCACGTGGAGG + Intronic
985745095 5:1642392-1642414 GTCACTGCGTCCTCACATGGCGG + Intergenic
985844147 5:2331631-2331653 CTCACTGTGTCCTCACACTGTGG + Intergenic
986069382 5:4267112-4267134 CTCACTGTGTCCTCACATGGTGG - Intergenic
986093660 5:4535442-4535464 CCCACTGTGTCCTCACATGGTGG - Intergenic
986105329 5:4654562-4654584 TTCAGAGTGTCCTCACACAGAGG + Intergenic
986201887 5:5586648-5586670 CTCAGTGTGTCCTCACATGGAGG + Intergenic
986575919 5:9213045-9213067 CTCACTGTGTCCTCACAAGGTGG + Intronic
986670665 5:10140170-10140192 CTGACTGTGTCCTCACATGGTGG - Intergenic
986729083 5:10621971-10621993 CTCACTGTGTCCTTACATGGTGG - Intronic
986805815 5:11307982-11308004 TTTGCTGTGTCCTCACATGGTGG - Intronic
986809385 5:11339730-11339752 CTCTCTGTGTCCTCACAAAGTGG - Intronic
986858204 5:11896720-11896742 TTCTCAGTGTTCTCACATTTGGG + Intronic
986945691 5:13016488-13016510 CTCACTGTATCCTCACATGGTGG + Intergenic
986961587 5:13219382-13219404 TTCTCAGTGCTCTCACATGGTGG - Intergenic
987070222 5:14329438-14329460 TTCTATGTGTCCTCACATGGAGG - Intronic
987354061 5:17046747-17046769 TACACTGTGTTCTCCCATGTTGG - Intergenic
987664217 5:20915910-20915932 TTCACTGTGTCATTACCTAGAGG + Intergenic
987877272 5:23693900-23693922 CTCACTGTATCCTCACATGGTGG + Intergenic
988104151 5:26721950-26721972 TTCACTGTAACCTCACATGGTGG + Intergenic
988112789 5:26845081-26845103 TTCATTGTGTTTTCATATTGTGG + Intergenic
988758466 5:34286289-34286311 TTCACTGTGTCATTACCTAGAGG - Intergenic
988862903 5:35303402-35303424 TTGACTGAGTTCTCTCATTGCGG - Intergenic
988985603 5:36615554-36615576 CTCACTGTGTTCTCAAACACTGG - Intronic
989225697 5:39025669-39025691 CTCACTGTCTCCTCACATGGTGG + Intronic
989316286 5:40082665-40082687 CTCTCTGTGTCCTCACATGGTGG + Intergenic
989398845 5:40987471-40987493 TTCTCTGTGTCCTCACATGGTGG + Intergenic
989399643 5:40994883-40994905 CTCGCTGTGTCCTCACATGGTGG - Intergenic
989405116 5:41051685-41051707 CTCACTGTGTCCTTACCTAGTGG - Intronic
989476108 5:41874960-41874982 TTCTCTGTGTCCTCACATAATGG + Intergenic
989478236 5:41899075-41899097 TTATCTGTGTCCTCACATAGTGG + Intergenic
989800000 5:45525982-45526004 CTCACTGTATTCTCACCTGGTGG - Intronic
989980482 5:50637740-50637762 TTTGCTGTGTCCTCACATGGTGG - Intergenic
990434369 5:55773170-55773192 CTCTCTGTGTCCTCACATGGTGG + Intronic
990858221 5:60296004-60296026 CTCACGGTGTCCTCACATGGTGG + Intronic
991299819 5:65119455-65119477 TTCGCTGTGTTCTTACATGATGG - Intergenic
991335665 5:65544185-65544207 CTTGCTGTGTCCTCACATAGTGG + Intronic
991514798 5:67423311-67423333 CTCACTGTGTCCTCACATGAGGG - Intergenic
991582808 5:68174455-68174477 CTCACCGTGTCCTCACATGGTGG + Intergenic
992388036 5:76304697-76304719 AACACTGTGTCCTCACATGGTGG + Intronic
992458087 5:76934653-76934675 AACACTGTGTCCTCACATGGTGG - Intergenic
992532094 5:77662020-77662042 TTCACTTGGTTGTCACATAGGGG + Intergenic
992894460 5:81234438-81234460 TTCTCTCTGTCCTCTCATAGAGG + Intronic
992911709 5:81401474-81401496 TGCACTGTGTGATCACATACAGG - Intergenic
992930275 5:81636134-81636156 TTCACTGTGTCCTTACATATTGG - Intronic
992943480 5:81786397-81786419 CTCTCTGTGTCCTCACATGGTGG + Intergenic
993105706 5:83597950-83597972 TTTCCTGTGTCCTCACATGGTGG + Intergenic
993281707 5:85933459-85933481 TTAGCTGTGTCCTCACATGGTGG - Intergenic
993351601 5:86856822-86856844 CTCACTGTGTATTCACAAAGTGG + Intergenic
994141071 5:96342023-96342045 TTCAGTTTGGTCTCACATTGAGG - Intergenic
994381731 5:99079530-99079552 CTCACTGTGTCCTCACATGCTGG - Intergenic
994622841 5:102183535-102183557 TTCATTGTGTCCTTACACAGTGG + Intergenic
994714053 5:103300818-103300840 CTTGCTGTGTCCTCACATAGTGG + Intergenic
995286311 5:110392591-110392613 TTCACTGTGTCGTCACATGATGG + Intronic
995336250 5:111002879-111002901 CTCACTGTGTCCTCACATGGTGG - Intergenic
995536166 5:113138483-113138505 CTCACTGTGTCCTCACATGGAGG - Intronic
995597383 5:113762658-113762680 AACACTGTGTCCTCAAATAGAGG + Intergenic
996039959 5:118798320-118798342 TTCACTGTATCCTTACATGGTGG - Intergenic
996311893 5:122116010-122116032 CTTATTGTGTCCTCACATAGTGG + Intergenic
996480730 5:123972593-123972615 CTCAATGTGTCCTCACATTGTGG + Intergenic
996516287 5:124373105-124373127 TTCATTGTGTCCTCACATGGTGG + Intergenic
996678947 5:126209062-126209084 TTCTCTGTGTTCTCACAAGGCGG + Intergenic
996683584 5:126255729-126255751 TTCACTGAGTTCTTGCACAGTGG + Intergenic
996690806 5:126337774-126337796 GTCACTGTGTCTTCACATGGTGG - Intergenic
996841552 5:127852404-127852426 TGCAGTGTTTTCTCACATGGGGG + Intergenic
996907101 5:128613322-128613344 CTCACTGTGTCCTCACTTAAGGG + Intronic
996920981 5:128767494-128767516 ATTGCTGTGTCCTCACATAGTGG - Intronic
997007690 5:129838152-129838174 TTAACTGTGTTTTAACATTGAGG - Intergenic
997165011 5:131651518-131651540 CTCACTGTGTCCTCACATGGTGG + Intronic
997219515 5:132149231-132149253 CTAGCTGTGTTCTCACATAGTGG + Intergenic
997345928 5:133192019-133192041 CTCACTGTGTCCTCACGTGGTGG - Intergenic
997828106 5:137125561-137125583 TTCATTGTGTCCTCACATTGTGG - Intronic
997849257 5:137316156-137316178 AACACTGTGTGCTCACATGGTGG + Intronic
997957344 5:138289388-138289410 TTCACTGTGTTCACTCACACAGG - Intronic
998669786 5:144340693-144340715 TTCGCTGTGTCCTCACAGGGTGG - Intronic
998700768 5:144696941-144696963 TTCACTGTCTTCTGCCATATAGG + Intergenic
999725339 5:154432308-154432330 TTCACTATGTCCTCATACAGTGG + Intergenic
999846615 5:155488392-155488414 TTCACTGTATAATCACATGGTGG - Intergenic
1000239295 5:159394531-159394553 CTTGCTGTGTCCTCACATAGTGG - Intergenic
1000259041 5:159568388-159568410 CTCACTGTGTCCTCACATGGTGG + Intergenic
1000284086 5:159811532-159811554 CTCCCTGTGTGCTCACATGGTGG - Intergenic
1000701468 5:164456620-164456642 TTAGCTGTGTTCGCACATGGTGG - Intergenic
1001341726 5:170853009-170853031 CTCACTGTGTCCTCACATGGTGG + Intergenic
1001351657 5:170973825-170973847 CTCTCTGTGTGTTCACATAGTGG + Intronic
1001477430 5:172060494-172060516 CTCACTGTATCCTCACATAGTGG - Intronic
1001494318 5:172177222-172177244 CTCGCTGTGACCTCACATAGTGG - Intronic
1001663681 5:173415070-173415092 TTCACTGTGCTTTTCCATAGAGG + Intergenic
1001685591 5:173592716-173592738 CTCACTGTGTCCACACATGGGGG - Intergenic
1001837027 5:174841250-174841272 GTCACTGTTTCCTCACATGGTGG - Intergenic
1002397412 5:178968927-178968949 TGCACTGTCTTCTCAGATGGGGG - Intergenic
1002836994 6:873378-873400 CTCCCTGTGTCCTCACATGGTGG - Intergenic
1003193051 6:3890925-3890947 GTTGCTGTGTCCTCACATAGTGG - Intergenic
1003213666 6:4089935-4089957 CTTGCTGTGTCCTCACATAGTGG + Intronic
1003253742 6:4456587-4456609 TTTGCTGTGTCCTCACATGGTGG + Intergenic
1003294333 6:4810746-4810768 CTCACAGTGTCCTCACATGGTGG + Intronic
1003700082 6:8454039-8454061 TTCACTGTCTTGCCATATAGAGG + Intergenic
1003743400 6:8969537-8969559 CTTACTTTGTTCTCACATGGTGG + Intergenic
1003846899 6:10183109-10183131 TTCATTGTGCCCTCACATGGTGG - Intronic
1003877034 6:10447069-10447091 CTCCCTGTGTCCTCACATGGTGG + Intergenic
1003946217 6:11078273-11078295 CTCACTATGTCCTCACATGGTGG - Intergenic
1004249889 6:14015194-14015216 TTTGCTGTGTCCTCACATAGTGG + Intergenic
1004686079 6:17945756-17945778 TTCATTGTGTTCTGCTATAGGGG - Intronic
1005036318 6:21558254-21558276 TTCACTGTGTCCTCACTTGGTGG - Intergenic
1005070917 6:21861552-21861574 TTGGCTGTGTCCTCACATGGTGG + Intergenic
1005194651 6:23268951-23268973 TTAGCTGTGTACTCACATGGTGG - Intergenic
1005787442 6:29260355-29260377 CTCACTGTGTCTTCACATGGTGG + Intergenic
1007076436 6:39069990-39070012 CTCACTGTGTCCTCACATGATGG + Intronic
1007470346 6:42086015-42086037 CTCACTGTGTCCTCACATGGTGG - Intronic
1007888164 6:45256378-45256400 TTCTCTGTTTCCTCACATGGAGG + Intronic
1007945004 6:45818191-45818213 CTCCATGTGTTCTCACATGGTGG - Intergenic
1007966211 6:46005782-46005804 CTCACTGGGTTCTCACATTGTGG - Intronic
1008385798 6:50888355-50888377 CTCACTGTGTCCTCCCATGGTGG - Intergenic
1008397148 6:51022260-51022282 TTCACTGTGTCCTCACATAGTGG + Intergenic
1008668231 6:53738748-53738770 CTCACTGTGTCCTCACATGGTGG + Intergenic
1009293851 6:61918524-61918546 TTCACTGTGATTTTACATGGTGG - Intronic
1009446535 6:63749329-63749351 TGCACTGTGATCTGACAGAGTGG + Intronic
1009580723 6:65529813-65529835 CTCACTGTGTCCTCACATGATGG - Intronic
1009744424 6:67795487-67795509 TTTACTGTGTCCTCACATGGTGG - Intergenic
1009753152 6:67898929-67898951 TTCACTGTGTCCTCACATGGTGG + Intergenic
1009947650 6:70358331-70358353 CTCACTGTGTTCTCACATGGTGG - Intergenic
1010080682 6:71857231-71857253 CTCACTGTGTCCTCAGTTAGTGG - Intergenic
1010098572 6:72076380-72076402 CTCACTGTGCTCTCACATGGTGG + Intronic
1010554838 6:77266160-77266182 CTCACTATGTCCTCACATGGTGG + Intergenic
1010649473 6:78434561-78434583 TTTGCTGTGTCCTCACATGGTGG + Intergenic
1010765544 6:79774413-79774435 CTCCCTGTGTCCTCACACAGTGG + Intergenic
1010986970 6:82435707-82435729 CTCCCTGTGTCCTCACATGGTGG - Intergenic
1011106576 6:83787953-83787975 TACAATGTGTTCTCACACAATGG - Intergenic
1011127356 6:84021442-84021464 CTCGCTGTGTCCTCACATGGTGG - Intergenic
1011170447 6:84499070-84499092 TTCTCTGTGTTCTCACCATGTGG - Intergenic
1011183669 6:84650426-84650448 CTCACTGTGTCCTCACATAGTGG + Intergenic
1011627998 6:89298907-89298929 CTCACTGTAACCTCACATAGTGG - Intronic
1012026933 6:94007812-94007834 TTAGCTGTGTTCTCACATAGTGG - Intergenic
1012519464 6:100103582-100103604 TTTACTGTGTCCTCACATTGTGG + Intergenic
1012646861 6:101695247-101695269 AACACTGTGTCCTCACATGGTGG + Intronic
1012687594 6:102272036-102272058 GTCACAGTGTTATGACATAGTGG + Intergenic
1012713665 6:102640503-102640525 TTTTCTATGTTCTCACATGGTGG + Intergenic
1013053935 6:106564726-106564748 TTCACTGAGTTCCCACACAGAGG - Intronic
1013174415 6:107665098-107665120 TGCACAGAGTTCTCTCATAGAGG - Intergenic
1013186456 6:107763741-107763763 CTTACTGTGTCCTCACATGGTGG - Intronic
1013340092 6:109205550-109205572 CTCCCTGTGTCCTCACATGGTGG + Intergenic
1013398284 6:109766170-109766192 CTCACTGTGTCCTCACATGATGG - Intronic
1013754341 6:113443372-113443394 TTCACTGTAATCTCACATGGTGG - Intergenic
1014127096 6:117789314-117789336 TTCACTGTGATCTCACATGGTGG + Intergenic
1014309605 6:119783337-119783359 CTCACTGTGTCCTCACTTTGGGG - Intergenic
1014503537 6:122224570-122224592 CTCACTGTGTTCTCAGATGGTGG + Intergenic
1014642159 6:123926006-123926028 CTCACTGTGTCCTCACATGGTGG + Intronic
1015175720 6:130305993-130306015 TACAATGTGTCCTCACATGGTGG + Intronic
1015222021 6:130814739-130814761 CTCACTGTGTCCTCACATGGTGG - Intergenic
1015650047 6:135446602-135446624 TTCACTATATTCTCACATGGTGG - Intronic
1016129590 6:140449990-140450012 TTCACTGTGTTCTCACATGGTGG - Intergenic
1016133919 6:140513925-140513947 CTCACCGTGTTCTCAGATAGTGG - Intergenic
1016499691 6:144705515-144705537 CTCACTGTGTCCTCCCATAGTGG + Intronic
1016532057 6:145069688-145069710 CTCACTGTGTCCTCACATGGTGG + Intergenic
1016586058 6:145687256-145687278 CTTGCTGTGTTCTCACATGGTGG - Intronic
1016626885 6:146180966-146180988 TTAAGTGTGTTATCACATTGAGG - Intronic
1016670083 6:146694360-146694382 ACCACTGTGTACTCACCTAGTGG + Intronic
1016719859 6:147283531-147283553 CTCACTGGGAGCTCACATAGGGG - Intronic
1016732407 6:147440742-147440764 CTCACTCTAATCTCACATAGTGG + Intergenic
1016752993 6:147651571-147651593 CTCACTGTGTCCTCACACGGTGG - Intronic
1016767083 6:147806928-147806950 CTCACTGTGTCCTCTCATGGTGG - Intergenic
1016926330 6:149352658-149352680 TTTACTGTGTTATCAACTAGCGG + Intronic
1017284269 6:152656585-152656607 CTCACTGTGTCCTCACATGATGG + Intergenic
1017371467 6:153714221-153714243 TGCACTGTGCCCTCACATGGGGG + Intergenic
1017631958 6:156404758-156404780 TCCACTGTGTTCTACCATACAGG - Intergenic
1018040603 6:159918465-159918487 CTCACTGTGTCCTCACGTGGTGG - Intergenic
1018242395 6:161790604-161790626 CTCACTGTGTCCTCATATGGTGG - Intronic
1018465192 6:164037871-164037893 GTCTCTGTGTTCACACATGGAGG - Intergenic
1018572465 6:165225541-165225563 TTGGCTGTGTCCTCACATGGTGG - Intergenic
1018953564 6:168393678-168393700 GTCACTGTGTTCCCACACACAGG - Intergenic
1019075270 6:169382250-169382272 CTCCCTGTGTCCTCACTTAGTGG + Intergenic
1019621530 7:1994709-1994731 CTCACTGTGTCCTCACACGGTGG - Intronic
1019760675 7:2810257-2810279 CTCACTGTGTCCTCAGATGGTGG + Intronic
1019886642 7:3911460-3911482 TTTGCTGTGTCCTCACATGGCGG + Intronic
1020160412 7:5766528-5766550 CTCCCTGTGTTCTCACATGATGG - Intronic
1020220623 7:6233920-6233942 TTCTCTGTGTCCTCACTTGGTGG + Intronic
1021010061 7:15451522-15451544 CTCACTGTATTCTTACATGGTGG + Intronic
1021062466 7:16130943-16130965 CTCAGTGTGTCCTCACATGGTGG - Intronic
1021526597 7:21595191-21595213 CTCATTGTGTCCTCACATGGAGG + Intronic
1021560077 7:21960891-21960913 CTCACTGTGTCCTCACATGGTGG - Intergenic
1021966111 7:25920703-25920725 TTCACTGTGTCCTCACATGATGG - Intergenic
1022316067 7:29246790-29246812 TTCACTGTGCCCGCACATGGTGG + Intronic
1022323709 7:29310731-29310753 CTCACTGTGTCCTCACATGGTGG + Intronic
1022421006 7:30223275-30223297 TGCACTGTGTTCCCACCTGGAGG - Intergenic
1022781951 7:33594604-33594626 TTCACTGTGTTGTCATATAGAGG - Intronic
1022863987 7:34398392-34398414 CTCTCTGTGTCCTCACATGGTGG + Intergenic
1023559092 7:41453497-41453519 CTCACTGTGTCCTCACATAGTGG - Intergenic
1023624743 7:42104816-42104838 CTCACTGTGTCCTCACGTGGTGG - Intronic
1023679938 7:42675135-42675157 TTCACTGTGTCCTCACATAGTGG + Intergenic
1024189407 7:46990471-46990493 TTTACTGTGTCCTTACATGGTGG - Intergenic
1024760853 7:52594692-52594714 GTCACTGTGTCCTCACATGGTGG - Intergenic
1025866742 7:65389326-65389348 TTTATTTTGCTCTCACATAGGGG + Intronic
1026028500 7:66767712-66767734 CTCCCTGTGTCCTCACATGGTGG - Intronic
1027617648 7:80443646-80443668 CTCTCTGTGTCCTCACATGGTGG + Intronic
1028176321 7:87663858-87663880 CTCACTGTGTCCTCACTTGGTGG + Intronic
1028286517 7:89009681-89009703 CTCCCTGTGTCCTCACATGGTGG - Intronic
1028786918 7:94805611-94805633 CTCGCTCTGTCCTCACATAGTGG - Intergenic
1028862756 7:95672087-95672109 CCCACTATGTCCTCACATAGTGG - Intergenic
1028906518 7:96160556-96160578 CTCACTGTGTCCTCACATGGAGG + Intronic
1029955466 7:104634349-104634371 CTCATTGTGTCCTCACATGGTGG + Intronic
1029972460 7:104802553-104802575 TTCTCTCTGTCCTCACATGGTGG - Intronic
1030081940 7:105785784-105785806 CTCACTGTGTCCTCACATGGTGG - Intronic
1030288900 7:107853035-107853057 TGCACTGTGTTTTGACATTGGGG + Intergenic
1030433568 7:109485204-109485226 CTCACTGTCTCCTCACATAATGG - Intergenic
1030605996 7:111639633-111639655 CTCACTGTGTCCTCACATGATGG - Intergenic
1030649568 7:112102617-112102639 CTCACTGTGTCCTCACATGTTGG - Intronic
1030688260 7:112508181-112508203 CTCACTGTGTCCTCACATGGTGG + Intergenic
1030776812 7:113543667-113543689 CTCACTGTGTCTTCACATGGTGG - Intergenic
1030817160 7:114052490-114052512 AACACTGTGTCCTCACATGGTGG - Intronic
1031020237 7:116620109-116620131 CTCACTGTGTTCTCACATGATGG + Intergenic
1031213513 7:118860745-118860767 CTCACTGTGTCCTCACATGGTGG + Intergenic
1031273975 7:119694244-119694266 AACACTGTGTCCTCACATGGTGG - Intergenic
1031417902 7:121515280-121515302 TTCACTGTGTCCTTATATGGTGG + Intergenic
1031516973 7:122712807-122712829 TTCGCTGTGTTCTTACATTGTGG + Intronic
1031609535 7:123808834-123808856 TTCACTGTTTCCTCACATGGTGG + Intergenic
1031656780 7:124365571-124365593 TCCACTGTCTACTCACATAGTGG + Intergenic
1031820379 7:126493552-126493574 CTCATTTTCTTCTCACATAGTGG - Intronic
1032790776 7:135240978-135241000 CTTGCTGTGTTCTCACATGGGGG + Intronic
1033221934 7:139532732-139532754 CTTACTGAGTCCTCACATAGCGG - Intronic
1033780383 7:144662324-144662346 CTCACTTTGTCCCCACATAGTGG - Intronic
1033944947 7:146705384-146705406 TTTTCTGTGTTCTCGCATGGTGG + Intronic
1033999621 7:147396566-147396588 TTAATTGTATTCTCACACAGTGG + Intronic
1034100830 7:148449036-148449058 CTCACCGTGTCCTCACATGGTGG - Intergenic
1034380595 7:150688808-150688830 TCCACAGTGTTCTCGCACAGTGG - Intronic
1034420472 7:150988009-150988031 CTCACTGTGTCCTCACATGATGG + Intergenic
1034420480 7:150988071-150988093 CTCACTGTGTCCTCACATGATGG + Intergenic
1034472015 7:151260095-151260117 TTCACTGTGCTATCACAGGGTGG + Intronic
1034737158 7:153439975-153439997 CTCCCTGTGTCCTCACATGGCGG - Intergenic
1034996830 7:155582622-155582644 TTCGATGTGCTCTCACATGGTGG - Intergenic
1035333169 7:158109554-158109576 TTCACTGAGTCTTCACATAGGGG - Intronic
1035461098 7:159039664-159039686 TTCTCTGTGTCCTCACGTGGTGG - Intronic
1035702570 8:1647884-1647906 TTCCCTGCGTCCTCACATGGTGG + Intronic
1035901628 8:3462988-3463010 CTCACTGTGTCCTCACGTGGTGG - Intronic
1037154615 8:15684677-15684699 TTCTCTGTGTTCTGAGATTGAGG + Intronic
1037223729 8:16557043-16557065 TGAATTGTGTTCTCACATATTGG - Intronic
1037457741 8:19081051-19081073 TTCCCTGGGTTCCCACAGAGGGG + Intronic
1037486779 8:19355371-19355393 TTCACTCTGTTCCCAAATAGAGG + Intronic
1037517165 8:19644168-19644190 TGCACTGTGTGCACACATATTGG - Intronic
1038269963 8:26067099-26067121 CTTGCTGTGTCCTCACATAGTGG - Intergenic
1038381267 8:27096594-27096616 CTTACTGTGTCCTCACATGGTGG + Intergenic
1038604465 8:28985269-28985291 TTCATTGTGTTCTCACGTAGTGG + Intronic
1038867176 8:31452010-31452032 AACGCTGTGTCCTCACATAGTGG - Intergenic
1038890079 8:31711824-31711846 TTCACTGTATCCTCACGTAATGG + Intronic
1038921414 8:32088844-32088866 ATTACTGTTTTCTAACATAGAGG - Intronic
1038990087 8:32858477-32858499 TTCATTGTGTTCTCTCATTAGGG - Intergenic
1039099741 8:33928477-33928499 TTCACTGCATTCTCACATGGTGG + Intergenic
1039218918 8:35306259-35306281 TTCAATATGTTCTCACCTAATGG + Intronic
1040889735 8:52304815-52304837 CTTGCTGTGTTCTCACATGGAGG + Intronic
1041748043 8:61230888-61230910 TTTGATGTGTGCTCACATAGTGG + Intronic
1042365952 8:67936628-67936650 CTCCCTGTGTCCTCACAGAGTGG + Intergenic
1042702060 8:71626037-71626059 CTCACTGTATTCTCATATAGTGG - Intergenic
1042736743 8:71998172-71998194 GTTTCTGTGTTCTCACATGGTGG + Intronic
1042775883 8:72430804-72430826 ATCACTGTGTCCTCACATGGTGG + Intergenic
1042866249 8:73358934-73358956 TTCACTGTGTCCTTACGTGGAGG - Intergenic
1043022427 8:75020496-75020518 TTCTCTGTGTCCTCACATGGTGG + Intronic
1043141249 8:76593003-76593025 CTCACTGTGACCTCACATGGCGG + Intergenic
1043855431 8:85259564-85259586 TTCACAGTTTTCCCACATGGTGG + Intronic
1043979659 8:86623486-86623508 AACACTGTGTCCTTACATAGTGG + Intronic
1044064444 8:87682308-87682330 TTTGCTGTGTCCTTACATAGTGG - Intergenic
1044076943 8:87833434-87833456 CTCACTGGGTACTCACATGGTGG - Intergenic
1044097070 8:88079813-88079835 TTAGCTGTGTTCTCACACAGTGG - Intronic
1044105189 8:88196159-88196181 TTCTCTGCTTTCTCAAATAGAGG - Intronic
1044124736 8:88444202-88444224 TTTTCTGTGTCCTCACATGGTGG + Intergenic
1044220706 8:89665644-89665666 CTAGCTGTGTTCTCACATGGTGG - Intergenic
1044409734 8:91869423-91869445 TTTGCTGTGTCCTCACACAGTGG - Intergenic
1044548146 8:93482341-93482363 CTCACTGTATCCTCACATGGTGG - Intergenic
1044601926 8:94013692-94013714 TTTACTGTTTCCTCACAGAGAGG + Intergenic
1044608165 8:94065002-94065024 TTCTCTGTTTTGTCACAAAGCGG + Intergenic
1044719139 8:95129017-95129039 CTCACTGTGTTCTCATGTGGTGG + Intergenic
1045297609 8:100885752-100885774 CTCACTGTGTCCTCACATCGGGG - Intergenic
1045432596 8:102127259-102127281 TTCCATGTGTTCTCATAGAGTGG + Intergenic
1045468872 8:102493483-102493505 TCCACTGTGTCCTCACGTGGTGG - Intergenic
1045495690 8:102706463-102706485 TTCACTGTAACCTCACACAGTGG - Intergenic
1045554299 8:103200744-103200766 CTTGCTGTGTTCTCACATGGTGG + Intronic
1045651294 8:104343788-104343810 CTCCCTGTGTCCTCACATGGCGG - Intronic
1045719624 8:105093014-105093036 TTTACTGTGTCCTCACATGTTGG - Intronic
1046079429 8:109353337-109353359 TTCACTGCATCCTCACATGGTGG + Intergenic
1046245066 8:111548823-111548845 TTTGCTGTGTCCTCACATGGTGG + Intergenic
1046264050 8:111807785-111807807 CTCTCTGTGTCCTCACAGAGTGG + Intergenic
1046358205 8:113115947-113115969 CTTGCTGTGTCCTCACATAGAGG - Intronic
1047432863 8:124807669-124807691 GTCACTGTGTCCTCACATGGTGG - Intergenic
1047441038 8:124879033-124879055 CTCACTGTGTCCTTACATGGCGG + Intergenic
1047597449 8:126393276-126393298 CTCACTGTGTTCTCATAATGTGG - Intergenic
1047914844 8:129571971-129571993 TTCACTCTGTTCACATAAAGGGG + Intergenic
1048165823 8:132060442-132060464 TTCAATGGGTTCTTCCATAGAGG - Intronic
1048428451 8:134344426-134344448 CTCACTGTGTCCTCACATGAAGG + Intergenic
1048501644 8:134981443-134981465 ATCACTACATTCTCACATAGAGG - Intergenic
1048685223 8:136897457-136897479 TTCACTGTGCCCTCACATGGTGG - Intergenic
1048874638 8:138827386-138827408 TTCCCTGTACTCTCACATGGTGG - Intronic
1049025119 8:139983148-139983170 CTCACTGTGTCCTCACATGGTGG - Intronic
1049343141 8:142124446-142124468 TCCACTGTGTTCTTATCTAGAGG + Intergenic
1049837241 8:144744650-144744672 CTCACTGTGTCCTCACATGGTGG - Intronic
1049860395 8:144894326-144894348 GTCACTGTGTTCTCACAGGAAGG - Intronic
1050038743 9:1465099-1465121 CTCACTGTATTCTCACATAGGGG - Intergenic
1050057303 9:1669049-1669071 CTAGCTGTGTCCTCACATAGTGG - Intergenic
1050211431 9:3262797-3262819 TTCACAGTGTTCTGAAAGAGAGG - Intronic
1050235664 9:3576537-3576559 CTTACTATGTCCTCACATAGAGG + Intergenic
1050637142 9:7624451-7624473 CTCACTGTGTTCTCACATGGTGG + Intergenic
1050687069 9:8183790-8183812 CTTACTGTGATCTCACATAGGGG + Intergenic
1051039969 9:12796724-12796746 TTTACTGAGCTCTCACATAGAGG + Intronic
1051108851 9:13611949-13611971 TTCTTTGTGTCCTCACATGGTGG + Intergenic
1051401257 9:16685513-16685535 TTAACTGTTTTCTCAGCTAGGGG - Intronic
1051588979 9:18756806-18756828 AACACTGTGTTCACACAGAGAGG - Intronic
1051737376 9:20215158-20215180 CTCACTGTGTCCTCACATGGTGG + Intergenic
1051760547 9:20458618-20458640 CTCACCATGTCCTCACATAGAGG - Intronic
1051968678 9:22861747-22861769 CTCACTATGTCCTCACACAGTGG + Intergenic
1052116646 9:24656575-24656597 TTTGCTGTGTCCTCACACAGTGG + Intergenic
1052399134 9:27978520-27978542 CTCCCTGTGTCCTCACATGGTGG - Intronic
1052694344 9:31856532-31856554 TTCACTGTGGTCTGACAGTGTGG - Intergenic
1053089877 9:35265337-35265359 TTTGCTGTGTCCTCACATGGTGG - Intronic
1053493070 9:38525986-38526008 AACACTGTGTCCTCACATGGTGG - Intergenic
1053723364 9:40971983-40972005 AACACTGTGTCCTCACATGGTGG - Intergenic
1054891205 9:70253743-70253765 CTCACTGTGTCCTCCCATGGTGG - Intergenic
1054962027 9:70979851-70979873 CTCACTGTGTCCTCACTTGGTGG + Intronic
1054972042 9:71099211-71099233 CTCACTCTGTCTTCACATAGTGG + Intronic
1054999656 9:71434343-71434365 TTTGCTGTGTTCTTACGTAGTGG - Intronic
1055370562 9:75593780-75593802 CTCATTGTGTCCTCACATGGTGG - Intergenic
1055466413 9:76570970-76570992 CTAACTGTGTCCTCACATGGTGG + Intergenic
1055570066 9:77607789-77607811 CTTACTGTGTCCTCACATGGTGG + Intronic
1055618211 9:78095116-78095138 TTTGCTGTGTCCTCACATGGTGG - Intergenic
1055633933 9:78255548-78255570 TTCACCATGTCCTCACATGGTGG + Intronic
1055884442 9:81043957-81043979 TTCTCTGTGTACTCAAAGAGTGG - Intergenic
1056348539 9:85723877-85723899 TTCATTGTGTGCTCACATGGTGG - Intronic
1056495359 9:87149851-87149873 TTCCCTGTGTCCTCATATGGTGG - Intronic
1056666362 9:88583829-88583851 CTCAGTGTGTTCTCACATGGTGG - Intronic
1056735175 9:89203308-89203330 CTCACTGTGTCTTCACATGGAGG + Intergenic
1056939375 9:90941911-90941933 CTTACTGTGTACTCACACAGGGG + Intergenic
1057057791 9:91977319-91977341 AGCACTGTGTTCTCACTTAGTGG - Intergenic
1057079202 9:92159738-92159760 TTCACCGTGTTCTCACTCTGTGG - Intergenic
1057135045 9:92681692-92681714 CTCACTGTGTCCCCACATAGTGG + Intergenic
1057240214 9:93401043-93401065 GTCACTGTGTCCCCACAGAGTGG - Intergenic
1057673307 9:97114899-97114921 AACACTGTGTCCTCACATGGTGG - Intergenic
1057853167 9:98580938-98580960 TTCACTCTGCTCCCATATAGCGG - Intronic
1057945468 9:99324261-99324283 TTGACTGTGTTGTCACATAGGGG - Intergenic
1057958318 9:99430438-99430460 TTCATTGTGTCCTCACAAGGCGG + Intergenic
1058636299 9:107041684-107041706 CTCTCTGTGTCCTCACATGGTGG + Intergenic
1058862410 9:109128867-109128889 CTCATTGTGTACTCACATGGTGG + Intergenic
1058890738 9:109358521-109358543 TTCACTGTGTCCTCACATGGTGG - Intergenic
1059142951 9:111871164-111871186 TTTGCTGTGTCCTCACATAGTGG - Intergenic
1059388902 9:113986548-113986570 GTCACTGTGTCCTCACGTGGGGG + Intronic
1059465146 9:114464448-114464470 CTTACTGTGTCCTCACATGGTGG + Intronic
1059564702 9:115372130-115372152 CTCTCTGTATGCTCACATAGTGG + Intronic
1059726288 9:117011395-117011417 CTCCCTGTGTTCTCACATGGTGG - Intronic
1059794162 9:117673205-117673227 CTCACTGTGTCCTCACATAGAGG - Intergenic
1060496319 9:124121837-124121859 CTCACTGTGTCCTCACATGGTGG + Intergenic
1061272708 9:129552560-129552582 TTAGCTGTGTCCTCACATGGAGG + Intergenic
1062102616 9:134736335-134736357 CTTGCTGTGTCCTCACATAGCGG + Intronic
1203451785 Un_GL000219v1:123998-124020 AACACTGTGTCCTCACATAGTGG + Intergenic
1185676793 X:1855884-1855906 CCCACTGTGTCCTCACATAGTGG + Intergenic
1185676820 X:1856038-1856060 CCCACTGTGTCCTCACATAGTGG + Intergenic
1185676848 X:1856192-1856214 CCCACTGTGTCCTCACATGGTGG + Intergenic
1185676862 X:1856269-1856291 CCCACTGTGTCCTCACATGGTGG + Intergenic
1185759867 X:2682230-2682252 TTTGCTGTGTTCTCACATGGAGG + Intergenic
1185815994 X:3156464-3156486 CTCACTGTGTCCTCCCATGGTGG - Intergenic
1185842602 X:3406534-3406556 CTTGCTGTGTTCTCACATGGTGG - Intergenic
1185869680 X:3653261-3653283 CTCGCTGTGTCCTCACATGGTGG - Intronic
1185872259 X:3673901-3673923 TTCACTGTGTCCTCACATGGTGG - Intronic
1185875180 X:3696159-3696181 CTCACTGTGTCCTCACATGGTGG - Intronic
1185876326 X:3705238-3705260 CTCACTGTGTCCTCATATAGTGG + Intronic
1185876761 X:3708192-3708214 CTCGCTGTGTCCTCACATGGTGG - Intronic
1185881537 X:3745684-3745706 CTCACTGTGTCCTCACATGGTGG + Intergenic
1185962716 X:4563342-4563364 CTCGCTGTGTCCTCACACAGTGG + Intergenic
1185970892 X:4662414-4662436 CTCGCTGTGTCCTCACATATTGG + Intergenic
1186007911 X:5094721-5094743 CTCACTGTGGCCTCACATGGTGG + Intergenic
1186027018 X:5324281-5324303 CTCACTGTGTTCTCACATGGTGG - Intergenic
1186054870 X:5639411-5639433 CTCACTGTGTCCTCACATGGTGG - Intergenic
1186066795 X:5775264-5775286 CTCGCTGTGTCCTCACATGGTGG + Intergenic
1186079199 X:5912269-5912291 TCCTCTGTGTCCCCACATAGAGG + Intronic
1186096002 X:6102447-6102469 CTCACTGTGTCCTCACATAGTGG - Intronic
1186175123 X:6918694-6918716 TTCACTGTAACCTCACGTAGTGG + Intergenic
1186211399 X:7253975-7253997 CTCACTGTGTCTTCACATGGTGG + Intronic
1186228985 X:7432103-7432125 CTCTCTGTGTCCTCACATGGTGG - Intergenic
1186313898 X:8348520-8348542 TTCTCTGTGTCTTCACATGGTGG + Intergenic
1186364414 X:8876018-8876040 CTCCCTGTGTCCTCACATGGTGG - Intergenic
1186387189 X:9121763-9121785 CTCACTGTGTCTTCACATGGAGG - Intronic
1186408756 X:9327147-9327169 CTCGCTGTGTCCTCACATGGTGG - Intergenic
1186422665 X:9438802-9438824 CTCCCTGTGTCCTCACATGGTGG + Intergenic
1186442745 X:9600297-9600319 TTTGCTGTGTTCTCACATGGTGG + Intronic
1186645466 X:11502428-11502450 CTCACTTTGTTTTCACAAAGTGG - Intronic
1186987057 X:15028493-15028515 CTCACTGTGTCCTCATATGGTGG - Intergenic
1187178179 X:16915790-16915812 CTCGCTGTGTCCTCACATAATGG - Intergenic
1187396220 X:18921864-18921886 TTCAATGTGTTGTCTCATTGAGG - Intronic
1187729202 X:22235522-22235544 CTCTCTGTGTCCTCACATGGTGG + Intronic
1187784185 X:22866095-22866117 TTCAGTGTGTCCTCACATGATGG - Intergenic
1187799333 X:23042900-23042922 TTGACTGTGTTCTCCCATCCTGG - Intergenic
1188038972 X:25350306-25350328 TTCTCTGTGTTCTGACATTGAGG + Intergenic
1188425566 X:30043274-30043296 CTCACTGTGTCCTCACATGGTGG + Intergenic
1188649468 X:32613951-32613973 TTCACAGAGTTTTCACATGGTGG + Intronic
1189219950 X:39363018-39363040 CTCACTGTGTCTTCACATGGTGG - Intergenic
1189241351 X:39526913-39526935 CTCATTGTGTCCTCACATGGTGG - Intergenic
1189554200 X:42125505-42125527 CTCTCTGTGTCCTCACATGGTGG + Intergenic
1189560235 X:42184767-42184789 CTCACTGTGTCCTCAGATGGTGG - Intergenic
1189631277 X:42956337-42956359 CTCACTGTGTCCTCACATGATGG + Intergenic
1190241007 X:48658246-48658268 TTCATTGTATCCTCACATTGTGG + Intergenic
1190242417 X:48667832-48667854 CTCGTTGTGTCCTCACATAGTGG + Intergenic
1190442024 X:50484115-50484137 CTCACTGTGTCCTCACATGGTGG + Intergenic
1190537173 X:51440852-51440874 CTCACTGTGTCTTCACATGGTGG - Intergenic
1190762348 X:53447005-53447027 CTCACTGTGTCCTCACCTGGTGG - Intergenic
1190895909 X:54617739-54617761 CTAGCTGTGTTCTCACACAGTGG - Intergenic
1192171451 X:68857896-68857918 CTCACTGTGTCCTCACGTGGTGG + Intergenic
1193136948 X:77983004-77983026 CTCCCTGTGTCCTCACATGGTGG + Intronic
1193497087 X:82228223-82228245 CTCCCTGTGTTCTCACATGGTGG + Intergenic
1193578091 X:83228820-83228842 TTCACTGTGGTCTGACAGTGTGG + Intergenic
1194046831 X:89017712-89017734 TTTATTGTGTTCTCACATGGTGG - Intergenic
1194056635 X:89143117-89143139 TTTACAGTGTTCTCCCATTGTGG + Intergenic
1194445308 X:93980974-93980996 TTTACTGTGTCCTCAGATGGTGG + Intergenic
1194525746 X:94975633-94975655 TGCACTGTGTTCTAACAGAGAGG + Intergenic
1194539367 X:95152317-95152339 AACACTGTGTTCTCACATGATGG + Intergenic
1194736714 X:97521131-97521153 CTCACTGTGCCCTCACATGGTGG - Intronic
1194947454 X:100085849-100085871 CTCCCTGTGTTCTCACATGGTGG - Intergenic
1195407771 X:104535446-104535468 CTTGCTGTGTCCTCACATAGTGG - Intergenic
1195482604 X:105364017-105364039 TTCCCTGTGTTTTCTTATAGCGG + Intronic
1195545013 X:106104464-106104486 TTTTCTGTGTCCTCACATAGTGG + Intergenic
1195774965 X:108392776-108392798 CTCACTGTGTTCTCATGTGGTGG - Intronic
1196005139 X:110828872-110828894 TTCACTGTGTCCTCACATGGTGG + Intergenic
1196076741 X:111586084-111586106 CTCACTGTGTCCTCACATGGTGG - Intergenic
1196298717 X:114029953-114029975 CTTACTGTGTCCTCACATGGGGG - Intergenic
1196972805 X:121127963-121127985 CTCACTGTGTTGTCACATGATGG + Intergenic
1197004791 X:121482396-121482418 TTCTGTGTGTTCTCACATGGTGG + Intergenic
1197299627 X:124762117-124762139 CTCGTTGTGTTCTCACATGGTGG + Intronic
1197787141 X:130210030-130210052 CTCACTGCGTCCTCACATGGTGG - Intronic
1197788426 X:130224232-130224254 CTCACTGTGTCTTCACATGGGGG - Intronic
1197914180 X:131516870-131516892 TTCACTGTGTCCTCACATAGTGG - Intergenic
1198463263 X:136882927-136882949 CTCACTGTGTTCTCACATGGTGG - Intergenic
1198671779 X:139088918-139088940 CTCACTGTGTCCTCACATGGTGG - Intronic
1198753107 X:139954944-139954966 TTCACTGTGTCCTCACATTGCGG + Intergenic
1198891845 X:141405000-141405022 AACACTGTGTCCTCACATGGTGG - Intergenic
1199133421 X:144222370-144222392 CTCACTGTGTCCTCACATGGTGG + Intergenic
1199301301 X:146217447-146217469 TAGACTATGTTCTCACATAGTGG - Intergenic
1199585257 X:149408252-149408274 CCCACTGTATCCTCACATAGTGG - Intergenic
1199971666 X:152866212-152866234 TTCACCATGTCCTCACATGGTGG + Intronic
1200078318 X:153562927-153562949 CTCACTCTGTGCTCACATGGTGG + Intronic
1200374416 X:155764991-155765013 CTCACTGTGTCCTCACATGATGG + Intergenic
1200788602 Y:7280218-7280240 CTCGCTGTGTCCTCACATGGTGG + Intergenic
1200791645 Y:7304780-7304802 TTCACTGTGTCCTCACATGGTGG + Intergenic
1201265453 Y:12202135-12202157 CTCACTGTGTCCTCCCATGGTGG + Intergenic
1201528215 Y:14960276-14960298 CTCACTGTGTCCTAACATGGTGG - Intergenic
1201538332 Y:15076993-15077015 TTCACTGTGCTCACACACTGAGG + Intergenic
1201719430 Y:17080568-17080590 TTCACTGTTTTCTCAAACATGGG - Intergenic
1201962596 Y:19698687-19698709 GTCACTGTGTTCTCACACAGTGG + Intergenic
1202259479 Y:22955351-22955373 CTCACAGTGTTCTCTCACAGGGG + Intergenic
1202359639 Y:24094343-24094365 TTTACTGTATTTTCAGATAGAGG - Intergenic
1202412465 Y:24589095-24589117 CTCACAGTGTTCTCTCACAGGGG + Intergenic
1202458315 Y:25080975-25080997 CTCACAGTGTTCTCTCACAGGGG - Intergenic
1202511139 Y:25575771-25575793 TTTACTGTATTTTCAGATAGAGG + Intergenic