ID: 1095444989

View in Genome Browser
Species Human (GRCh38)
Location 12:42274032-42274054
Sequence TCCAGCTGGCCCGCAAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 2, 1: 13, 2: 9, 3: 26, 4: 135}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095444973_1095444989 25 Left 1095444973 12:42273984-42274006 CCGGCCCCTCCGAGTGTGGGGCC 0: 1
1: 20
2: 160
3: 504
4: 632
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444976_1095444989 19 Left 1095444976 12:42273990-42274012 CCTCCGAGTGTGGGGCCCACCAA 0: 1
1: 2
2: 1
3: 13
4: 65
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444969_1095444989 29 Left 1095444969 12:42273980-42274002 CCGGCCGGCCCCTCCGAGTGTGG 0: 1
1: 17
2: 145
3: 378
4: 559
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444979_1095444989 3 Left 1095444979 12:42274006-42274028 CCACCAAGCCCACACCCACCCGG 0: 37
1: 494
2: 531
3: 386
4: 740
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444974_1095444989 21 Left 1095444974 12:42273988-42274010 CCCCTCCGAGTGTGGGGCCCACC 0: 2
1: 30
2: 116
3: 208
4: 285
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444981_1095444989 0 Left 1095444981 12:42274009-42274031 CCAAGCCCACACCCACCCGGAAC 0: 63
1: 709
2: 625
3: 344
4: 428
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444978_1095444989 4 Left 1095444978 12:42274005-42274027 CCCACCAAGCCCACACCCACCCG 0: 10
1: 134
2: 522
3: 520
4: 709
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444977_1095444989 16 Left 1095444977 12:42273993-42274015 CCGAGTGTGGGGCCCACCAAGCC 0: 22
1: 155
2: 372
3: 335
4: 379
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444983_1095444989 -6 Left 1095444983 12:42274015-42274037 CCACACCCACCCGGAACTCCAGC 0: 27
1: 491
2: 428
3: 499
4: 809
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444975_1095444989 20 Left 1095444975 12:42273989-42274011 CCCTCCGAGTGTGGGGCCCACCA 0: 1
1: 1
2: 2
3: 8
4: 103
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135
1095444982_1095444989 -5 Left 1095444982 12:42274014-42274036 CCCACACCCACCCGGAACTCCAG 0: 25
1: 477
2: 408
3: 455
4: 596
Right 1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG 0: 2
1: 13
2: 9
3: 26
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095444989 Original CRISPR TCCAGCTGGCCCGCAAGCAC TGG Intronic
902443850 1:16449030-16449052 ACCAGCTGCCCTGCAATCACTGG - Intronic
903500190 1:23796352-23796374 AGCGGCTGGCCCGCAGGCACCGG + Intronic
904270909 1:29349484-29349506 TCCATGTGGCCCCCAAGCCCAGG - Intergenic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
905625928 1:39490937-39490959 TCCAGCTGGGCCAGAAGCTCTGG - Intergenic
906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG + Intronic
910220978 1:84889213-84889235 TCCAGCTGGCTTGCCAGGACAGG + Intronic
910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG + Intergenic
913371671 1:118106470-118106492 TGCAGTTGGCCTGGAAGCACTGG + Intronic
914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
915004368 1:152622994-152623016 TCCAGCTGTGCCCCAAGCTCTGG - Exonic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG + Intergenic
1065863061 10:29887605-29887627 TCAAGCAGTCCCGCAAGAACTGG + Intergenic
1067062410 10:43084479-43084501 TGCAACTGGCCAGCATGCACAGG - Intronic
1067707728 10:48623268-48623290 CCCAGCTGGTCAGCCAGCACTGG + Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG + Intergenic
1076817110 10:132920478-132920500 TCCAGCTGCCCTCCAAGCAGAGG + Intronic
1077392646 11:2307184-2307206 CCCTGCTGGCCCCCAAGCACAGG - Intronic
1080258538 11:30321000-30321022 TCCACCTGGCCCTCTAGCCCAGG + Intergenic
1081813731 11:45927424-45927446 TCCTGCCGGGCAGCAAGCACTGG - Exonic
1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG + Intronic
1083886600 11:65576240-65576262 TCCCGCTGGCCCGCCACCGCTGG - Exonic
1084712347 11:70851796-70851818 TCCAACTGGACCCCAAGCTCTGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088628621 11:111752157-111752179 ACCAGCTGGCCTGCCAGCAGCGG + Exonic
1090223153 11:125048661-125048683 TCCCCCTGGCCCCCAAACACAGG + Intergenic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1095234333 12:39778365-39778387 TACAGCTGGCCCCCAAGAGCTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1095923179 12:47551637-47551659 TCCAGATGGCCCTGGAGCACAGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099380896 12:81951047-81951069 TCCACATGACCAGCAAGCACCGG - Intergenic
1101789289 12:107912827-107912849 TGCAGCTGGCCCTCCCGCACTGG + Intergenic
1102661786 12:114535300-114535322 TTCAGCTGGGCCACAAGTACTGG - Intergenic
1107456530 13:40560592-40560614 TCCAAATGGCCTGCAAGCCCTGG - Exonic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1118690947 14:68339221-68339243 TTAAGCTGGCCCACAAGTACAGG - Intronic
1118888334 14:69885832-69885854 TTAAGCTGGCCCACAAGTACAGG - Intronic
1119303685 14:73590698-73590720 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1125320348 15:38480482-38480504 TCTACCTGACCCCCAAGCACAGG - Intronic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1131912560 15:97224278-97224300 TCGCGCTGGCCCGCCAGCGCCGG - Intergenic
1132653190 16:1030757-1030779 TCCAGCCGGCCCACACCCACTGG - Intergenic
1133344424 16:5060411-5060433 TCCAGCTGACCCTCCAGCCCGGG - Exonic
1134177165 16:12016689-12016711 TGCAGATGGCCAACAAGCACAGG - Intronic
1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG + Intergenic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG + Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1141679981 16:85538198-85538220 CCCGGCTGGCCCGCCAGCAATGG + Intergenic
1144863820 17:18322499-18322521 TCCACCTAGCCAGCATGCACTGG - Intronic
1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG + Intergenic
1149058279 17:52390606-52390628 TCCTGCTGACCCACAAGCCCAGG - Intergenic
1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG + Intergenic
1153977820 18:10284935-10284957 CCCAGCTGTCCCTCAGGCACAGG - Intergenic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG + Intergenic
1157620524 18:49014609-49014631 TCCATCTGACCCGGGAGCACTGG + Intergenic
1160904191 19:1444919-1444941 GGCAGCTGACCCGCAAGCGCCGG - Intergenic
1160983359 19:1826773-1826795 TCCAGTTGGCTCGGAGGCACGGG - Intronic
1160989494 19:1854681-1854703 ACGAGCTGGCCCGCCACCACCGG - Exonic
1162584781 19:11552087-11552109 TTGAGCTGGCCCGGAAGCCCTGG - Intronic
1163233946 19:16020419-16020441 GCCAGCTGGCAGGGAAGCACCGG + Intergenic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166774164 19:45302532-45302554 TCCTGCTGGCCTGCCTGCACGGG + Exonic
925288578 2:2731357-2731379 TCCAGCTGGCTCCCAAGGCCTGG - Intergenic
925413431 2:3653416-3653438 TCCAGGTGACCGGCAAGGACTGG + Intergenic
927515626 2:23670183-23670205 TCCAGTTAGCCCGCGAGCTCAGG - Intronic
928411887 2:31060716-31060738 ACCTGCTGGGCCCCAAGCACCGG - Intronic
928728777 2:34206670-34206692 TCCAGCTTGGCCACATGCACTGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
932831952 2:74998774-74998796 TGCAGCAGGCCCACATGCACTGG - Intergenic
933060846 2:77735002-77735024 GCCGGCCGGCCCGCAAGCCCTGG - Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
937980044 2:127609415-127609437 TCCAGCAGGCCGGGCAGCACGGG - Intronic
938904703 2:135826833-135826855 GTCAGCCAGCCCGCAAGCACAGG + Intronic
940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG + Intronic
941178861 2:162234890-162234912 TCTAGCTGGCCGGCAAGCGTGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG + Intergenic
945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948768416 2:240235105-240235127 TGCAGCTGGCCAGGACGCACAGG - Intergenic
1169204754 20:3733264-3733286 TCAAGCTGGCCCGGAAGACCAGG - Intronic
1175460672 20:59149831-59149853 TCCAGCTGGCCGGTGTGCACAGG + Intergenic
1177318696 21:19493628-19493650 TCGCGCTGGCCGGCAAGCGCCGG - Intergenic
1178408944 21:32348044-32348066 TCCACCTGCCCCGGAAGGACTGG + Intronic
1180242948 21:46524050-46524072 TCCAGCTGTCCCGTCAGCTCTGG + Intronic
1181038068 22:20179376-20179398 TCCAGGTGGGCCTCAAGCCCAGG - Intergenic
1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG + Intergenic
1184057216 22:42060586-42060608 TCCAGCAGGTGCCCAAGCACGGG + Intronic
1184106013 22:42368028-42368050 TCCAGGTGGCCCCGCAGCACTGG - Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950574702 3:13825159-13825181 TCCAGCTGGTCCCCTGGCACTGG - Intronic
950668220 3:14509955-14509977 TCCAGCTCATCTGCAAGCACGGG + Exonic
952925261 3:38315452-38315474 CCCAGCTGGCCAGCAGGCTCAGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG + Intronic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
957074055 3:75587830-75587852 TCCAGCTGGCAGGGAAGCGCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960868602 3:122227440-122227462 GCTGGCTGGCCCGCAAGCCCCGG - Intronic
961455661 3:127022694-127022716 TCCAGCTGTCCAGCAGGCACAGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
968135420 3:196216678-196216700 TCCAGCAATCCCGCAGGCACCGG - Exonic
968657876 4:1786456-1786478 TCCAGCTCAGCCGCAGGCACTGG - Intergenic
973144285 4:46805121-46805143 TCGCGCTGGCCTCCAAGCACCGG + Intronic
973764339 4:54149628-54149650 TCGCGCTGGCCGGCGAGCACGGG + Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
975754795 4:77561919-77561941 TTGTGCTGGCCCACAAGCACTGG - Intronic
980822468 4:138035744-138035766 TTCAGCTGGCCTGCCAGCATTGG - Intergenic
980827332 4:138088828-138088850 GCCGGCCAGCCCGCAAGCACCGG - Intergenic
980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984728631 4:183045108-183045130 TCGCACTGGTCCGCAAGCACGGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987196400 5:15530810-15530832 CCCAGCTGGCCCCAAAGCATGGG - Intronic
988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG + Intronic
992717881 5:79529582-79529604 TTAAGCTGGCCCACAAGTACAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995112385 5:108442301-108442323 GCCAGCCGGCCCGCAAGCCCCGG - Intergenic
998132513 5:139658567-139658589 TGCGGCTGGCCCACAGGCACAGG + Intronic
999327141 5:150650368-150650390 TCCATCTGGCCCTCAAGGAGGGG - Exonic
1000609117 5:163355889-163355911 TCGCACTGGCCCACAAGCACCGG - Intergenic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1002790740 6:435800-435822 GCCAGTTGGCCCGCAAGTCCCGG - Intergenic
1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG + Intergenic
1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1004262279 6:14118381-14118403 ACCTGCTGGCCCACAACCACAGG - Intronic
1004338227 6:14783826-14783848 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1004906184 6:20239095-20239117 TCGCGCTGGCCCACAAGTACCGG - Intergenic
1008017073 6:46532467-46532489 TGCAGCTGGCCTACAAGAACAGG + Intergenic
1008092798 6:47309539-47309561 TCCAGCTGCCCCGCGCGCCCCGG - Exonic
1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG + Intronic
1009901434 6:69812124-69812146 TCCAGATGGCTTGCAAGCAAGGG + Intergenic
1012733545 6:102910904-102910926 GCCGGCGGGCCCGCAAGCCCGGG - Intergenic
1015665725 6:135626357-135626379 TCCAGCTGACCCAGAAGCCCAGG + Intergenic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG + Intergenic
1030024661 7:105311522-105311544 TCCACCTGGCCAACAAGCAAAGG + Intronic
1030324360 7:108204066-108204088 TCCAGATGGGAAGCAAGCACTGG + Intronic
1031728912 7:125273048-125273070 TACAAATGGCCAGCAAGCACAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1036123850 8:6045346-6045368 TCGCACGGGCCCGCAAGCACCGG + Intergenic
1037504762 8:19518754-19518776 TCCAGCTAGGCCGTCAGCACAGG + Intronic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1037999746 8:23381589-23381611 TACAGGTGGCCAGTAAGCACGGG - Intronic
1044853550 8:96452364-96452386 TCTTGCTGGCCAGCAAGCGCCGG - Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047161634 8:122387008-122387030 TCCAGTTGGCCCCCAGGCTCGGG + Intergenic
1051419721 9:16877316-16877338 GCCAGCAGGCCAGCAAGCCCCGG - Intergenic
1053015314 9:34658572-34658594 TCCAGCTGGCTCGCAGGCGTCGG - Exonic
1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG + Intronic
1061080196 9:128365262-128365284 TCCAGCAGGCCGGCCAGCCCGGG - Intergenic
1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG + Intronic
1062293089 9:135806253-135806275 TCCAGCTGGCCCACTTGTACTGG + Intergenic
1062425082 9:136502373-136502395 TGCTGCTGTCCCGCAAGCGCCGG - Exonic
1186334378 X:8570681-8570703 TCCATCTGCCCCACCAGCACCGG - Exonic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1190451850 X:50590048-50590070 TGCAACTGGCTAGCAAGCACAGG - Intergenic
1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG + Intergenic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1196811082 X:119629504-119629526 TGCAGCTGGCAGGGAAGCACAGG + Exonic
1200002360 X:153068636-153068658 TTCAGCTGGCCCCAAAGCACAGG - Intergenic
1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG + Intergenic
1200039077 X:153353079-153353101 TCCAAGTGCCCAGCAAGCACTGG - Intronic
1200955294 Y:8938368-8938390 TCATGCTGGCCCTCGAGCACTGG - Intergenic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic